A modified gRNA and a method for producing heat tolerant dairy cows by gene editing

By designing modified gRNA and RNP electrotransfection technology, combined with HDR method, the precise editing of bovine PRLR gene was achieved, which solved the problem of low efficiency in producing heat-resistant cattle in existing technologies, and produced heat-resistant dairy cows with heat adaptability and short hair characteristics.

CN121160698BActive Publication Date: 2026-04-10INST OF ANIMAL SCI & VETERINARY MEDICINE SHANDONG ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-26
Publication Date
2026-04-10

Smart Images

  • Figure CN121160698B_ABST
    Figure CN121160698B_ABST
Patent Text Reader

Abstract

This invention discloses a modified gRNA and a method for producing heat-resistant dairy cows through gene editing, belonging to the field of genetic engineering technology. The gRNA is composed of an sgRNA sequence linked to a scaffold sequence at the 3' end. Modification includes adding a reverse deoxythymidine to the 3' end of the sgRNA sequence, introducing a phosphate thioester bond at the 5' end, and also includes a PNA sequence. The modified gRNA sequence itself has a gene editing rate as high as 56.02%. After modification, combined with a specific PNA sequence, the gene editing efficiency reaches 88.60%, enabling efficient and precise editing of the PRLR gene. The resulting PRLR gene carries the chr20:39099191-39099267_77bp_del mutation and has a p.Ala464* truncated amino acid sequence. ‑ / ‑ Somatic cell nuclear transfer of embryos has significantly improved the success rate of producing gene-edited cattle.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of genetic engineering, and particularly relates to a modified gRNA and a method for producing heat-resistant dairy cows through gene editing. BACKGROUND

[0002] Cattle are sensitive to high temperature and high humidity environment, and are prone to heat stress, which has a negative impact on their growth, lactation, reproduction, health and other traits. It is estimated that heat stress causes an economic loss of 2.5 billion US dollars per year to the livestock industry. Due to global warming, the harm of heat stress to livestock is likely to intensify, leading to a shortage of animal food and threatening food security. How to deal with the problem of heat stress caused by high temperature and high humidity environment is still a worldwide problem.

[0003] From the perspective of genetic improvement, breeding or creating heat-resistant cattle germplasm is an important way to ultimately solve the problem of the industry. The Senepol, a local cattle breed from the Americas, has short and sparse hair, smooth hair, and other characteristics, and its heat tolerance is better than that of other breeds. By crossing with these breeds, the ability of cattle to regulate body temperature in high temperature environment can be improved, and new heat-resistant germplasm can be bred. However, in order to stabilize the excellent traits of the original germplasm, decades of breeding of multiple generations are needed.

[0004] Littlejohn et al. found that the functional mutation of the short hair trait of Senepol cattle is located in the 11th exon of the prolactin receptor (RPLR) gene, i.e. chr20: 39136558GC>G (genomic data version Bos taurus UMD3.1) causes a premature termination (p.Leu462 (Littlejohn MD, Henty KM, Tiplady K, et al. Functionally reciprocal mutations of the prolactin signalling pathway define hairy and slick cattle. Nat Commun. 2014. 18;5:5861). It was reported that dairy cows carrying this natural mutation by crossing with Senepol cattle have good heat adaptation, and their yield is not affected by high temperature in summer (Dikmen S, Khan FA, Huson HJ, et al. The SLICK hair locus derived from Senepol cattle confers thermotolerance to intensively managed lactating Holstein cows. J Dairy Sci. 2014. 97(9):5508-20), which provides a new strategy for breeding heat-resistant germplasm. At the same time, the discovery of functional mutations of heat-resistant performance also provides important genetic resources for creating heat-resistant gene editing cattle germplasm. The U.S. Food and Drug Administration (FDA) has given a low safety risk evaluation for PRLR gene editing cattle related products, so this gene editing cattle has broad industrial application prospects.

[0005] The PRLR-mediated prolactin signaling pathway has physiological functions such as promoting mammary gland development and growth, stimulating and maintaining lactation, and regulating hair growth. The domain distribution of PRLR protein in the cell has multiple tyrosine phosphorylation modification sites responsible for transmitting the signal of prolactin binding. The p.Leu462 The truncation mutations are located between p.Y407, p.Y427, p.Y431, p.Y433, p.Y512 and p.Y543, which retain the upstream tyrosine phosphorylation modification sites, so that the signal pathway still has partial function (Porto-Neto LR, Bickhart DM, Landaeta-Hernandez AJ, et al. Convergent Evolution of Slick Coat in Cattle through Truncation Mutations in the Prolactin Receptor. Front Genet. 2018. 23;9:57). Therefore, only the precise editing of the site can achieve the purpose of constructing heat-resistant gene editing germplasm under the premise of retaining the important physiological function of PRLR, which is the difficulty in the current production of gene editing cattle. SUMMARY

[0006] The purpose of the present application is to provide a modified gRNA which can precisely edit the site of PRLR gene, and then be used for producing PRLR gene p.Leu462 The truncated natural mutation has the same effect on heat-resistant dairy cows, and a new heat-resistant germplasm is bred.

[0007] The technical scheme of the present application is described in detail as follows:

[0008] In the first aspect, the present application provides a modified gRNA, which is composed of the 3' end of sgRNA sequence shown in SEQ ID NO: 1 connected with the scaffold sequence shown in SEQ ID NO: 2;

[0009] The modification includes adding 3' Inverted Deoxythymidine (3' idT) at the 3' end of the sgRNA sequence and introducing 5' Phosphorothioate (PS) Linkages between the 3 bases at the 5' end; and further including the PNA sequence shown in SEQ ID NO: 3. The PNA sequence is a complementary sequence designed for the sequence upstream of the PAM region of the sgRNA sequence.

[0010] SEQ ID NO: 1: TCCTTCCCTGCCAGTTTCAA;

[0011] SEQ ID NO: 2: gttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgc.

[0012] SEQ ID NO:3: aaactggcagggaagga.

[0013] The gRNA (guide RNA) is composed of two parts: sgRNA (single guide RNA) sequence and scaffold sequence. The sgRNA is responsible for recognizing and guiding the Cas9 protein to cut the target DNA sequence, and the scaffold is used to bind with the Cas9 protein and improve the editing efficiency. The 3' end of the sgRNA is connected with the Scafflod sequence to form the gRNA.

[0014] Optionally or preferably, the modified gRNA described above further adds 2'-O-methyl in the seed sequence cagttta of the sgRNA.

[0015] In a second aspect, the application provides the use of the modified gRNA described above in the production of PRLR gene mutation heat-resistant dairy cows.

[0016] In a third aspect, the application provides a method for producing heat-resistant dairy cows by gene editing, comprising the following steps:

[0017] (1) The modified gRNA, Cas9 protein and reporter gene vector described above are introduced into bovine BFF cells by RNP electroporation, and positive clone cells are obtained by reporter gene expression screening;

[0018] (2) The DNA of the positive clone cells is extracted for sequencing, and PRLR - / - gene editing BFF cells, PRLR gene is based on the bovine ARS-UCD2.0 version;

[0019] (3) The PRLR - / - gene editing BFF cells are injected into the perivitelline space under the zona pellucida of the enucleated mature donor oocyte to obtain reconstructed embryos, 5-10 reconstructed embryos are used as a group for embryo fusion and activation, and then cultured in vitro, and the non-cleavage embryos are removed during the culture process to obtain PRLR - / - somatic cell nuclear transfer embryos;

[0020] (4) The PRLR - / - somatic cell nuclear transfer embryos are transplanted into the uterus of a recipient cow in estrus by non-surgical method, and the calf produced is a PRLR gene site mutation heat-resistant dairy cow.

[0021] Optionally or preferably, in the above method, the dairy cow is a Holstein cow.

[0022] In a fourth aspect, the present application provides another method for producing heat-tolerant dairy cows through gene editing, comprising the following steps:

[0023] (1) introducing the modified gRNA, Cas9 protein, reporter gene and donor DNA fragment vector with chr20: 39099191-39099267_77bp_del mutation of claim 1 or 2 into bovine BFF cells by RNP electroporation, and obtaining PRLR with chr20: 39099191-39099267_77bp_del mutation through report gene expression screening - / - gene editing BFF cells;

[0024] The nucleotide sequence of the donor DNA fragment is shown in SEQ ID NO: 4;

[0025] (2) injecting the PRLR - / - gene edited BFF cells into the perivitelline space of the enucleated mature donor oocyte, obtaining a reconstructed embryo, 5-10 reconstructed embryos are used as a group for embryo fusion and activation, and then cultured in vitro, and the non-cleavage embryos are removed during the culture process, obtaining PRLR - / - somatic cell nuclear transfer embryo;

[0026] (3) PRLR - / - somatic cell nuclear transfer embryo is transplanted into the uterus of a recipient cow in estrus by a non-surgical method, and the calf produced is a PRLR gene site mutation heat-tolerant dairy cow.

[0027] The donor DNA fragment deletes 77 bases of chr20: 39099191-39099267, and the purpose is to efficiently and accurately obtain BFF cells with chr20: 39099191-39099267_77bp_del mutation through HDR.

[0028] Compared with the prior art, the present application has the following beneficial effects:

[0029] The gene editing (insertion and deletion) efficiency of the gRNA sequence provided by the present application is as high as 56.02%, and after modification, combined with the PNA sequence provided by the present application, the gene editing efficiency reaches 88.60%, which can efficiently and accurately edit the PRLR gene, and then retain the upstream modification sites p.Y407, p.Y427, p.Y431 and p.Y433 of the PRLR gene, and delete the downstream modification sites p.Y512 and p.Y543 of the PRLR gene. The cleavage proportion and blastocyst development rate of the obtained mutant cells are higher than those of wild type embryo cells, which effectively improves the production success rate of gene edited cows.

[0030] In addition, the donor DNA fragment provided by the present application can directly introduce the chr20:39099191-39099267_77bp_del mutation site into the PRLR gene of Holstein cow through homology-mediated repair, thereby further improving the success rate of gene editing of cows.

[0031] The PRLR gene site mutation heat-resistant cow produced by the method of the present application has the same phenotype as the p.Leu462 The truncated mutation (natural mutation) has the same phenotype, does not affect the tyrosine phosphorylation signal pathway, and has a short hair characteristic and good heat adaptation. BRIEF DESCRIPTION OF DRAWINGS

[0032] Figure 1 It is an agarose gel electrophoresis map of the PCR product of the mixed sample cells in Example 1. Note: 1-3: gRNA1 group; 4-6: gRNA2 group; 7-9: gRNA3 group; 10: water, negative control group.

[0033] Figure 2 It is a statistical result map of the gene editing efficiency of the three groups of gRNA in Example 1.

[0034] Figure 3 It is a statistical result map of the Indel efficiency of the gRNA added with different modifications in Example 2.

[0035] Figure 4 It is a sequencing peak map of the 10# homozygous monoclonal cells in Example 3.

[0036] Figure 5 It is a culture photo of the 10# homozygous monoclonal cells in Example 3.

[0037] Figure 6 It is a comparison of the amino acid sequences of different PRLR genotypes in Example 3.

[0038] Figure 7 It is a photo of the construction and development process of the PRLR gene edited embryo in Example 4, wherein A is the micro-operation process of constructing the PRLR gene edited somatic cell nuclear transfer embryo; B is the PRLR gene edited embryo developed to the blastocyst stage.

[0039] Figure 8 It is a photo of the appearance characteristics of the PRLR - / - and PRLR + / + somatic cell nuclear transfer calf. DETAILED DESCRIPTION

[0040] For those skilled in the art to better understand the present application, the present application will be described clearly and completely in conjunction with the embodiments and drawings. Obviously, the described embodiments are only a part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor should fall within the scope of protection of the present application. The instruments and reagents used in the embodiments are from commercial channels, unless otherwise specified.

[0041] Example 1 Screening of high-efficiency gRNA near bovine PRLR gene chr20: 39099213 GC>G

[0042] 1.1 Precise positioning of bovine PRLR gene chr20: 39136558 GC>G

[0043] It has been previously reported that, based on the Bos taurus UMD3.1 (GCA_000003055.5) genome data, the mutation site of the PRLR gene related to the short hair trait of cattle is chr20: 39136558 GC>G; based on NM_001039726.2, the mutation site in the CDS region is c.1381 GC>G; and based on NP_001034815, the amino acid mutation type is p.A461V, and p.L462 , a truncation mutation occurs.

[0044] In the present application, based on the ARS-UCD2.0 version of the genome data of cattle, the site chr20: 39136558 GC>G is repositioned to chr20: 39099213 GC>G; based on NM_001039726.2, the mutation site in the CDS region is c.1381 GC>G; and based on NP_001034815, the amino acid mutation type is p.Ala461Val, and p.Leu462 truncation mutation. The following all indicate the mutation of the short hair trait of cattle by the site chr20: 39099213 GC>G.

[0045] 1.2 gRNA design near the site chr20: 39099213 GC>G of the PRLR gene

[0046] The present application adopts the method of RNP electroporation for gene targeting, and the main components are Cas9 protein and gRNA sequence, wherein the gRNA includes sgRNA sequence and scaffold sequence two parts.

[0047] First, the sgRNAs around the mutation site within 200bp upstream and downstream were predicted using the CHOPCHOP website, and finally three sgRNAs were selected for targeting experiments. The sequences of the sgRNAs are shown in Table 1. The 3' end of the sgRNA was connected to the Scafflod sequence to form gRNA. The gRNAs were named gRNA1, gRNA2 and gRNA3. The gRNA sequence was sent to Shenguo Bioengineering Co., Ltd. for synthesis.

[0048] Table 1 sgRNA design of PRLR gene

[0049]

[0050] 1.3 Screening of efficient gRNA efficiency

[0051] 1.3.1 Preparation before electroporation

[0052] Ribonucleoprotein (RNP) electroporation technology was used to introduce Cas9 protein and gRNA into Bovine Fetal Fibroblast (BFF) cells to evaluate the editing efficiency of gRNA. First, primary BFF cells were isolated and cultured by tissue block method, and BFF cells were inoculated in 6-well cell culture plates. When the cells grew to 80% confluence, they were used for subsequent electroporation experiments. The BFF cell culture medium was 90% DMEM (No. 11995073, Thermo), 10% FBS (No. 10091148, Thermo) and 1x Penicillin-Streptomycin (No. 15140122, Thermo). The electroporator (Nucleofector TM 2b, Lonza) and the electroporation kit (VPI-1002, Lonza) were used for electroporation, and the electroporation program was U-023. Cas9 protein was TrueCut HiFi Cas9 protein (A50574, Thermo).

[0053] 1.3.2 Electroporation and flow sorting

[0054] The electroporator was turned on before RNP electroporation and set to U-023 program.

[0055] The main steps of electroporation are as follows:

[0056] The first step is to prepare the VPI working solution. Add the Supplement solution to the Primary Cell Nucleofector™ Solution to prepare the Complete Primary Cell Nucleofector™ Solution (referred to as "Solution solution").

[0057] Second step, assemble RNP complex, resuspend to 1 μg / μl with RNase-free water, mix 3 μg Cas9 protein with 5 μg gRNA (each gRNA is separately electroporated), the final volume should not exceed 10 μl. Gently pipette to mix, incubate at room temperature for 10-20 min. Then add 0.5 μg pmax-GFP plasmid (which can express green fluorescent protein), gently mix.

[0058] Third step, single cell suspension preparation, digest into single cells with 0.25% trypsin (No. 15050065, GIBCO), take 1 x 10 6

[0059] Fourth step, electroporation, gently mix 100 μl cell suspension with the pre-assembled RNP complex in a 1.5 mL centrifuge tube, the total volume should not exceed 110 μl, transfer the cell-RNP mixture into an electroporation cup, cover the lid to avoid air bubbles, place the electroporation cup into the cup slot of the electroporator, ensure good contact with the metal surface (three repeats for each gRNA).

[0060] Fifth step, cell collection and culture, after electroporation, the cells are plated into a 6-well plate and 3 ml of culture medium is added for culture for 24-48 h, then digested into single cells, and cells with green fluorescent protein (GFP) are screened by flow cytometry.

[0061] 1.3.3 Detection of targeting efficiency

[0062] Extract genomic DNA from the above flow-sorted GFP-positive cells, and detect the targeting efficiency of the mixed sample. Design primers upstream and downstream of the target site, perform PCR amplification product sequencing, and the primer sequences are shown in Table 2.

[0063] Table 2 PRLR gene editing identification primers

[0064]

[0065] ​The PCR amplification mix was 2x Taq Master Mix (P112, Novozyme), and the amplification system was as follows: 2x Taq MasterMix: 25 μL, PRLR-TF (10 μM): 2 μL, PRLR-TR: 2 μL, template DNA: 0.1-1 μg, and ddH2O was added to a final volume of 50 μL. The PCR amplification procedure was as follows: pre-denaturation at 95°C for 3 min; 35 cycles of amplification at 95°C for 15 s, 55°C for 15 s, and 72°C for 53 s; elongation at 72°C for 5 min; and preservation at 4°C.

[0066] The PCR product was detected by agarose gel electrophoresis, as shown in Figure 1 , and it was found that the amplification band was single, with a size of about 800-1000 bp, which was consistent with the expectation.

[0067] The PCR product was subjected to Sanger sequencing, and the sequencing results were uploaded to the Decodr website (https: / / decodr.org / ) for gene editing efficiency statistics. The results are shown in Figure 2 , and statistics showed that the indel efficiency of gRNA1, gRNA2 and gRNA3 was 36.35%, 41.17% and 56.02%, respectively. It was shown that the three sgRNAs all had targeting efficiency for cutting DNA, and the efficiency of gRNA3 was significantly higher than that of gRNA1 and gRNA2.

[0068] Example 2: Effect of gRNA with different modification types on gRNA targeting efficiency

[0069] 2.1 Design and synthesis of gRNA with different modification types

[0070] On the basis of screening the optimal gRNA, three modifications were added to gRNA3 in the present application:

[0071] The first one was gRNA3-3'idT-5'PS, that is, 3' idT was added to the first three bases at the 3' end of the nucleotide sequence of gRNA3, and a phosphorothioate bond (PS) was introduced between the first three nucleotides at the 5' end. It was labeled as group B.

[0072] The second one was gRNA3-3'idT-5' PS-2'-OMe, which was based on the first modification, that is, 3'idT + 5'PS was added, and 2'-OMe was further added to the seed sequence "cagtttca" of sgRNA. It was labeled as group C.

[0073] The third is to design a complementary PNA (18nt) sequence upstream of the PAM region of sgRNA sequence PAM. The sequence is aaactggcagggaagga. The third modification is superimposed on the first and second modifications. The first modification is the addition of PNA sequence to group B, labeled as group D. The second modification is the addition of PNA sequence to group C, labeled as group E.

[0074] The above modified gRNA and PNA sequence are synthesized by Shenguo Bioengineering Co., Ltd.

[0075] 2.2 Comparison of gRNA targeting efficiency of different modification types

[0076] The modified gRNA, Cas9 protein, and PNA were introduced into bovine BFF cells by RNP electroporation. The high-efficiency gRNA modification was screened by identifying the targeting efficiency in mixed sample cells. The electroporation scheme is shown in Table 3, which is divided into A, B, C, D, and E groups.

[0077] Table 3 Electroporation scheme

[0078]

[0079] Note: pmax-GFP is a commonly used reporter gene vector in CRISPR / Cas9 gene editing system.

[0080] The preparation and specific steps of electroporation are shown in 1.3.1 and 1.3.2. In groups A-C, 3 μg of gRNA and 5 μg of Cas9 protein were used for RNP complex assembly. After the RNP complex was assembled, 0.5 μg of pmax-GFP was added, and then mixed with the cell suspension for electroporation. In addition, the RNP complex assembly steps of groups D and E were the same as groups A-C. After the RNP complex was assembled, 10 μM PNA and 0.5 μg pmax-GFP were added, and then mixed with the cell suspension for electroporation. Each group of electroporation was repeated 3 times.

[0081] After each group of cells was electroporated, they were plated into 6-well cell culture plates for further culture. The medium was changed after 6 h, and the cells were cultured for 24-48 h. Then, the GFP-positive cells were sorted by flow cytometry. Genomic DNA was extracted to identify the targeting efficiency of the mixed sample. PCR amplification was performed using PRLR-TF and PRLR-TR primers from Table 2. The PCR products were sequenced by Sanger sequencing, and the sequencing results were uploaded to the Decodr website (https: / / decodr.org / ) for gene editing efficiency statistics.

[0082] Statistical results showed that the indel efficiency of B, C, D and E groups were significantly higher than that of the control group A, indicating that the modification of gRNA can significantly improve the targeting efficiency. D and E groups were significantly higher than B and C groups (P<0.05), indicating that the addition of PNA can significantly improve the targeting efficiency of gRNA. The indel efficiency of E group was significantly higher than that of D group (P<0.05), indicating that the 2'-OMe modification of gRNA 3 seed sequence and the addition of PNA have better effect on improving the targeting efficiency of gRNA (see Figure 3 and Table 4).

[0083] Table 4 Indel efficiency statistics of gRNA with different modifications

[0084]

[0085] Note: The indel efficiency of each group is the average value of 3 repeats.

[0086] The above results show that for the RNP experiment of bovine fetal fibroblasts, the 3' idT + 5' PS + seed sequence 2'-OMe + PNA of group E is the best modification type.

[0087] Example 3 Screening of effective targeting monoclonal cells

[0088] Under the transfection conditions of groups D and E, low passage Holstein BFF cells were electroporated. The cell amount was 5x10 7 After 48h of transfection, the cells were digested into single cells, and then BFP positive cells were enriched by flow cytometry sorting. After sorting, the cells were cultured in 96-well cell culture plates for 24h, then digested into single cell suspension, and the mixed sample single cell suspension was cultured by limiting dilution method, 200 cells were plated in each 10cm dish, 30 dishes in each group, 15ml of culture medium was added to each dish, and the single cell clones at the bottom of the dish were observed after 7 days of culture. It was found that the cell clone point density of each dish was appropriate, the clone point was single, the edge was clear, and the cell growth was good. The single and larger clone points were circled and covered with a cloning ring, and then trypsinized and transferred to 96-well plates for 2-3 days. The full wells were digested and passaged, 1 / 3 of the cells in each well were used for genomic DNA extraction, PCR amplification and sequencing, and 2 / 3 of the cells were cultured in 96-well cell culture plates, as shown in Table 5.

[0089] Table 5 Screening of homozygous mutant monoclonal cells

[0090]

[0091] After extracting the DNA of the monoclonal cells, the gene editing was analyzed by Sanger sequencing of PCR products, wherein the primers of PCR were PRLR-TF and PRLR-TR of Table 2, and the amplification system was the same as that in the step 1.3.3.

[0092] Table 6 Mutation site and amino acid truncation type of pure hybrid mutation monoclonal cells

[0093]

[0094] The PCR sequencing results were uploaded to the Decodr website, and the analysis results showed that 16 strains of good condition pure hybrid mutations were obtained in groups D and E, wherein the 10#, 29#, 79#, 120# and 145# positive clones had a deletion of 77 bases in the region of chr20:39099191-39099267, marked as chr20:39099191-39099267_77bp_del, and the amino acid sequence truncation type was p.A464 . Taking the 10# monoclonal cell as an example, the sequencing peak chart is shown in Figure 4 , and the cell state is shown in Figure 5 .

[0095] By comparing the PRLR protein amino acid sequences of WT (wild type), chr20: 39099213GC>C and chr20:39099191-39099267_77bp_del, the results are shown in Figure 6 Compared with WT, the amino acid at position 464 of the mutation type of chr20:39099191-39099267_77bp_del was mutated into a stop codon (p.A464 ), which occurred a truncation mutation. This mutation retained the p.Y407, p.Y427, p.Y431 and p.Y433 tyrosine phosphorylation modification sites upstream of the PRLR gene, deleted the p.Y512 and p.Y543 modification sites, and did not add new tyrosine modification sites. Therefore, the p.A464 mutation site is closer to the natural mutation p.L462 , and therefore the 10#, 29#, 79#, 120# and 145# positive monoclonal cells were transferred to 48-well plates for culture and freezing, and were directly used for subsequent somatic cell nuclear transfer.

[0096] Example 4: Efficient and precise acquisition of BFF cells with chr20:39099191-39099267_77bp_del pure hybrid mutation by HDR method

[0097] 4.1 Design of donor double-stranded DNA fragment and synthesis

[0098] By implementing Example 3, we obtained BFF cells of chr20:39099191-39099267_77bp del. Therefore we developed a way to introduce the chr20:39099191-39099267_77bp del mutation site into the Holstein PRLR gene by homology directed repair (HDR).

[0099] The 1000 bp upstream and downstream of the bovine PRLR gene chr20:39099191-39099267_77bp del mutation site were selected as the left and right homologous arms, the genotype of the donor DNA fragment was chr20:39099191-39099267_77bp del, the sequence was shown as SEQ ID NO: 4, and PacI (TTAATTAA) and AscI (CGCGCC) restriction enzyme sites were added at 5' and 3', respectively. The sequence after connecting the restriction enzyme sites at both ends was shown as SEQ ID NO: 9, and was labeled as bPRLR-Donor. The bPRLR-Donor sequence was sent to a company for synthesis, and after synthesis, the synthesized plasmid was added to the pUC57 cloning plasmid. The bPRLR-Donor sequence was cut off by PacI (R0547, NEB) and AscI (R0558, NEB) double enzyme digestion, and after purification by gel recovery purification kit, the concentration was measured and stored at -20°C for RNP transfection experiment.

[0100] bPRLR-Donor (SEQ ID NO: 9):

[0101] TTAATTAACGCGCC, the underlined part is the sequence of enzyme cutting site.

[0102] 4.2 Screening of gRNA modification for HDR efficient integration

[0103] The 77bp of chr20:39099191-39099267 was deleted by RNP electroporation with the addition of bPRLR-Donor based on the electroporation protocol in Table 3. To compare the effects of different modified gRNAs on the HDR integration efficiency of bPRLR-Donor, five combinations were designed. On the basis of groups A, B, C, D, and E, bPRLR-Donor was added, respectively named A+, B+, C+, D+, and E+, and the specific electroporation protocol is shown in Table 7. The specific electroporation steps are shown in 1.3.1 and 1.3.2, in which 3 µg of PRLR-Donor was added to each group.

[0104] Table 7 HDR-based RNP electroporation protocol

[0105]

[0106] After electroporation, the GFP-positive cells were sorted by flow cytometry after 24-48h of culture. After sorting, the cells were plated into cell culture plates and cultured for another 24-48h. The cells were then collected and genomic DNA was extracted. PCR amplification was performed using PRLR-TF and PRLR-TR primers. The PCR products were subjected to Sanger sequencing, and the sequencing results were uploaded to the Decodr website (https: / / decodr.org / ) for statistical analysis of HDR integration efficiency, and the results are shown in Table 8.

[0107] Table 8 Statistical analysis of the effects of different modified gRNAs on the HDR integration efficiency of bPRLR-Donor

[0108]

[0109] Note: The indel efficiency of each group is the average of 3 replicates.

[0110] Statistical analysis found that the proportion of chr20:39099191-39099267_77bp_del mutation type was higher in the mixed cells of groups D+ and E+, i.e., the HDR integration efficiency was higher, which was 43.16% and 49.02%, respectively (see Table 8). This method can be used for PRLR - / - Gene editing BFF cells screening.

[0111] Example 5 Obtain chr20:39099191-39099267_77bp_del embryo by somatic cell nuclear transfer

[0112] 5.1 Preparation of gene editing donor cells

[0113] PRLR - / - (chr20:39099191-39099267_77bp_del) gene editing BFF cells (i.e. donor cells, which can be obtained by screening of Example 3 or by homologous recombination of Example 4, both of which have the same PRLR - / - editing sequence) and PRLR + / + (wild type) BFF cells were thawed and plated in 60 mm cell culture dishes, respectively. The gene editing donor cells and wild type cells were cultured until confluence. Before transplantation, the culture medium was removed and washed with PBS (Gibco, 10010-023), then digested with 1 mL TrypLE digestion solution (Thermo Fisher, 12604013) for 5 minutes, and collected by blowing with 2 mL Hepes operation solution. After centrifugation (250 x g, 5 min) and resuspension in 200 μL HEPES operation solution, it was ready for use. The formula of Hepes operation solution is 114 mM NaCl, 3.2 mM KCl, 2 mM CaCl2, 0.5 mM MgCl2, 0.1 mM Sodium pyruvate, 2 mM NaHCO3, 10 mM HEPES, 17 mM Sodium lactate, 1% volume ratio of 100 x MEM non-essential amino acids (Gibco, 11140050), 1% volume ratio of 100 x penicillin-streptomycin (Gibco, 15140148), 3 mg / mL BSA (Sigma, A1933), pH 7.3-7.4.

[0114] 5.2 Micro-operation needle preparation

[0115] The holding needle, the enucleation needle and the transplantation needle were all made of borosilicate glass capillary. The needle embryo was processed using a needle puller (Sutter, P-1000), a needle grinder (Narishige, MF-830) and a needle polisher (Narishige, EG-401) to make a holding needle with an inner diameter of about 30 μm, an enucleation needle with a sharp spike and an inner diameter of 15-18 μm, and a transplantation needle with an inner diameter of 20-35 μm. The glass debris was removed by 70% ethanol flushing.

[0116] 5.3 Oocyte maturation

[0117] Oocytes were derived from slaughterhouse ovaries, and cumulus-oocyte complexes were collected by aspiration of 2-8 mm follicular fluid with an 18G needle. Oocytes were matured in vitro for 20-22 h at 38.5°C in 5% CO2 and saturated humidity using oocyte maturation medium. The oocyte maturation medium formula: the base medium was Medium 199 (Sigma, M5017), supplemented with 10% (v / v) fetal bovine serum (Gibco, 10099141), 0.01 U / ml FSH (Solarbio, F8470), 0.01 U / ml FSH (Solarbio, L8040), 1 μg / mL estradiol (Sigma, E8875), 22 μg / mL sodium pyruvate (Sigma, P5280), and 1% (v / v) 100x penicillin-streptomycin (Gibco, 15140148).

[0118] 5.4 Oocyte enucleation

[0119] After in vitro maturation of oocytes, cumulus cells were removed with 1 mg / mL hyaluronidase (Sigma, H3506), and oocytes with the first polar body were selected and placed in Hepes manipulation medium containing 5 μg / mL Hoechst 33342 (Sigma, B2261) and 5 μg / mL cytochalasin B (Sigma, C6762). Under a UV fluorescence microscope, polar bodies and chromosomes were sucked out to obtain enucleated oocytes.

[0120] 5.5 Somatic cell nuclear transfer

[0121] 10 μL of the above-mentioned resuspended gene editing donor cells were dropped into the Hepes manipulation medium, small and smooth cells were sucked up using a transfer needle, and injected into the perivitelline space under the zona pellucida of the enucleated oocyte. After injection, the reconstructed embryo was transferred into KSOM medium (Millipore, MR-101-D) for standby.

[0122] 5.6 Embryo fusion and activation

[0123] 5-10 reconstructed embryos per group were transferred into the electrofusion solution, and a single direct current pulse was applied using an electrofusion instrument (BTX2001) with an intensity of 2 kV / cm and a duration of 15 μs. The electrofusion solution formula: 250 mM sorbitol (Sigma, S1876), 0.5 mM MgOAc (Sigma, M5661), 1 mg / mL BSA (Sigma, A2153), pH 7.2.

[0124] The complex was arranged between electrodes, and a single direct current pulse (2 kV / cm, 15 μs) was given, and then transferred into KSOM medium. 2-4 h after electrofusion, chemical activation was performed, i.e., the reconstructed embryo was placed in Hepes operation solution containing 5 μM ionomycin (Sigma, I0634) for 4 min, and then transferred into KSOM medium containing 2 mM 6-DMAP (Sigma, D2629) for 4 h.

[0125] 5.7 Embryo culture

[0126] After chemical activation, the embryos were washed 3 times in KSOM medium (Millipore, MR-101-D) and then cultured in vitro under the conditions of 38.5°C, 5% CO2, 5% O2, and 90% N2. The cleavage rate was recorded after 48 h of in vitro culture, and the non-cleaved embryos were removed. FBS was added to the culture medium at a volume ratio of 5% at 72 h of in vitro culture. The number of blastocysts was recorded on the 7th day of in vitro culture.

[0127] 5.8 Embryo transfer

[0128] The constructed PRLR - / - and PRLR + / + The somatic cell nuclear transfer embryos were transplanted into the uterus of a recipient cow in estrus by a non-surgical method. Each recipient cow was transplanted with 2 embryos. According to the luteal status of the ovary, the transplantation side of the embryo in the uterus was determined. PRLR - / - and PRLR + / + The number of transplanted somatic cell nuclear transfer embryos was 20 and 22, respectively.

[0129] 5.9 Experimental results

[0130] PRLR - / - (chr20:39099191-39099267_77bp_del) gene edited BFF cells were used to construct somatic cell nuclear transfer embryos, of which 22 developed to the blastocyst stage, and the blastocyst development rate was 41.5%; PRLR + / + Wild-type cells were used to construct 311 embryos, of which 84 developed to the blastocyst stage, and the blastocyst development rate was 27.0%. According to the Yates method, the chi-square statistical test analysis showed that the development ability of the somatic cell nuclear transfer embryos constructed by PRLR - / - gene edited cells was significantly higher than that of the somatic cell nuclear transfer embryos constructed by wild-type cells (P<0.05) (Table 9). Figure 7

[0131] Table 9 Development ability detection results of different somatic cell nuclear transfer embryos

[0132]

[0133] Note: different letters represent significant differences (P <0.05).

[0134] See Figure 8 , transplanted PRLR - / - One of the 10 recipient cows of somatic cell nuclear transfer embryos gave birth to a live calf. The PRLR - / - The somatic cell nuclear transfer calf showed a distinct feature of short hair. The PRLR + / + Two of the 11 recipient cows of somatic cell nuclear transfer embryos gave birth to live calves, which had longer hair and were not significantly different from ordinary cattle.

[0135] The specific examples are applied in the detailed description of the inventive concept, and the above examples are only used to help understand the core idea of the present application. It should be pointed out that any obvious modification, equivalent replacement or other improvement made by those skilled in the art without departing from the inventive concept should be included in the protection scope of the present application.

Claims

1. A combination of PNA and modified gRNA, characterized in that, The PNA nucleotide sequence is shown as SEQ ID NO: 3; the gRNA is composed of the 3' end of the sgRNA sequence shown as SEQ ID NO: 1 connected with the scaffold sequence shown as SEQ ID NO: 2, and the modification includes adding 3 reverse deoxythymidine at the 3' end of the gRNA sequence and introducing a phosphorothioate bond between the first 3 bases at the 5' end.

2. The combination of claim 1, wherein, The modification also includes adding 2'-O-methyl in the seed sequence cagtttca of the sgRNA.

3. Use of the combination of claim 1 or 2 in producing PRLR gene mutation heat-resistant dairy cows for non-therapeutic purposes.

4. A method for producing heat-tolerant dairy cows for non-therapeutic purposes by gene editing, characterized by: The method comprises the following steps: (1) introducing the combination of claim 1 or 2, Cas9 protein and reporter gene vector into bovine BFF cells by RNP electroporation, and obtaining positive cells by reporter gene expression screening; (2) Extract the DNA of positive clone cells for sequencing to obtain PRLR with p.Y407, p.Y427, p.Y431 and p.Y433 retained in the upstream modification sites of the PRLR gene and p.Y512 and p.Y543 deleted in the downstream modification sites of the PRLR gene - / - Gene editing BFF cells, PRLR gene based on the bovine ARS-UCD2.0 version (3) PRLR - / - Gene-edited BFF cells are injected into the periplasmic space below the zona pellucida of an enucleated mature donor oocyte to obtain reconstructed embryos. Five to ten reconstructed embryos are grouped together for embryo fusion and activation, followed by in vitro culture. During culture, embryos without cleavage are discarded to obtain PRLR. - / - Somatic cell nuclear transfer embryos; (4) PRLR - / - The somatic cell nuclear transfer embryos are transplanted into the uterus of the estrus recipient cow by non-surgical method, and the calves born are the heat-resistant cows with PRLR gene site mutation.

5. A method for producing heat-tolerant dairy cows for non-therapeutic purposes by gene editing, characterized by: The method comprises the following steps: (1) introducing the combination of claim 1 or 2, Cas9 protein, reporter gene and donor DNA fragment vector with chr20:39099191-39099267_77bp_del mutation into bovine BFF cells by RNP electroporation, and obtaining PRLR by screening the expression of the reporter gene - / - gene-edited BFF cells; The nucleotide sequence of the donor DNA fragment is shown as SEQ ID NO: 4; The PNA nucleotide sequence is shown as SEQ ID NO: 3; the gRNA is composed of the 3' end of the sgRNA sequence shown as SEQ ID NO: 1 connected with the scaffold sequence shown as SEQ ID NO: 2, and the modification includes adding 3 reverse deoxythymidine at the 3' end of the gRNA sequence and introducing a phosphorothioate bond between the first 3 bases at the 5' end. The modification also includes adding 2'-O-methyl in the seed sequence cagtttca of the sgRNA. (2) PRLR - / - Gene-edited BFF cells are injected into the periplasmic space below the zona pellucida of an enucleated mature donor oocyte to obtain reconstructed embryos. Five to ten reconstructed embryos are grouped together for embryo fusion and activation, followed by in vitro culture. During culture, embryos without cleavage are discarded to obtain PRLR. - / - Somatic cell nuclear transfer embryos; (3) PRLR - / - The somatic cell nuclear transfer embryos are transplanted into the uterus of the estrus recipient cow by non-surgical method, and the calves born are the heat-resistant cows with PRLR gene site mutation.

Citation Information

Patent Citations

  • Genetically modified animals having increased heat tolerance

    CN108347908A

  • SgRNA for targeted editing of PRLR gene and application thereof

    CN117568343A