SNP molecular marker on pig chromosome 6 associated with lean meat percentage of pig and application thereof

By identifying SNP molecular markers related to lean meat percentage on pig chromosome 6, and using primer pairs to detect and select dominant alleles, the problem of improving lean meat percentage in Duroc pigs in existing technologies has been solved, achieving a rapid and efficient breeding process and improved economic benefits.

CN117904307BActive Publication Date: 2026-06-09SOUTH CHINA AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311646241.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-04
Publication Date
2026-06-09
Estimated Expiration
2043-12-04

AI Technical Summary

Technical Problem

Existing technologies are insufficient to quickly and effectively increase the lean meat percentage of Duroc pigs, impacting the economic benefits and market demand of pig farming enterprises.

Method used

By identifying SNP molecular markers associated with lean meat percentage on pig chromosome 6, using primer pairs to detect and select dominant alleles, molecular marker-assisted selection breeding was carried out to increase the frequency of allele T generation by generation, thereby increasing lean meat percentage.

Benefits of technology

It significantly improves the lean meat percentage of Duroc pigs, shortens the breeding process, and increases the economic benefits and industrial chain value of breeding and production enterprises.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117904307B_ABST
    Figure CN117904307B_ABST
Patent Text Reader

Abstract

The present application belongs to the field of molecular biological technology and molecular marker technology, and particularly relates to a SNP molecular marker related to lean rate of pigs on chromosome 6 of pigs and application. The SNP site of the SNP molecular marker related to lean rate of pigs on chromosome 6 of pigs corresponds to C>T mutation at 47817566bp on chromosome 6 of international pig reference genome 11.1 version; the molecular marker is obtained by whole genome association analysis, and can significantly affect the lean rate of pigs at 100kg body weight. The present application further provides a primer pair for identifying the molecular marker, and the molecular marker and the primer pair can be used to establish high-efficiency and accurate molecular marker assisted breeding technology, which can be applied to genetic improvement of lean rate of pigs, and can finally realize improvement of economic benefits of breeding enterprises.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the fields of molecular biotechnology and molecular marker technology, specifically relating to a SNP molecular marker located on chromosome 6 of pigs that is associated with lean meat percentage and its application. Background Technology

[0002] Lean Meat Percentage (LMP) refers to the percentage of lean meat mass in the total carcass weight. In the "Technical Specification for Determination of Lean Meat Pig Carcass Traits" (NY / T825-2004), LMP is defined as the percentage of lean meat weight on the left side of the carcass after slaughter, relative to the combined weight of skin, bone, fat, and lean meat. LMP is a primary indicator for evaluating pig carcass quality in my country. Throughout the entire pig industry chain, LMP is also the standard for pricing pigs at the slaughtering and processing stages, directly impacting the economic benefits of pig farming enterprises and the overall economic value of the industry chain. Currently, the main direction of carcass grading technology both domestically and internationally is to improve the carcass grading system centered on LMP. With the development of biotechnology, combining molecular genetic methods such as Marker-Assisted Selection (MAS) and quantitative genetic methods such as Genome-wide Association Study (GWAS) for the selection of important and complex economic traits can effectively accelerate genetic progress, shorten generation intervals, and significantly improve the production performance of the herd.

[0003] Duroc pigs are one of the world's most popular commercial pig breeds. Through long-term artificial selection, they have achieved outstanding performance in growth rate, feed efficiency, and meat quality. In recent years, Duroc pigs have become the terminal sire for many mixed commercial lean meat breeds. Concentrated breeding of core Duroc pig populations to improve lean meat percentage traits and transfer their excellent genetic potential to commercial pig populations can effectively increase the lean meat percentage of commercial pigs, directly increasing the economic benefits of pig farming enterprises and further encouraging them to expand production to meet the growing consumer demand for lean meat. Summary of the Invention

[0004] To overcome the shortcomings and disadvantages of the prior art, the primary objective of this invention is to provide an SNP molecular marker located on chromosome 6 of pigs that is associated with lean meat percentage in pigs.

[0005] Another object of the present invention is to provide the application of the above-mentioned SNP molecular markers located on chromosome 6 of pigs that are associated with lean meat percentage in pigs.

[0006] Another object of the present invention is to provide a primer pair for identifying the above-mentioned molecular markers.

[0007] A fourth objective of this invention is to provide applications of the aforementioned primer pairs.

[0008] The fifth objective of this invention is to provide a method for genetic improvement of Duroc pigs.

[0009] The objective of this invention is achieved through the following technical solution:

[0010] A molecular marker of a SNP located on chromosome 6 of pigs that is associated with lean meat percentage in pigs, the SNP site of which corresponds to the C>T mutation at 47817566 bp on chromosome 6 of the International Pig Reference Genome 11.1 version;

[0011] The nucleotide sequence of the SNP molecular marker located on chromosome 6 of pigs that is associated with lean meat percentage is shown in SEQ ID NO.1, where M in the sequence is C or T, which leads to differences in the lean meat percentage trait of pigs;

[0012] The SNP site of the SNP molecular marker on pig chromosome 6 that is related to the lean meat percentage of pigs is the C107-T107 nucleotide mutation at position 107 of the sequence marked in SEQ ID NO:1 (a single base mutation at the 107th nucleotide of this sequence fragment, named: g.107C>T);

[0013] The aforementioned SNP molecular markers located on chromosome 6 of pigs and associated with lean meat percentage are used in the identification of lean meat percentage traits and genetic breeding of Duroc pigs;

[0014] A method for detecting the lean meat percentage trait in pork includes the following steps:

[0015] The above-mentioned SNP molecular markers on pig chromosome 6 that are related to lean meat percentage were detected, and it was determined whether the single nucleotide of the SNP site was C or T.

[0016] The preferred pigs are Duroc and its synthetic strains;

[0017] A primer pair for identifying the aforementioned SNP molecular markers located on chromosome 6 of pigs and associated with lean meat percentage, comprising primers primer-F and primer-R, has the following nucleotide sequence:

[0018] Upstream primer-F: 5'-TGGGAATTTTTGCGTGCCTC-3';

[0019] Downstream primer-R: 5'-TCTTGGACCGGAAACCTTGG-3';

[0020] The application of the primer pairs described above in identifying traits affecting lean meat percentage in breeding pigs;

[0021] Application of the primer pairs in marker-assisted breeding of pigs;

[0022] Application of the primer pairs in improving the lean meat percentage of breeding pigs;

[0023] A method for genetic improvement of pigs, comprising the following steps:

[0024] Identify the aforementioned SNP molecular markers on chromosome 6 of pigs in the core breeding pig population that are associated with lean meat percentage, and make corresponding selections based on these molecular markers: select breeding pigs with the TT genotype at 47817566 bp on chromosome 6 of the International Swine Reference Genome 11.1, and cull breeding pigs with the TC and CC genotypes at this locus, in order to increase the frequency of the T allele at this locus in each generation, thereby increasing the lean meat percentage of the offspring pigs;

[0025] The preferred pigs are Duroc and its synthetic strains;

[0026] The present invention has the following advantages and effects compared with the prior art:

[0027] (1) This invention studies and determines that the molecular markers related to the lean meat percentage of pigs are located on the nucleotide sequence of chromosome 6 of pigs, verifies their effect on the lean meat percentage trait of pigs, and finally establishes a molecular marker-assisted selection breeding technology for rapid improvement of the lean meat percentage trait of pigs, which greatly improves the breeding process of Duroc and its synthetic lines, meets the market demand for high lean meat type pigs, and increases the economic value of the entire industry chain.

[0028] (2) This invention provides a primer pair for SNP molecular markers located on chromosome 6 of pigs that are related to lean meat percentage. This primer pair enables the establishment of an efficient and accurate marker-assisted breeding technology, allowing for rapid and accurate selection of traits and accelerating the breeding process. Applying this technology to a genetic improvement program for lean meat percentage in pigs can significantly increase the lean meat percentage, thereby increasing the profits of livestock farming enterprises and enhancing their core competitiveness.

[0029] (3) This invention provides a method for pig breeding by selecting the dominant allele of the molecular marker, which can accelerate the genetic progress of Duroc pigs and shorten the generation interval. If this invention selects all CC-type individuals that affect the lean meat percentage trait of pigs into TT-type individuals, the lean meat percentage of each pig at 100kg body weight can be increased by 0.87%, and in a large-scale pig farm with 10,000 pigs, it can increase the lean meat by 8.7 tons. As a major pork producer and consumer, the potential to increase the lean meat percentage and provide benefits to the pig farming industry is enormous. Attached Figure Description

[0030] Figure 1 This is a genome-wide association (GWAS) diagram of Duroc on chromosome 6 regarding the lean meat percentage trait in breeding pigs at 100 kg body weight; where: the horizontal axis represents the chromosome number of the pig; the vertical axis represents the -logP value;

[0031] Figure 2 This is a graph showing the lean meat percentage of pigs with different genotypes at a weight of 100kg. Detailed Implementation

[0032] The present invention will be further described in detail below with reference to the embodiments and accompanying drawings, but the embodiments of the present invention are not limited thereto.

[0033] Experimental pig herd: A total of 3,769 Duroc pigs were used in this experiment.

[0034] Example 1 explains in detail the process of determining the effect of lean meat percentage in this invention.

[0035] The lean meat percentage of Duroc pigs after slaughter was determined using the New Zealand HGS (Hennessy Grading System). The pre-slaughter live weight was then corrected to 100 kg using a calibration formula. The experimental pig herd used in this invention consisted of 3769 purebred Duroc pigs from the breeding pig division of Guangdong Wens Foodstuff Group Co., Ltd., representing the core herd of the company, with detailed pedigree records. Duroc breeding pigs from this resource group were selected for this experiment. Under standardized feeding conditions, the pigs had free access to feed and water and were raised to a weight of 100 ± 5 kg.

[0036] Example 2 provides a detailed explanation of the invention process of the gene marker in this invention.

[0037] (1) DNA was extracted from Duroc pig ear-like tissue using the phenol-chloroform method as described in the standard. The DNA from the purebred Duroc population was tested for quality and concentration using a Nanodrop-ND1000 spectrophotometer. An A260 / 280 ratio of 1.8–2.0 and an A260 / 230 ratio of 1.7–1.9 were considered acceptable. Finally, the acceptable DNA samples were uniformly diluted to 50 nanograms per microliter.

[0038] (2) 50K SNP genotyping of the entire porcine genome: The GeneSeek Genomic Profiler Porcine 50K SNP genotyping platform was used, and microarray hybridization and result scanning were performed according to the Illumina Infinium user manual and standard procedures. Genotype data were then read using GenomeStudio software. To increase marker density and thus improve the success rate of identifying key mutation sites affecting the target trait, the SWIM database website was used to fill the genotype data. The obtained genotype-filled data were quality-controlled using PLINK v1.9, and data with a detection rate <90%, mimor allelfrequency (MAF) <1%, or deviation from Hardy-Weinberg equilibrium (HWE) P≤10 were excluded. -6 SNP markers were excluded, with a detection rate <95%, and SNPs located at unknown locations and on sex chromosomes were excluded. The remaining 7,442,761 SNP markers and 3,769 samples from the 100kg lean meat percentage quality control were used for subsequent data analysis.

[0039] (3) Genome-wide association analysis (GWAS): Due to the potential for false positives caused by kinship and population stratification effects, a kinship matrix needs to be constructed using GEMMA software before association analysis. Principal component analysis is then performed using GCTA software, with the first five principal components used as covariates to correct for population structure. Finally, GWAS analysis is conducted using a univariate mixture model in GEMMA software. This invention references the human genome significance threshold, setting the genome significance and chromosome significance thresholds to 5.00E-08 and 1.00E-06, respectively.

[0040] GWAS analysis results are as follows Figure 1 As shown. From Figure 1 It is known that in Duroc, there is a locus on chromosome 6 that significantly affects the lean meat percentage per 100 kg, with the strongest association SNP being g.107C>T (P = 3.35 × 10⁻⁶). -11 (The 107th nucleotide in SEQ NO.1 corresponds to the C>T mutation at 47817566 bp on chromosome 6 in International Pig Reference Genome Version 11.1).

[0041] (4) Association analysis between different genotypes and the lean meat percentage phenotype of breeding pigs at 100kg body weight: According to Table 1, the SNP site g.107C>T of the molecular marker was significantly correlated with the lean meat percentage trait (P<0.01), indicating that this molecular marker significantly affects the lean meat percentage of pigs. Assisted selection at this SNP site in pigs can improve the lean meat percentage of the population, thereby accelerating the breeding process of lean-type breeding pigs. Furthermore, according to Table 1, Figure 2It was also found that the CC type had a lower lean meat percentage than the TC and TT types, indicating that TT is the dominant genotype for the lean meat percentage trait. Lean meat percentage is an important indicator of carcass quality in breeding pigs; a high lean meat percentage indicates good carcass quality. Therefore, in the breeding process, we need to gradually eliminate CC and TC type breeding pigs and retain TT type breeding pigs to increase the frequency of the T allele at this locus through each generation.

[0042] Table 1. Correlation between SNP sites of molecular markers (g. 107C>T) and traits.

[0043]

[0044] Example 3 explains in detail the invention process of detecting SNP markers.

[0045] (1) The target fragment containing the SNP site that is significantly associated with the lean meat percentage performance of Duroc at 100kg body weight is a 589bp nucleotide sequence on chromosome 6. The upstream and downstream primers for sequence amplification are primer-F (SEQ ID NO.2) and primer-R (SEQ ID NO.3), and their nucleotide sequences are as follows:

[0046] Upstream primer-F: 5'-TGGGAATTTTTGCGTGCCTC-3';

[0047] Downstream primer primer-R: 5'-TCTTGGACCGGAAACCTTGG-3'.

[0048] (2) PCR amplification system and conditions

[0049] Prepare a 10 μL system, including 1 μL DNA sample, 0.3 μL upstream primer, 0.3 μL downstream primer, 5 μL PCR mix, and 3.4 μL ddH2O. The PCR conditions are: 95℃ pre-denaturation for 5 min, 95℃ denaturation for 30 s, 64℃ annealing for 30 s, 72℃ extension for 30 s, for a total of 35 cycles, and a final extension at 72℃ for 5 min.

[0050] (3) DNA Sequence Sequencing Identification: Sequencing was performed at BGI Genomics Co., Ltd. in Shenzhen, with two sequencing reactions for each gene fragment. The obtained sequences were compared with the NCBI genome sequence to identify mutations at corresponding SNP sites. The sequencing results are shown below:

[0051] TGGGAATTTTTGCGTGCCTCTGGTGCAGCTAGAGAGAGAGAGATCCTTAGGTATTTGGTTATGTTTCAACCCCAGCCAGTGAGATTCTTCAGGGTGTCCAAATA M(C / T)CTTCTCTACATGTTCTTTATTGCCATATGTGTCATTTCTGACTAATTTAATAGCCCTCATCACACACAAAAAAAGCAACAAGGAGTTCCCGTTGTGGCGCAGTAGTTAACGAATCCGACTAGCAACCATGAGGATGTGGGTTCGATCCCTGGCCTCGCTCAGTGGGTTAAGTGGCATTGCTGTGAGCTGTGGTGTAGGTCGCAGATGTGGCTCGGATCTGGCTTGGCTGTGGCTGTGGCTG TGGTATAAGCCGGCAGCTGCAGCTCCGATTCAACCCCTCGCCAGGGAACTTTCATATGTCGCAGGTGCGGCCCTAGAAAGAAAAATAAAAAGTCAGGGGGCCCTACCCCGACAGCCCTGCCATCCTGGCTTAGAGAACTTCCAGGAAAGTGGTCCAGAAGGCAGGGCCCACCTCCTGGTATAAGGATACACCTAATGGGGTGTGAGAGAGTCACGTGGGCACCAAGGTTCCGGTCCAAGA

[0052] Note: M marked in the sequence is the mutation site, indicated by an underline (the mutated base in parentheses represents the allele mutation). The beginning and end of the sequence are bolded to indicate the primer binding position.

[0053] Example 4: Analysis of the g.107C>T effect of SNP sites on molecular markers

[0054] This invention provides a SNP molecular marker that can significantly improve the lean meat percentage of Duroc pigs. Using this SNP molecular marker for marker-assisted selection can greatly accelerate the lean meat percentage breeding process in Duroc pigs. If this invention selects all CC-type individuals of the molecular marker affecting the lean meat percentage trait into TT-type individuals, the lean meat percentage per pig at 100kg body weight can be increased by 0.87%, resulting in an additional 8.7 tons of lean meat in a large-scale pig farm with 10,000 pigs. As a major pork producer and consumer, the potential for increasing lean meat percentage to improve the profitability of the pig farming industry is enormous. By selecting the dominant allele (T) of this SNP in Duroc pigs, the economic benefits of pig farming enterprises can ultimately be improved, contributing to the vigorous development of China's pig farming industry.

[0055] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention.

Claims

1. The application of a SNP molecular marker located on pig chromosome 6 that is associated with lean meat percentage in the identification of lean meat percentage trait and the genetic improvement of lean meat percentage in pigs, characterized in that... The nucleotide sequence of the SNP molecular marker on chromosome 6 of pigs that is associated with lean meat percentage is shown in SEQ ID NO.1, where M in the sequence is C or T, which leads to differences in the lean meat percentage trait. The CC genotype has a lower lean meat percentage than the TC and TT genotypes, and the TT genotype is the dominant genotype for the lean meat percentage trait. The pigs mentioned are Duroc and its synthetic strains.

2. A method for detecting the lean meat percentage trait in pork, characterized in that, It includes the following steps: The detection of SNP molecular markers on pig chromosome 6 as described in claim 1, which are associated with lean meat percentage, wherein the nucleotides of the SNP molecular markers are C or T; the CC genotype has a lower lean meat percentage than the TC and TT genotypes, and the TT genotype is the dominant genotype for the lean meat percentage trait; The pigs mentioned are Duroc and its synthetic strains.

3. The application of a primer pair in identifying the lean meat percentage trait in breeding pigs, characterized in that: The primer pair is used to identify the SNP molecular marker of claim 1, and includes primers primer-F and primer-R, whose nucleotide sequences are as follows: Upstream primer-F: 5'-TGGGAATTTTTGCGTGCCTC-3'; Downstream primer-R: 5'-TCTTGGACCGGAAACCTTGG-3'; The CC genotype of the SNP molecular marker had a lower lean meat percentage than the TC and TT genotypes, and the TT genotype was the dominant genotype for the lean meat percentage trait. The pigs mentioned are Duroc and its synthetic strains.

4. The application of a primer pair in marker-assisted breeding of pigs, characterized in that: The primer pair is used to identify the SNP molecular marker of claim 1, and includes primers primer-F and primer-R, whose nucleotide sequences are as follows: Upstream primer-F: 5'-TGGGAATTTTTGCGTGCCTC-3'; Downstream primer-R: 5'-TCTTGGACCGGAAACCTTGG-3'; The CC genotype of the SNP molecular marker had a lower lean meat percentage than the TC and TT genotypes, and the TT genotype was the dominant genotype for the lean meat percentage trait. The pigs mentioned are Duroc and its synthetic strains.

5. A method for genetic improvement of pigs, characterized in that, It includes the following steps: Identify the SNP molecular markers on chromosome 6 of pigs in the core breeding pig population that are related to lean meat percentage, as described in claim 1, and make selections based on the molecular markers: select breeding pigs with the TT genotype of the SNP molecular markers described in claim 1 for successive generations, eliminate breeding pigs with the TC and CC genotypes, and increase the frequency of the allele T at the mutation site in each generation to increase the lean meat percentage of the offspring pigs. The pigs mentioned are Duroc and its synthetic strains.