Detection method for detecting RNA (Ribonucleic Acid) of influenza A virus by FET (Field Effect Transistor) method and application

By combining the CRISPR-Cas13a system with a field-effect transistor biosensor, and designing specific crRNA to activate the Cas13a protein, the problem of long detection time for influenza A virus in existing technologies has been solved, enabling rapid, convenient and highly sensitive nucleic acid detection.

CN121160922APending Publication Date: 2025-12-19ACADEMY OF MILITARY MEDICAL SCIENCES
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511365279.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-09-23
Publication Date
2025-12-19

AI Technical Summary

Technical Problem

Existing methods for detecting influenza A virus require complex instruments and facilities, and are time-consuming, making it difficult to achieve rapid and convenient real-time nucleic acid testing.

Method used

By combining the CRISPR-Cas13a system with a field-effect transistor biosensor, and by designing specific crRNA to activate the Cas13a protein, a highly sensitive detection method for influenza A virus RNA is achieved, simplifying it into a rapid detection method that does not require nucleic acid amplification.

Benefits of technology

It enables highly sensitive and convenient detection of viral nucleic acid as low as 1 copy/μL within 20 minutes, and is suitable for rapid on-site qualitative detection of influenza A virus in resource-limited areas.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121160922A_ABST
    Figure CN121160922A_ABST
Patent Text Reader

Abstract

The invention discloses a detection method for detecting influenza A virus RNA through an FET method and application, and particularly relates to a detection method for detecting influenza A virus RNA through the FET method and application, the detection method comprises a CRISPR-Cas13a system used for detecting influenza A virus and a field effect transistor biosensor matched with the CRISPR-Cas13a system for use, the CRISPR-Cas13a system comprises a composition, Cas13a protein and report RNA, a detection chip of the field effect transistor biosensor is a carbon-based biosensor chip; based on the CRISPR-Cas13a field effect transistor biosensor, a report RNA used for nucleic acid detection of the CRISPR-Cas13a field effect transistor biosensor and a specific crRNA which is used for influenza A virus RNA detection and targets a target sequence are finally provided. The crRNA provided by the invention can realize high-sensitivity and high-specificity detection of influenza A virus RNA by activating Cas13a, and has important application value in the field of detection and identification of influenza A virus.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of nucleic acid detection, and particularly relates to a detection method for detecting influenza A virus RNA by using a FET method and application thereof. BACKGROUND

[0002] Influenza A virus is a single-stranded negative-sense RNA virus that can infect various avian and mammalian animals including humans, and is one of the main pathogens causing human influenza pandemic. The genome of the influenza A virus is composed of eight RNA segments, which encode 12 proteins and have high variability. The influenza A virus mainly spreads through droplets, air and contact with contaminated objects, and has a strong infectious ability. The influenza A virus can cause seasonal influenza or even global influenza pandemic in humans, which poses a serious threat to public health. Seasonal influenza virus causes about 3-5 million cases of severe infection and about 290,000-650,000 deaths worldwide each year. Due to the overlapping symptoms of influenza A virus infection with other respiratory pathogens, the clinical diagnosis is often unclear.

[0003] The current "gold standard" for detecting influenza A virus is reverse transcription real-time fluorescence quantitative polymerase chain reaction. However, this technique requires high requirements for instruments, places and operators, and also needs several hours for sampling, nucleic acid extraction and detection, which limits the application of RT-qPCR in the field of nucleic acid instant detection. SUMMARY

[0004] Based on the technical problems existing in the prior art, the application provides a detection method for detecting influenza A virus RNA by using a FET method and application thereof, which solves the technical problem that the influenza A virus cannot be quickly detected or identified in the prior art.

[0005] To achieve the above-mentioned purpose, according to a first aspect of the technical scheme of the application, the application provides a detection method for detecting influenza A virus RNA by using a FET method, which comprises a CRISPR-Cas13a system for detecting influenza A virus and a field effect transistor biosensor used in conjunction therewith. The CRISPR-Cas13a system for detecting influenza A virus comprises a composition, a Cas13a protein and a reporter RNA. The detection chip of the field effect transistor biosensor used in conjunction therewith is a carbon-based biosensor chip, which is used for detection by using a transfer curve on a field effect transistor carbon-based biological workstation.

[0006] The composition comprises crRNA, and the crRNA comprises an anchor sequence for binding with the Cas13a protein and a guide sequence targeting the RNA target sequence of the influenza A virus.

[0007] Further, the CRISPR-Cas13a system comprises a1) -a2) as follows: a1) a crRNA and a LwCas13a protein alone or a complex of a crRNA and a LwCas13a protein; the target sequence of the crRNA is sequence crRNA1; a2) the reporter RNA is composed of 20 U, and the sequence of the reporter RNA is labeled with a gold nanoparticle and biotin at both ends, and streptavidin magnetic beads for separation of the probe.

[0008] Further, in the crRNA, the anchor sequence is the 1st-38th of sequence crRNA1.

[0009] Preferably, the guide sequence is the 39th-66th of sequence crRNA1.

[0010] According to the second aspect of the technical scheme of the present application, the present application provides a detection method for detecting influenza A virus RNA based on the FET method of the CRISPR-Cas13a system, which comprises the following steps: Step B1: analysis of the conserved region sequence and preparation of the plasmid; Step B2: preparation of the conserved sequence RNA; Step B3: design of the crRNA; Step B4: preparation of the crRNA Step B5: screening of the crRNA Preferably, step B1 further comprises extracting the nucleic acid of the sample to be tested as a template, preparing a CRISPR-Cas13a detection system for reaction, the CRISPR-Cas13a detection system comprising the above composition, Cas13a protein, reporter RNA; at the same time, water is used to replace the nucleic acid template as a negative control; the system is detected, and the detection signal is read.

[0011] Further, the reaction conditions are: 37℃, reaction for 15 minutes.

[0012] Further, the sample to be tested can be a throat swab.

[0013] According to the third aspect of the technical scheme of the present application, the present application provides an application of the above-mentioned detection method for detecting influenza A virus RNA based on the FET method of the CRISPR-Cas13a system, which comprises the following categories: C1, preparation of a product for detecting influenza A virus RNA or detecting influenza A virus RNA; C2, preparing a product for detecting or assisting in detecting whether a to-be-tested sample contains influenza A virus RNA or detecting or assisting in detecting whether a to-be-tested sample contains influenza A virus RNA; C3, preparing a product for screening whether a target individual carries influenza A virus or screening whether a target individual carries influenza A virus; C4, preparing a product for diagnosing influenza A virus infection or diagnosing influenza A virus infection; C5, preparing or assisting in preparing a kit for detecting influenza A virus detection.

[0014] Compared with the prior art, the FET method for detecting influenza A virus RNA and the application have the following beneficial technical effects: 1. The FET method for detecting influenza A virus RNA based on the CRISPR-Cas13a system and the application provide a to-be-tested target sequence for detecting influenza A virus RNA and a specific crRNA that can target the target sequence through design, construction and screening. The crRNA can activate Cas13a to realize high-sensitivity and high-specificity detection of influenza A virus RNA, and the sensitivity reaches 1 copies / μL, which has important application value in the field of detecting and identifying influenza A virus.

[0015] 2. The CRISPR-Cas13a system is combined with a field effect transistor biosensor to obtain a new detection module for detecting influenza A virus RNA. Unlike traditional reverse transcription real-time fluorescent quantitative polymerase chain reaction, the detection method does not need nucleic acid amplification, realizes rapid and high-sensitivity nucleic acid detection, and is convenient to operate.

[0016] 3. The application screens influenza A virus-specific RT-RAA primers and crRNA, and establishes an RT-RAA-CRISPR fluorescence method and a CRISPR-FET nucleic acid detection method for influenza A virus.

[0017] 4. The application combines the CRISPR system with the FET biosensor to establish an immunomagnetic bead-assisted CRISPR-FET biosensor nucleic acid detection method for influenza A virus.

[0018] 5. The method does not need a nucleic acid amplification step, and compared with the FET sensor reported in the current literature, it avoids complex chip modification and probe fixation steps for the first time, can detect virus nucleic acid as low as 1 copies / μL within 20 minutes, and achieves the detection effect of ultra-fast, simple, portable, high-sensitivity and high-specificity. The method is suitable for rapid qualitative detection of influenza A virus in resource-limited areas, and has important application value in the field of detecting and identifying influenza A virus. Attached Figure Description

[0019] Figure 1A This is one of the crRNA screening results diagrams according to the present invention. Figure 1A The fluorescence values ​​of each group at the 60-minute detection time using the CRISPR-Cas13a fluorescence assay represent the fluorescence values ​​of each group. Figure 1B The second figure shows the crRNA screening results according to the present invention. Figure 1B This indicates the fluorescence values ​​of each group at the 60-minute time point detected by the CRISPR-Cas13a fluorescence method; Figure 2A This is one of the result diagrams established according to the CRISPR-Cas13a-FET biosensor nucleic acid detection method of the present invention. Figure 2A The FET sensor detection transfer curves show the systems with and without target RNA. Figure 2B The second result is shown in the figure below, representing the results of the nucleic acid detection method based on the CRISPR-Cas13a-FET biosensor of the present invention. Figure 2B The on-state current value of the transfer curve representing the target RNA and the system with added target RNA; Figure 3A This is one of the graphs showing the detection sensitivity results of a field-effect transistor biosensor for the target sequence of influenza A virus. Figure 3A This indicates that the CRISPR-FET biosensor detects 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 copies / μL and 10 -1 Transfer curves for copies / μL and NC group; Figure 3B Figure 2 shows the detection sensitivity results of the field-effect transistor biosensor for the influenza A virus target sequence. Figure 3B The values ​​represent the on-state current values ​​of the transfer curves obtained by the CRISPR-FET biosensor for each group. NC is the negative control (the detection template is enzyme-free water). The black dashed line represents the positive detection threshold. n=3. Figure 4A This is one of the graphs showing the specificity of the field-effect transistor biosensor detecting the target sequence of influenza A virus. Figure 4A This indicates the transfer curves of the CRISPR-FET biosensor detecting IAV, EBoV, JuninV, VEEV, YFV, and NC groups. Figure 4BFigure 2 shows specificity results of the FET biosensor for detecting the target sequence of the influenza A virus. Figure 4B Figure 2 shows specificity results of the FET biosensor for detecting the target sequence of the influenza A virus. DETAILED DESCRIPTION

[0020] In order to make the technical problems solved by the present application, the technical solutions adopted and the beneficial effects obtained more clear and apparent, the present application is further described in detail below in combination with specific embodiments. The specific embodiments described herein are only used to explain the present application and do not constitute any limitation on the present application. Unless otherwise defined, all terms used in the present application have the same meaning as commonly used in the field to which the present application belongs.

[0021] The following specific embodiments are provided to help understand the present application, but it should be understood that the listed embodiments and test examples of the present application are only used to illustrate the present application, but do not constitute any limitation, and the actual protection scope of the present application is set forth in the claims.

[0022] The present application provides a FET method for detecting influenza A virus RNA and its application. The present application is based on the CRISPR system as the third generation of gene editing tools, which has the advantages of high sensitivity and good specificity in the field of nucleic acid detection. The field effect transistor biosensor can realize rapid and high sensitive nucleic acid detection without nucleic acid amplification, and the operation is more convenient. The present application provides a preparation method of a probe-free and / or chip-free modification CRISPR-Cas13a system and FET-based influenza A virus RNA detection platform. The FET detection composition for biological detection of the present application comprises: a reporter RNA, a surface-coated streptavidin magnetic bead, a Cas13a protein, and a crRNA specific to the biological to be detected. The reporter RNA is composed of 20 U, and the sequence of the reporter RNA is labeled with gold nanoparticles and biotin at both ends, and a streptavidin magnetic bead for separating the probe. The target sequence of the crRNA is sequence crRNA1.

[0023] In an embodiment, the present application can be used for preparing a product for detecting influenza A virus RNA or detecting influenza A virus RNA; the present application can be used for preparing a product for detecting or assisting in detecting whether a sample to be tested contains influenza A virus RNA or preparing a product for detecting or assisting in detecting whether a sample to be tested contains influenza A virus RNA; the present application can be used for preparing a product for screening whether a target individual carries influenza A virus or preparing a product for screening whether a target individual carries influenza A virus; the present application can be used for preparing a product for diagnosing influenza A virus infection or preparing a product for diagnosing influenza A virus infection; the present application can be used for preparing a product for screening or assisting in screening an influenza A virus prevention and treatment drug or preparing a product for screening or assisting in screening an influenza A virus prevention and treatment drug.

[0024] The present application will be further described in detail below in combination with specific embodiments. In the following examples, the experimental methods used are conventional methods unless otherwise specified. In the following examples, the materials, reagents, etc. used are commercially available unless otherwise specified. The following examples facilitate better understanding of the present application, but do not limit the present application. In the following examples, three repeated experiments were set for quantitative tests, and the average value was taken.

[0025] The reagents involved in the following examples and their sources are as follows: HiScribe T7 Fast High Yield RNA Synthesis Kit (from New England Biolabs, E2050S), RNA purification magnetic beads (from Agencourt RNA Clean XP, Beckman Coulter, A63987), LwCas13a protein (from Nanjing Kingsriver Biotechnology Co., Ltd.), RNAse Alert v2 (from Thermofisher Scientific, 4479769), RNase-free H2O (from Beijing Bomeide Gene Technology Co., Ltd., RA114-01), reporter RNA (synthesized by Shanghai Sangon Biological Engineering Co., Ltd.), water-soluble gold nanoparticles (from Nanjing Dongna Biotechnology Co., Ltd., AuP11), Dynabeads™ M-280 Streptavidin (from Thermo Fisher Scientific), carbon-based biosensor chip (from Hunan Yuanxin Sensor Technology Co., Ltd.).

[0026] Example 1 In this embodiment, a FET method for detecting influenza A virus RNA and its application are provided, which is a FET method for detecting influenza A virus RNA based on a CRISPR-Cas13a system, the design and screening of crRNA of which include the following steps: Step B1: analysis of conserved region sequence and preparation of plasmid; which further comprises the following steps: Step S11: sequence acquisition and alignment; influenza A virus M genome sequence information is acquired from NCBI influenza virus database, and MAFFT multi-sequence alignment program is used for alignment analysis of the sequence; Step S12: conserved sequence screening; the alignment result is displayed by Jalview visualization software, and suitable highly conserved sequence (denoted as sequence 1, SEQ ID NO. 1) is screened and obtained; Step S13: plasmid copy number calculation; the plasmid copy number of the sequence 1 is calculated according to the formula: copies / μL=6.02×10 23 × concentration (ng / μL) ×10 9 / plasmid length × 660; Step S14: construction of recombinant vector; the sequence 1 is inserted into the multiple cloning site of pUC57 vector, the remaining nucleotide sequence of pUC57 vector is kept unchanged, and the recombinant plasmid vector is constructed and obtained.

[0027] In the recombinant vector, the sequence 1 is connected with the pUC57 vector through standard molecular cloning technology, and the vector skeleton keeps complete enzyme cutting site and functional elements.

[0028] The sequence 1 (5'-3') is as follows: CAAAGCCCCAGAAGTTCACCTCATCTGCCAACGGAGTGACCACACACTACGTCTCACAGATTGGTGGCTTCCCAAATCAAACAGAAGACGGAGGACTACCACAAAGTGGCAGAATTGTTGTTGATTACATGGTGCAAAAATCTGGAAAAACAGGAACAATTACCTATCAAAGAGGTATTTTGTTGCCTCAAAAGGTGTGGTGCGCAAGTGGCAAGAGCAA; Step B2: preparation of conserved sequence RNA; which further comprises the following steps: Step S21: in vitro transcription reaction; 1 μg of plasmid (the required product volume is calculated according to the measured plasmid concentration) is added into 20 μL T7 RNA polymerase transcription system, and incubated at 37℃ for 12 h for transcription. The transcription system is shown in Table 1.

[0029] Table 1 Reaction system of in vitro transcribed RNA

[0030] As shown in Table 1, a 20 μL transcription reaction system was configured, which contained 10 μL NTP Mix (HiScribe™ T7 Quick High Yield RNA Synthesis Kit), 2 μL T7 RNA polymerase (HiScribe™ T7 Quick High Yield RNA Synthesis Kit), and 1 μg PCR purified product, and was supplemented with nuclease-free water to 20 μL. Incubation was performed at 37°C for 12 hours to complete transcription.

[0031] Step S22: RNA purification; the RNA Clean XP magnetic beads were mixed, 36 μL of the RNA Clean XP magnetic beads were added to the 20 μL transcription product of step S21, and the mixture was mixed by blowing and sucking 10 times. After thorough mixing, the mixture was allowed to stand at room temperature for 3-5 minutes. The mixture was placed on a magnetic stand for magnetic separation for 5-10 minutes until the solution was clear, and the supernatant was discarded. 200 μL of 70% ethanol was added for washing for 30 seconds, and the washing was repeated 3 times, without touching the magnetic beads during the operation. After the washed product was dried at room temperature for 10 minutes, 40 μL of nuclease-free water (sterile and nuclease-free pure water was used) was added to the solution containing the transcription product. The liquid in the tube was mixed by rotation or oscillation to ensure that the nuclease-free water and the transcription product were fully mixed. The upper liquid was carefully sucked up using a sterile pipette or gun head without touching the precipitate, and was transferred to a clean container to obtain the conserved sequence RNA.

[0032] Step S23: product detection and preservation; the conserved sequence RNA obtained in step S22 was measured for RNA concentration using an ultramicro spectrophotometer; and after aliquoting, it was stored at -80°C for long-term preservation.

[0033] In step S22, the magnetic bead purification step needs to strictly avoid contacting the magnetic beads, and the ethanol washing needs to ensure that the residual is completely removed. The finally obtained conserved sequence RNA is suitable for downstream molecular biology experiments.

[0034] Step B3: design of crRNA; which further comprises the following steps: Step S31: Target sequence design; based on the influenza A virus conserved sequence and the RT-RAA primer, the RT-RAA primer is the primer with the sequence of RT-RAA-F (SEQ ID NO. 2) and RT-RAA-R (SEQ ID NO. 3) in Table 2, and the crRNA is designed between the forward and reverse primers. The crRNA sequence consists of two parts of scaffold sequence and target sequence. First, a 28 bp fragment is selected as the target sequence of the crRNA. The crRNA is prepared by selecting the method of T7 in vitro transcription, and the sequence of the prepared transcription template is shown in Table 2.

[0035] Step S32: Promoter modification; the 5' end of the target sequence is connected with the crRNA promoter sequence (5'-GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAAC-3') to form a complete crRNA scaffold; the single-stranded DNA sequence of the crRNA is used as an amplification template to design annealing primers for the in vitro transcription synthesis of the crRNA; Step S33: Primer design; the upstream primer crRNA-F contains a T7 promoter sequence and a 5'-GATTTAGACTACCCCAA-3' adapter sequence; the downstream primer crRNA-R contains a 20 bp reverse complementary sequence of the target sequence; Step S34: Preparation of in vitro transcription template; the single-stranded DNA is used as a template, and the primers are shown in Table 2. The templates of the five crRNAs are crRNA-1 (SEQ ID NO. 5), crRNA-2 (SEQ ID NO. 7), crRNA-3 (SEQ ID NO. 9), crRNA-4 (SEQ ID NO. 11), and crRNA-5 (SEQ ID NO. 13). The upstream primer is T7-crRNA-F (SEQ ID NO. 4), and the downstream primers are crRNA1-R (SEQ ID NO. 6), crRNA2-R (SEQ ID NO. 8), crRNA3-R (SEQ ID NO. 10), crRNA4-R (SEQ ID NO. 12), and crRNA5-R (SEQ ID NO. 14), respectively. The crRNA transcription template containing the T7 promoter is obtained by amplification with the primers.

[0036] The RT-RAA primer sequence, the crRNA sequence, and the crRNA synthesis primer sequence are shown in Table 2 and are synthesized by Beijing Tianyihuiyuan Biotechnology Co., Ltd.

[0037] Table 2 Nucleic acid sequences used in the experiment

[0038] Step B4: Preparation of crRNA; which further comprises the following steps: Step S41: PCR amplification: crRNA-Template is used as DNA amplification template, crRNA-F (forward primer) and crRNA-R (reverse primer) are used as primers for PCR reaction, and crRNA transcription template containing T7 promoter sequence is obtained by PCR amplification. The PCR reaction program is shown in Table 3, which comprises the following steps: Step S411: Pre-denaturation stage, the PCR instrument temperature is set to 95°C for 5 minutes to make all template DNA completely unwound into single-stranded, and the thermostable DNA polymerase is activated.

[0039] Step S412: Denaturation stage, 95°C for 30 s, the hydrogen bond between the template DNA double strands is broken by high temperature to unwind into single-stranded DNA, providing single-stranded template for subsequent primer binding. Step S413: Annealing stage, 55°C for 30 s, to make the primer bind to the template DNA Step S414: Extension stage, 72°C for 45 s, the DNA polymerase takes the primer as the starting point and dNTP as the raw material, and synthesizes new DN chain along the 3' end direction of the template DNA according to the principle of base complementary pairing, so as to extend the DNA fragment. Step S412: Denaturation stage, step S413: Annealing stage, step S414: Extension stage, a total of 35 cycles; Step S415: Continued extension stage, continued extension (72°C for 10 min) to ensure that the DNA polymerase has sufficient time to complete all uncompleted extension reactions, and to ensure that the final product is complete double-stranded DNA, reducing the proportion of short fragments or incomplete products.

[0040] Table 3 PCR reaction system for preparing crRNA

[0041] Step S42: PCR product purification and recovery, which further comprises the following steps: Step S421: Preparation of nucleic acid extraction reagent, Tris balanced phenol and chloroform are mixed in a volume ratio of 1:1, vortexed until fully emulsified, and then centrifuged at a speed of 10,000 rpm for 10 minutes using a high-speed centrifuge. The supernatant is discarded to prepare the nucleic acid extraction reagent.

[0042] Step S422: organic solvent extraction purification, 200 μL of PCR product was mixed with 600 μL of nucleic acid extraction reagent prepared in step S421, vortexed for 30 seconds; using a high-speed centrifuge with a speed setting of 10,000 rpm for 5 minutes, and the supernatant was transferred to a new centrifuge tube; ethanol was added in a volume ratio of 3:7 to the supernatant: anhydrous ethanol, and after mixing, a high-speed centrifuge was used with a speed setting of 10,000 rpm for 10 minutes.

[0043] Step S423: precipitation washing and drying, the product obtained in step S422 was discarded after washing the precipitate with 200 μL of 70% ethanol; the washing step was repeated twice, each time with a centrifugation condition of 10,000 rpm x 10 minutes; the white nucleic acid precipitate at the bottom of the EP tube was retained after removing the supernatant, and was dried at room temperature for 10 minutes.

[0044] Step S424: product dissolution and quantification, 50 μL of nuclease-free water was added to dissolve the precipitate, and the product concentration was measured using a ultramicro spectrophotometer.

[0045] Step S43: in vitro transcription, 1 μg of purified PCR product obtained in step S42 (the volume of product to be added was calculated according to the measured product concentration) was added to 20 μL of T7 RNA polymerase transcription system (as shown in Table 4), and incubated at 37°C for 12 h to transcribe crRNA.

[0046] Table 4 Reaction system for in vitro transcription of crRNA

[0047] Step S44: crRNA purification, which further comprises the following steps: Step S441: magnetic bead binding and nucleic acid adsorption, 36 μL of magnetic bead suspension was added to the 20 μL crRNA transcription reaction system completed in step S43 after the RNA Clean XP magnetic beads were thoroughly vortexed and mixed, and the nucleic acid was specifically combined with the functional groups on the surface of the magnetic beads by repeatedly blowing and sucking for 10 times; then it was placed at room temperature for 3-5 minutes to balance the binding reaction.

[0048] Step S442: magnetic separation and supernatant removal, the mixed solution was placed on a magnetic stand for 5-10 minutes until the solution system was clear, indicating that the nucleic acid-magnetic bead complex had been completely separated; the supernatant was discarded, and the magnetic bead precipitate combined with the nucleic acid was retained.

[0049] Step S443: ethanol washing and purification, 200 μL of 70% ethanol (v / v) was added, incubated at room temperature for 30 seconds, and the supernatant was discarded after gentle mixing; this washing operation was repeated a total of 3 times, and the magnetic bead precipitate was strictly avoided during the process to remove salt ions and impurities Step S444: After washing, the magnetic bead precipitate was air-dried for 10 minutes at room temperature under ventilation conditions to ensure that the residual ethanol was completely volatilized to avoid affecting the downstream dissolution efficiency; 40 μL of nuclease-free water was added to the dried magnetic bead precipitate, which was vortexed and mixed, and then the supernatant was aspirated to obtain a purified crRNA solution; this step uses a mild redissolution strategy to maximize the nucleic acid recovery rate.

[0050] Step S445: The absorbance value of the crRNA solution was measured using an ultramicro spectrophotometer, and the concentration was calculated; finally, the crRNA was diluted to a target concentration of 100 ng / μL and stored at -80°C to maintain long-term stability.

[0051] Step B5: Screening of crRNA, which further comprises the following steps: Step S51: RT-RAA amplification; The RT-RAA isothermal amplification reaction solution was prepared according to Table 5, and 5 μL of target RNA was added to each reaction unit tube as a detection template after the preparation was completed, and a negative control experiment was performed with nuclease-free water as a template to monitor the system contamination; after thorough mixing, the reaction solution was centrifuged at low speed to make the reaction solution located at the bottom of the tube. Then the reaction unit tube containing the reaction solution was placed in a 42°C metal bath and incubated for 30 min. The amplification product was subjected to subsequent experiments.

[0052] Table 5 RT-RAA isothermal amplification reaction system

[0053] Step S52: Configuration of fluorescence CRISPR detection system; The reaction system for fluorescence CRISPR detection was prepared according to Table 6. 5 μL of RT-RAA amplification product was added to each reaction unit tube, which was thoroughly mixed and then centrifuged at low speed to make the reaction solution located at the bottom of the tube. The prepared reaction solution was placed in a real-time fluorescence PCR instrument for detection, with a constant temperature of 37°C, and FAM fluorescence was collected every 2 minutes for a total of 30 times.

[0054] Table 6 Preparation table of reaction solution for fluorescence CRISPR detection

[0055] Step S53: CRISPR-Cas13a fluorescence detection collects the fluorescence signal at 60 min of CRISPR reaction for result analysis.

[0056] The experimental results are shown in Figure 1A The fluorescence value curves of crRNA1, crRNA2, and crRNA3 experimental groups peaked quickly and had relatively high fluorescence values. As shown in Figure 1BAs shown, the fluorescence values of crRNA1-crRNA5 groups were 20891.93±5234.67, 11323.39±1392.97, 11201.49667±2087.60, 3589.88±94.39, and 5292.14±192.09, respectively, and the difference between the fluorescence value of the NC group at 60 min (3112.55±130.99) and the fluorescence values of the crRNA1-crRNA5 groups was statistically significant. The fluorescence value of the crRNA1 experimental group was the highest at 60 min, indicating that the efficiency of Cas13a protein in vitro cleavage of the reporter RNA was the highest when crRNA1 was present in the reaction system, and crRNA1 was selected for subsequent experiments. Figure 1A The real-time fluorescence curve of each group at 60 min of the fluorescence method CRISPR-Cas13a detection is shown. Figure 1B The fluorescence values of each group at the 60 min time point of the fluorescence method CRISPR-Cas13a detection are shown. The fluorescence values of the crRNA1-crRNA5 groups were subjected to Student's t test or Welch's t test with the negative control, ****: P<0.0001, ***: P<0.001, **: P<0.01; NC: negative control (detection template is enzyme-free water); n=3.

[0057] Example 2 The method for establishing a CRISPR-Cas13a field effect transistor biosensor for detecting influenza A virus RNA includes the following steps.

[0058] 1. Configuration of the CRISPR-Cas13a-FET detection system The IAV conserved sequence RNA (103 copies / μL) was used as the detection template, and the CRISPR-FET system configuration requirements in Table 7 were used to configure the system. After the configuration was completed, the metal bath was incubated at 37°C for 15 minutes. The crRNA1 obtained by pre-screening specifically recognized the IAV RNA target sequence; after the crRNA1 combined with the target sequence, the transcleavage activity of the Cas13a protein was activated; the ssRNA FET reporter probe (AuNPs-20U-Biotin) was used to detect the transcleavage activity of the Cas13a-crRNA complex, wherein the reporter probe contained gold nanoparticle labeling and biotin modification.

[0059] Table 7. CRISPR-FET system configuration requirements

[0060] 2. Magnetic bead separation 1) Magnetic bead washing: Take 25 μL of magnetic beads and place them in a magnetic stand. After 3 minutes, discard the solution and add 25 μL of deionized water to resuspend the mixture. Again, place it in a magnetic stand for 3 minutes and discard the washing solution.

[0061] 2) Target capture: Mix 25 μL of the incubated solution containing Cas13a-crRNA complex and the sample to be tested with the pretreated magnetic beads. Incubate at room temperature for 3 minutes. Capture the FET reporter probe fragments through streptavidin-biotin specific binding. After magnetic separation, take 8 μL of the supernatant for detection.

[0062] 3. FET sensor test 1) Parameter setting: Parameter setting: Transfer curve setting gate voltage range -0.4~0.6 V, source-drain voltage 0.1 V; 2) Test method: Take 8 μL of the solution to be tested and drop it into the chip sample slot. Record the transfer curve and discard the solution with a pipette. Repeat the measurement three times and measure the data in each group in turn 4. The experimental results are shown in Figure 2A and Figure 2B There is a significant difference in the open-state current value of the transfer curve between the group without target RNA and the group with Cas13a-crRNA+target. The results show that IAV conserved sequence RNA can be accurately recognized by Cas13a-crRNA complex and activate the cleavage activity of Cas13a protein. The FET reporter probe is cut, the streptavidin magnetic beads bind to the biotin on the other end of the FET reporter probe, and the AuNPs remain in the supernatant. When using the FET sensor to test the transfer curve, a low current signal value is shown, indicating that the system can accurately detect influenza A virus RNA, and the streptavidin immunomagnetic bead-assisted CRISPR-FET biosensor system for detecting influenza A virus is successfully constructed. Figure a shows the FET sensor detection transfer curve of the system without target RNA and with target RNA; Figure b: the open-state current value of the transfer curve of the system with target RNA and with target RNA; the open-state current value of the PC group was subjected to Student's t test with the NC group, **: P<0.01, n=3.

[0063] Example 3 A FET method for detecting influenza A virus RNA and its application sensitivity detection, the detection steps and results are as follows.

[0064] According to the method in Example 1, the influenza A virus conserved sequence RNA was gradiently diluted, and the concentrations after dilution were: 10 4 copies / µL, 10 3 copies / µL, 10 2copies / µL, 10 1 copies / µL, 10 0 copies / µL, and 10 - 1 copies / µL. The negative control template was enzyme-free water, and the nucleic acid was detected according to the CRISPR-Cas13a field effect transistor biosensor detection system method in Table 7 to detect the sensitivity of the FET method for detecting influenza A virus RNA based on the CRISPR-Cas13a system. The positive threshold of the FET sensor was defined as the average current value of the negative control minus three standard deviations. When the current value detected by the FET sensor is lower than the positive threshold, the detection result is determined to be positive, and when the detected current value is greater than or equal to the positive threshold, the detection result is determined to be negative.

[0065] The experimental results are shown in Figure 3A and Figure 3B When the concentration of the target nucleic acid is not less than 100 copies / µL, the on-state current value measured by the FET sensor is less than the positive threshold, and the detection result is positive; when the concentration of the target RNA is 10 -1 copies / µL, the on-state current value measured by the FET sensor is greater than the positive threshold, and the detection result is negative. The results show that the minimum detection limit of the immune magnetic bead assisted CRISPR-FET biosensor nucleic acid detection method is 10 0 copies / µL. Figure 3A The transfer curve of the CRISPR-FET biosensor detecting 10 4 copies / µL, 10 3 copies / µL, 10 2 copies / µL, 10 1 copies / µL, 10 0 copies / µL, and 10 -1 copies / µL, NC group; Figure 3B The on-state current value of the transfer curve obtained by the CRISPR-FET biosensor for each group is shown, NC is the negative control (the detection template is enzyme-free water), the black dotted line indicates the positive detection threshold, n=3. The positive threshold (Cut-off Value) is the average on-state current value of the three groups of NC minus three standard deviations.

[0066] Example 4 A FET method for detecting influenza A virus RNA and a specificity detection method for its application, the detection steps and results are as follows.

[0067] In order to further verify the specificity of the immune magnetic bead assisted CRISPR-FET biosensor nucleic acid detection of the influenza A virus, the present application uses the CRISPR-FET biosensor to detect the nucleic acid substances (the concentration is 10 4 copies / μL) of five different pathogens (IAV, EBoV, JuninV, VEEV and YFV), and uses enzyme-free water as a template as a negative control to verify the specificity of the method.

[0068] The experimental results are shown in Figure 4A and Figure 4B The average value of the on-state current value of the negative control group (NC) minus 3 times the standard deviation to calculate the positive threshold value. The on-state current value of the positive control group (PC) is less than the positive threshold value, and is determined as positive, and the on-state current value of the remaining group and the negative control group (NC) is greater than the positive threshold value, and is determined as negative. The results show that the CRISPR-FET biosensor only appears a positive result when detecting the nucleic acid of the influenza A virus, and the results are all negative when detecting the nucleic acid of the non-influenza A virus, which indicates that the method has no cross reaction with the other four pathogens, and further indicates that the method has good specificity. Figure 4A : indicates the transfer curve of the CRISPR-FET biosensor for detecting IAV, EBoV, JuninV, VEEV, YFV and NC group. Figure 4B : indicates the on-state current value of the transfer curve of each group detected by the CRISPR-FET biosensor, NC is the negative control (the template is enzyme-free water), the black dotted line indicates the positive detection threshold value, n=3. The positive threshold value (Cut-off Value) is the average value of the on-state current of the three groups of NC minus 3 times the standard deviation.

[0069] Through the above description of the present application patent, the present application has the following innovations: 1. The present application patent screens out the influenza A virus specific RT-RAA primer and crRNA, and establishes the RT-RAA-CRISPR fluorescence method, and the CRISPR-FET influenza A virus nucleic acid detection method.

[0070] 2. The present application patent combines the CRISPR system with the FET biosensor to establish the immune magnetic bead assisted CRISPR-FET biosensor influenza A virus nucleic acid detection method.

[0071] 3. The present application does not need nucleic acid amplification step, at the same time, compared with the FET sensor reported in the current literature, it firstly avoids the complex chip modification and probe fixation step, and can detect low to 1 copies / μL of viral nucleic acid within 20 minutes, achieving the effect of ultra-fast, simple, portable, high sensitivity and high specificity detection. The method is suitable for on-site rapid qualitative detection of influenza A virus in resource-limited areas, and has important application value in the field of detection and identification of influenza A virus.

[0072] Finally, it should be pointed out that the above detailed description is of the preferred embodiments of the present application. However, the present application is not limited to the specific details in the above embodiments, and various simple modifications can be made to the technical solutions of the present application within the technical concept of the present application. These simple modifications all belong to the protection scope of the present application.

[0073] In addition, it should be pointed out that the various specific technical features described in the above specific embodiments can be combined in any way without contradiction. In order to avoid unnecessary repetition, the present application will not further describe various possible combinations. In addition, various different embodiments of the present application can also be combined in any way, as long as it does not deviate from the idea of the present application, it should also be considered as disclosed by the present application.

Claims

1. A method for detecting influenza A virus RNA by FET method, characterized in that, It comprises a CRISPR-Cas13a system for detecting influenza A virus and a field effect transistor biosensor used in conjunction therewith; The CRISPR-Cas13a system for detecting influenza A virus comprises a composition, a Cas13a protein and a reporter RNA; The detection chip of the field effect transistor biosensor used in conjunction therewith is a carbon-based biosensor chip, which is used for detection by using a transfer curve on a field effect transistor carbon-based biological workstation.

2. The method of claim 1, wherein the FET method for detecting the RNA of the influenza A virus is characterized by, The composition comprises a crRNA, which comprises an anchor sequence for binding with the Cas13a protein and a guide sequence targeting an RNA target sequence of the influenza A virus.

3. The method of claim 2, wherein the FET method for detecting the RNA of the influenza A virus is characterized by, The CRISPR-Cas13a system comprises a1) -a2) as follows: a1) crRNA and LwCas13a protein alone or crRNA and LwCas13a protein complex; the target sequence of the crRNA is sequence crRNA1; a2) the reporter RNA consists of 20 U, and the sequence of the reporter RNA is labeled with gold nanoparticles and biotin at both ends, and streptavidin magnetic beads for separating probes. 4.The detection technique for detecting influenza A virus RNA based on the CRISPR-Cas13a system FET method according to claim 2, wherein, In the crRNA, the anchor sequence is the 1st-38th of sequence crRNA1.

5. The method of claim 2, wherein the FET method for detecting the RNA of the influenza A virus is characterized by, The guide sequence is the 39th-66th of sequence crRNA1.

6. A detection method for detecting influenza A virus RNA based on a CRISPR-Cas13a system FET method, characterized in that, It comprises the following steps: Step B1: analysis of conserved region sequence and preparation of plasmid; Step B2: preparation of conserved sequence RNA; Step B3: design of crRNA; Step B4: preparation of crRNA; Step B5: screening of crRNA. 7.The method of claim 6, wherein the method is a method of detecting an influenza A virus RNA based on a CRISPR-Cas13a system-based FET method. Step B1 further comprises extracting nucleic acid of a sample to be tested as a template, preparing a CRISPR-Cas13a detection system for reaction, the CRISPR-Cas13a detection system comprising the above-mentioned composition, Cas13a protein, reporter RNA; at the same time, water is used to replace the nucleic acid template as a negative control; The system is detected to read the detection signal. 8.The method of claim 7, wherein the method is for detecting influenza A virus RNA based on a CRISPR-Cas13a system-based FET method. The reaction condition is: 37℃, reaction for 15 minutes. 9.The method of claim 8, wherein the method is for detecting influenza A virus RNA based on a CRISPR-Cas13a system-based FET method. The sample to be tested can be a throat swab.

10. Use of a method of detection of an influenza A virus RNA based on a CRISPR-Casl3a system according to any one of claims 6 to 9, characterized in that, The application comprises the following categories: C1, preparing a product for detecting influenza A virus RNA or detecting influenza A virus RNA; C2, preparing a product for detecting or assisting in detecting whether the sample to be tested contains influenza A virus RNA or preparing a product for detecting or assisting in detecting whether the sample to be tested contains influenza A virus RNA; C3, preparing a product for screening whether a target individual carries influenza A virus or screening whether a target individual carries influenza A virus; C4, preparing a product for diagnosing influenza A virus infection or diagnosing influenza A virus infection; C5, preparing or assisting in preparing a kit for detecting influenza A virus detection.