KASP molecular markers for identifying corbicula fluminea and corbicula fluminea and their application

Abstract

The present application belongs to the field of modern agricultural technology, and particularly relates to KASP molecular markers for identifying Corbicula fluminea and Cyclotella meneghiniana and application thereof. The present application develops the molecular markers based on KASP technology, which can accurately identify Corbicula fluminea and Cyclotella meneghiniana. The specific KASP primers provided by the present application can be used to detect Corbicula fluminea and Cyclotella meneghiniana, and the method is simple, easy to use, high in analysis flux and high in accuracy, and is suitable for detecting a large number of samples. The molecular markers provided by the present application can quickly and accurately screen Corbicula fluminea and Cyclotella meneghiniana, and can provide solid technical support for formulating and implementing targeted biodiversity protection and environmental management strategies.

Description

Technical Field

[0001] This invention belongs to the field of modern agricultural technology, specifically relating to the KASP molecular marker for identifying river clams and ringed clams and its application. Background Technology

[0002] River clams ( Corbicula fluminea ) and ringed clam ( Corbicula leana These two types of clams are freshwater mollusks of significant value in aquaculture, food consumption, and ecological monitoring. However, their morphological similarity makes accurate differentiation difficult using only the naked eye or traditional morphological methods. Corbicula The shell morphology of this genus exhibits significant plasticity, with its shape, size, and growth lines changing dramatically due to environmental influences. This phenotypic variability leads to unreliable morphological identification results, making misjudgments highly likely and consequently impacting subsequent ecological research, industry management, and species conservation efforts.

[0003] To overcome the limitations of morphological identification, researchers have turned to molecular biology methods for species identification. Commonly used molecular marker methods include sequencing or enzyme digestion analysis of mitochondrial genes, such as cytochrome c oxidase subunit I (COI) and cytochrome b (Cytb). However, these methods often have several shortcomings. For example, the traditional restriction fragment length polymorphism (PCR-RFLP) method is complex, requiring multiple steps such as PCR amplification, enzyme digestion, and gel electrophoresis. These steps not only require high technical expertise but are also time-consuming, hindering the rapid processing of large-scale samples. Furthermore, the high cost of DNA sequencing limits its application in high-throughput, large-volume identification projects. Other traditional methods are also relatively expensive due to the required reagents and labor, and many traditional molecular marker methods cannot be automated, detecting only a few gene loci at a time. Therefore, they are not suitable for high-throughput identification needs requiring rapid screening of tens of thousands of samples. Summary of the Invention

[0004] To address the aforementioned technical challenges, this invention utilizes unique SNP markers discovered in the mitochondrial genomes of *Clams maculatus* and *Clams circinus* to develop a molecular marker method based on KASP (Kompetitive Allele Specific PCR) technology. This method distinguishes different alleles through the competitive binding of specific primers and fluorescent probes. Thanks to its superior characteristics, KASP technology enables rapid, high-throughput sample detection, significantly shortening identification time and making it ideal for large-scale species surveys and monitoring projects. Compared to traditional sequencing and enzyme digestion methods, KASP has lower single-sample detection costs and a very simple operation procedure, making it an ideal choice for routine identification work.

[0005] The first aspect of the present invention is to provide SNP molecular markers for identifying river clams or ringed clams.

[0006] The second aspect of the present invention aims to provide the application of substances that detect the SNP molecular markers described in the first aspect of the present invention in the identification of river clams or ringed clams.

[0007] The third aspect of this invention is to provide a product.

[0008] A fourth aspect of the present invention is to provide a reagent or kit.

[0009] The fifth aspect of this invention aims to provide an application.

[0010] The sixth aspect of this invention aims to provide a method for identifying and screening river clams or ringed clams.

[0011] To achieve the above-mentioned objectives of this invention, the technical solution adopted by this invention is as follows: In a first aspect, the present invention provides an SNP molecular marker for identifying river clams or ringed clams, the molecular marker being: AAAGCTGATTTGAATGAGGTAGTTTATGAAAGGAGGCGGGATAGTGTGGGTGAAGAAGTTATTGCTTTGGCTGGTTATAT

A / G

[0012] Specifically as follows: > Corbicula fluminea: AAAGCTGATTTGAATGAGGTAGTTTATGAAAGGAGGCGGGATAGTGTGGGTGAAGAAGTTATTGCTTTGGCTGGTTATAT A GGAGTTGAAGATCGATTAAAAGATTTTGGTCCTGTAACAGAAGGAGGGACTATTGAAGATTTTATGTTTAGGTG (SEQ ID NO: 1).

[0013] > Corbicula leana: AAAGCTGATTTGAATGAGGTAGTTTATGAAAGGAGGCGGGATAGTGTGGGTGAAGAAGTTATTGCTTTGGCTGGTTATAT G GGAGTTGAAGATCGATTAAAAGATTTTGGTCCTGTAACAGAAGGAGGGACTATTGAAGATTTTATGTTTAGGTG (SEQ ID NO: 2).

[0014] A second aspect of the present invention provides the use of substances that detect the SNP molecular markers described in the first aspect of the present invention in the identification of river clams or ringed clams.

[0015] In some embodiments of the present invention, the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: Northern blotting, PCR, gene chip method, and nucleic acid sequencing.

[0016] A third aspect of the invention provides a product comprising a substance for detecting the SNP markers described in the first aspect of the invention.

[0017] In some embodiments of the present invention, the substance comprises a substance for use in one or more detection techniques or methods selected from the group consisting of: Northern blotting, PCR, gene chip method, and nucleic acid sequencing.

[0018] In some embodiments of the present invention, the product comprises at least one of a reagent, a reagent kit, a test strip, a chip, or a system.

[0019] In some embodiments of the present invention, the product comprises primer pairs for amplifying SNP molecular markers of the first aspect of the present invention.

[0020] In some embodiments of the present invention, the nucleotide sequence of the upstream primer of the primer pair is shown in SEQ ID NO: 3 or 4: The upstream primer used to detect river clam (A) is: 5'-AGTTATTGCTTTGGCTGGTTATATA-3' (SEQ ID NO: 3).

[0021] The upstream primer used for detecting Cyprinus annularis (G) is 5'-AGTTTATTGCTTTGGCTGGTTATATG-3' (SEQ ID NO: 4).

[0022] In some embodiments of the present invention, the nucleotide sequence of the downstream primer of the primer pair is 5'-ACCTAAACATAAAATCTTCAATAG-3' (SEQ ID NO: 5).

[0023] In some embodiments of the present invention, the 5' or 3' of the upstream primer has a fluorescent group selected from one of FAM, HEX, ROX, TET, JOE, TAMRA, Cy3, and Cy5.

[0024] A fourth aspect of the present invention provides a reagent or kit comprising the primer pairs described in the third aspect of the present invention.

[0025] In some embodiments of the present invention, the kit further comprises DNA polymerase, dNTPs, PCR buffer, and Mg. 2+ At least one of them.

[0026] A fifth aspect of the invention provides the use of the products, reagents, or kits described in the third and fourth aspects of the invention in 1) to 3): 1) Identification of river clams and ringed clams; 2) Monitoring and surveying of species in aquatic environments; 3) Food traceability or quality control of related products.

[0027] A sixth aspect of the present invention provides a method for identifying and screening river clams or ringed clams, comprising the following steps: Extract the genome from the sample, and use the products, reagents or kits described in the third and fourth aspects of this invention to detect the amplification products and analyze the results.

[0028] In some embodiments of the present invention, the test sample of genotype A is river clam, and the test sample of genotype G is ringed clam.

[0029] Specifically, it includes the following steps: 1. Genomic DNA was extracted from the river clam and the ringed clam to be tested; 2. Dilute the DNA from step (1) to 18–22 ng / μL (preferably 20 ng / μL) as a template, and add specific KASP Primer mix and universal KASP Master mix to it for PCR amplification.

[0030] 3. PCR products were analyzed using fluorescence detection. The KASP Primer mix contains the KASP primers; one fluorescent adapter is added to the 5' end of Primer X, and another fluorescent adapter is added to the 5' end of Primer Y, preferably FAM (carboxyfluorescein) or HEX (hexachlorofluorescein) fluorescence.

[0031] Primer X: 5'-AGTTATTGCTTTGGCTGGTTATATA-3' (SEQ ID NO: 3); Primer Y: 5'- AGTTATTGCTTTGGCTGGTTATATG -3' (SEQ ID NO: 4); Reverse primer: 5'-ACCTAAACATAAAATCTTCAATAG-3' (SEQ ID NO: 5); The KASP Master mix contains the following components: universal TRET cassette fluorescent primers, ROX internal control dye, KlearTaq DNA polymerase, dNTPs, and MgCl₂. 2+ Optionally, the KASP Master mix is ​​a product of LGC Ltd. in the UK. The product catalog number is KBS-1016-002.

[0032] Step (2) The PCR reaction system is as follows: template DNA 5 μL, KASP Primer mix 5 μL, KASP Mastermix 0.14 μL. The PCR reaction program is as follows: 94℃ for 15 minutes, 94℃ for 20 seconds, 65℃-56℃ for 60 seconds, with the annealing extension temperature decreasing by 0.8℃ for each cycle, for 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, for 30 cycles.

[0033] Step (3) After the PCR reaction is completed, the fluorescence signal of the reaction system is scanned using ARAYA; then, data analysis and genotyping are performed using INTELLICS. Analyze the SNP sites of the PCR amplification products. If fluorescence corresponding to Primer X is detected in the amplification products, the base at that site is the "A" genotype, corresponding to the river clam; if fluorescence corresponding to Primer Y is detected in the amplification products, the base at that site is the "G" genotype, corresponding to the ringed clam.

[0034] The beneficial effects of this invention are: This invention utilizes molecular markers developed based on KASP technology to accurately identify *Clams maculatus* and *Clams annularis*. The specific KASP primers provided by this invention enable the detection of *Clams maculatus* and *Clams annularis*, offering ease of use, high analytical throughput, and high accuracy, suitable for large-scale sample analysis. The molecular markers provided by this invention can rapidly and accurately screen for *Clams maculatus* and *Clams annularis*, providing solid technical support for the formulation and implementation of targeted biodiversity conservation and environmental management strategies. Attached Figure Description

[0035] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein: Figure 1 The identification results of the river clam and the ringed clam are for the present invention. Detailed Implementation

[0036] The following will describe the concept and technical effects of the present invention clearly and completely with reference to embodiments, so as to fully understand the purpose, features and effects of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Other embodiments obtained by those skilled in the art based on the embodiments of the present invention without creative effort are all within the scope of protection of the present invention.

[0037] Example 1: Development of molecular markers for identifying river clams and ringed clams 1. High-multiplier resequencing was performed on both freshwater clams and ringed clams. Adductor muscles from 20 freshwater clams and 20 ringed clams were collected, and DNA was extracted using the phenol-chloroform method. The extracted DNA samples were subjected to paired-end resequencing by BGI Genomics using the Illumina Xten platform. The sequenced read length was 150 bp, and the sequencing depth was 10×.

[0038] 2. Specific sequence analysis of *Clams maculatus* and *Clams circinata*. Sequence data from 20 freshwater clams and 20 ringed clams were aligned to the freshwater clam reference mitochondrial genome OR521035.1 (NCBI accession) using the bwa (v0.7.17-r1188) software. Based on the sequence alignment results, SNP markers between freshwater clams and ringed clams were identified.

[0039] > Corbicula fluminea: AAAGCTGATTTGAATGAGGTAGTTTATGAAAGGAGGCGGGATAGTGTGGGTGAAGAAGTTATTGCTTTGGCTGGTTATAT A GGAGTTGAAGATCGATTAAAAGATTTTGGTCCTGTAACAGAAGGAGGGACTATTGAAGATTTTATGTTTAGGTG (SEQ ID NO: 1).

[0040] > Corbicula leana: AAAGCTGATTTGAATGAGGTAGTTTATGAAAGGAGGCGGGATAGTGTGGGTGAAGAAGTTATTGCTTTGGCTGGTTATAT GGGAGTTGAAGATCGATTAAAAGATTTTGGTCCTGTAACAGAAGGAGGGACTATTGAAGATTTTATGTTTAGGTG (SEQ ID NO: 2).

[0041] 3. Development of the KASP tag Based on the SNP marker between *Clamus maculatus* and *Clamus annuus*, flanking sequences of this marker site were analyzed for copy number and GC content to ensure that the site met the high success rate characteristics for KASP marker identification. This site was then designed as a KASP marker. Based on the characteristics of SNP mutation information, a set of competitive allele-specific PCR primers was designed, including Primer X, Primer Y, and reverse primers. The two forward primers have allelic variant bases A / G at their ends, and the reverse primer sequence selection ensures that the amplified fragment is between 60-120 bp. Fluorescent tag sequences are attached to the 5' ends of the forward primers; Primer X has a fluorescent sequence tag attached to one type, and Primer Y has a fluorescent sequence tag attached to another type.

[0042] Primer sequence information is shown in Table 1.

[0043] Table 1

[0044] The primer sequences described above were all synthesized by Wuhan Tianyi Huiyuan Biotechnology Co., Ltd. The KASP genotyping method provided by this invention offers high throughput and is simple to operate. It only requires adding the specific KASP Primer mix and the universal KASP Master mix to a PCR microplate containing a DNA sample for PCR amplification. The final results can be analyzed using a fluorescence detector.

[0045] Example 2: Verification of molecular marker identification of river clams and ringed clams 1. Experimental Methods Thirty-nine freshwater clams and 55 ringed clams were collected, and genomic DNA was extracted from 94 freshwater clams and ringed clams using the phenol-chloroform method; the DNA concentration was diluted to 20 ng / μL as a template.

[0046] PCR amplification reaction system: template DNA 5μL, KASP Primer mix 5μL, KASP Master mix 0.14μL.

[0047] PCR reaction conditions: Template DNA 5 μL, KASP Primer mix 5 μL, KASP Master mix 0.14 μL. The PCR reaction program was as follows: 94℃ for 15 minutes; 94℃ for 20 seconds, 65℃–56℃ for 60 seconds, with the annealing extension temperature decreasing by 0.8℃ per cycle, for 10 cycles; 94℃ for 20 seconds, 57℃ for 60 seconds, for 30 cycles.

[0048] Fluorescence scanning of PCR amplification products: The fluorescence signal of the reaction system was scanned using ARAYA; then data analysis and genotyping were performed using INTELLICS.

[0049] Results analysis: A red fluorescent signal indicates a genotype of "A" at that locus, thus identifying the sample as *Clams maculatus*. A blue fluorescent signal indicates a genotype of "G" at that locus, thus identifying the sample as *Clams annuus*.

[0050] Specific results are as follows Figure 1 As shown in Table 2, this marker achieved excellent typing results in identifying river clams and ringed clams, and the typing results were highly consistent.

[0051] Table 2

[0052] The embodiments of the present invention have been described in detail above with reference to the accompanying drawings. However, the present invention is not limited to the above embodiments, and various changes can be made within the scope of knowledge possessed by those skilled in the art without departing from the spirit of the present invention. Furthermore, the embodiments of the present invention and the features thereof can be combined with each other unless otherwise specified.

Claims

1. Application of primer pairs for detecting SNP molecular markers in the identification of river clams or ringed clams; The SNP molecular marker is located at position 81 of the sequence shown in SEQ ID NO: 1 or 2, and the SNP polymorphism is A / G. The sample with genotype A was a river clam, and the sample with genotype G was a ringed clam.

2. The application according to claim 1, characterized in that: The nucleotide sequences of the upstream primers of the primer pair are shown in SEQ ID NO: 3 and 4; The nucleotide sequence of the downstream primer of the primer pair is shown in SEQ ID NO:

5.

3. A method for identifying and screening river clams or ringed clams, comprising the following steps: Extract the genome from the sample, use the primer pair for detecting the SNP molecular markers described in claim 1 or 2 to obtain the amplification products, and analyze the results; The sample with genotype A was a river clam, and the sample with genotype G was a ringed clam.

Images