Crispr-related methods and compositions for targeting CD70 expression

Abstract

The present disclosure relates to CRISPR related systems and components for targeting, editing and / or modulating CD70 (Cluster of Differentiation 70) gene expression. The disclosure also relates to methods and uses thereof related to engineered cells comprising T cells or T cell precursors.

Description

Related Applications

[0001] This application claims priority to U.S. Provisional Patent Application No. 63 / 504,671, filed May 26, 2023, the entire contents of which are incorporated herein by reference. TECHNICAL FIELD

[0002] The present disclosure relates to CRISPR-associated systems and components for targeting, editing, and / or modulating CD70 (cluster of differentiation 70) gene expression. The present disclosure also relates to methods and applications thereof related to diseases, including, for example, engineered cells (including T cells or T cell precursors). BACKGROUND

[0003] CRISPR (clustered regularly interspaced short palindromic repeats) evolved in bacteria and archaea as an adaptive immune system to defend against viral attacks. Upon exposure to a virus, short segments of viral DNA are integrated into the CRISPR locus. RNA is transcribed from a portion of the CRISPR locus that includes the viral sequence. This RNA contains sequences complementary to the viral genome, mediating targeting of Cas proteins to the target sequence in the viral genome. Cas proteins in turn cleave the viral target and thereby silence the viral target. Naturally occurring CRISPR systems are evolutionarily classified into two classes and five types. Cas12a (also known as Cpf1) represents a class 2 type V CRISPR / Cas system that has been adapted for genome editing in eukaryotic cells. Introduction of a site-specific double-strand break (DSB) into a targeted sequence allows for knock-out of a gene by formation of an indel through endogenous DNA repair mechanisms, such as non-homologous end joining (NHEJ). Introduction of a site-specific DSB into a targeted sequence can also facilitate gene conversion or gene correction by incorporation of an exogenous homologous sequence or endogenous homologous sequence with a repair template, such as homology directed repair (HDR).

[0004] The human CD70 gene is located on chromosome 19. The CD70 transcript (ENST00000245903) contains 3 exons, encoding the CD70 (cluster of differentiation 70) protein. CD70 is a cell membrane-bound antigen that interacts with its receptor CD27. CD70 is a member of the TNF superfamily and plays a role in T cell activation and proliferation. CD70 protein is transiently expressed on the surface of activated immune cells, including T cells and B cells, but is also overexpressed in various types of tumors. SUMMARY

[0005] The presently disclosed subject matter relates to RNA-guided nuclease related (e.g., CRISPR / Cas related) methods, genome editing systems, and compositions for targeting, editing, or modulating expression of a target CD70 nucleic acid sequence, and their applications related to CD70. The presently disclosed subject matter also provides genome editing systems, compositions, vectors, and methods for editing a target CD70 gene using CRISPR / Cas related components to edit the genome of a human T cell.

[0006] Provided herein are genome editing systems, RNA-guided nucleases, Cas12a (also known as Cpf1) proteins (including modified Cas12a proteins (Cas12a variants)), guide RNAs, and ribonucleoprotein (RNP) complexes for modulating CD70 expression. In certain embodiments, the RNP complex can include a guide RNA (gRNA) complexed with a wild-type Cas12a or modified Cas12a RNA-guided nuclease (modified Cas12a protein). In certain embodiments, the modified Cas12a protein is an activity-enhanced AsCas12a protein with a nuclear localization sequence (NLS). In certain embodiments, the AsCas12a protein comprises amino acid alterations to increase activity and / or inactivate RNase activity. In certain embodiments, the AsCas12a protein comprises a C-terminal linker and a nuclear localization sequence. In certain embodiments, the RNP complex comprises a guide RNA (gRNA) molecule targeting a CD70 gene sequence. In certain embodiments, the RNP complex is transfected into a target cell and induces editing, resulting in formation of an indel within or near a target sequence of the CD70 gene. In certain embodiments, the editing results in a knockout of the CD70 gene.

[0007] In some embodiments, the target cells provided herein are engineered cells and comprise one or more genomic edits. In some embodiments, the target cells provided herein are immune competent cells, e.g., T cells, CD8+ T cells (e.g., CD8+ naive T cells, central memory T cells, or effector memory T cells), CD4+ T cells, alpha / beta T cells, gamma / delta T cells, natural killer T cells (NKT cells), regulatory T cells (Tregs), stem cell memory T cells, lymphoid progenitor cells, hematopoietic stem cells, natural killer cells (NK cells), or dendritic cells. In some embodiments, the target cells further comprise a chimeric antigen receptor (CAR). In some embodiments, the target cells are T cells and the one or more edits enhance their efficacy in immunotherapeutic methods. For example, in some embodiments, provided are T cells that comprise one or more edits (resulting in loss of function of a gene or protein associated with suppression of T cell function in a therapeutic context) and / or one or more modifications (resulting in expression of an exogenous nucleic acid or protein associated with enhanced T cell function in a therapeutic context). In some embodiments, the target cells provided herein comprise one or more genomic edits, e.g., an indel or insertion of an exogenous nucleic acid construct resulting from cleavage of a genomic locus with an RNA-guided nuclease. The use of RNA-guided nuclease technology in the context of generating modified T cells allows for the engineering of complex alterations with enhanced features relevant for clinical applications. BRIEF DESCRIPTION OF DRAWINGS

[0008] The drawings are intended to provide illustrative and schematic rather than comprehensive examples of certain aspects and embodiments of the present disclosure. The drawings are not intended to limit or bind to any particular theory or model, and are not necessarily to scale. Without limitation of the foregoing, nucleic acids and polypeptides can be depicted as linear sequences, or as schematic two- or three-dimensional structures; these depictions are intended to be illustrative, rather than limiting or binding to any particular model or theory regarding their structure.

[0009] Figure 1 Screening results for RNP targeting CD70 including different guide RNAs in CD4+ and CD8+ T cells are depicted. (Y-axis) Percent edit measured by next generation sequencing. RNP highest dose was 8,000 nM, titration ratio was 1 : 3.16, as indicated on the X-axis. Duplicate data points are from two independent nucleofection.

[0010] Figure 2RNP4 concentration response data in CD4+ and CD8+ cell populations for three different donors are shown. The highest dose of RNP was 8,000 nM, with a titration ratio of 1 : 3.16, as indicated on the X-axis. The percent edit on the upper plot Y-axis represents the percent of NGS reads containing an indel at the intended cleavage site + / - 15 bases. The percent CD70 on the lower plot Y-axis represents the percent of CD4 or CD8 cell population positive for cell surface CD70. Duplicate data points are from two independent nucleofection. DETAILED DESCRIPTION

[0011] Definitions and Abbreviations

[0012] Unless otherwise indicated, each of the following terms has the meaning associated with it as this section pertains.

[0013] The indefinite article "a" and "an" refers to at least one, and is used interchangeably with the term "at least one" and "one or more." For example, "a module" means at least one module, or one or more modules.

[0014] The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 3 or more than 3 standard deviations, per practices in the art. Alternatively, "about" can mean ranges approximately 20%, preferably approximately 10%, more preferably approximately 5%, and still more preferably approximately 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold and more preferably within 2-fold, of a value.

[0015] The conjunctions "or" and "and / or" are used interchangeably, as nonexclusive alternatives.

[0016] The phrase "consisting essentially of means that the recited species are the major species, but other species can be present in trace amounts or in amounts that do not affect the structure, function, or action of the subject composition. For example, a composition consisting essentially of a particular species typically comprises 90%, 95%, 96%, or more of that species.

[0017] "Domain" is used to describe a segment of a protein or nucleic acid. Unless otherwise indicated, a domain need not have any particular functional property.

[0018] An "indel" is an insertion and / or deletion in a nucleic acid sequence. An indel can be a repair product of a DNA double-strand break, such as a double-strand break formed by a genome editing system of the disclosure. Indels are most commonly formed when a break is repaired through an "error-prone" repair pathway, such as the NHEJ pathways described below.

[0019] A "gene conversion" refers to a change in a DNA sequence by incorporation of an endogenous homologous sequence, such as a homologous sequence within a gene array. A "gene correction" refers to a change in a DNA sequence by incorporation of an exogenous homologous sequence, such as an exogenous single- or double-stranded donor template DNA. Gene conversion and gene correction are products of repair of a DNA double-strand break through a HDR pathway, such as those described below.

[0020] Indels, gene conversions, gene corrections, and other genome editing outcomes are typically evaluated by sequencing, most commonly by "next-gen" or "sequencing-by-synthesis" methods, but Sanger sequencing can still be used, and quantified by the relative frequency of numerical changes (e.g., ± 1, ± 2, or more bases) at the site of interest among all sequencing reads. Sequencing DNA samples can be prepared by a variety of methods known in the art, and can include amplification of the site of interest by polymerase chain reaction (PCR), capturing of DNA ends generated by double-strand breaks, as in the GUIDEseq method described in Tsai et al. (Nat. Biotechnol. 34(5): 483 (2016), incorporated herein by reference), or by other means well known in the art. Genome editing outcomes can also be evaluated by in situ hybridization methods (e.g., the FiberComb™ system, commercialized by Genomic Vision (Bagneux, France)) and by any other suitable method known in the art.

[0021] "alt-HDR," "alternative homology-directed repair," or "alternative HDR" are used interchangeably to refer to a process of repair of DNA damage using a homologous nucleic acid, such as an endogenous homologous sequence (e.g., a sister chromatid) or an exogenous nucleic acid (e.g., a template nucleic acid). alt-HDR differs from classic HDR in that the process utilizes a different pathway than classic HDR, and can be inhibited by the classic HDR mediators RAD51 and BRCA2. alt-HDR also differs in that it involves a single-stranded or nuclease nicked homologous nucleic acid template, whereas classic HDR typically involves a double-stranded homologous template.

[0022] “Classical HDR,”“classical homology directed repair,” or“cHDR” refers to a process that uses a homologous nucleic acid (e.g., an endogenous homologous sequence (e.g., a sister chromatid) or an exogenous nucleic acid (e.g., a template nucleic acid)) to repair a DNA lesion. Classical HDR typically functions when there is significant resection at a double-strand break, forming at least one single-stranded portion of DNA. In normal cells, cHDR typically involves a series of steps such as recognition of the break, stabilization of the break, resection, stabilization of single-stranded DNA, formation of a DNA cross-over intermediate, resolution of the cross-over intermediate, and ligation. The process requires RAD51 and BRCA2, and the homologous nucleic acid is typically double-stranded.

[0023] The term“HDR” as used herein encompasses both classical HDR and alt-HDR, unless otherwise indicated.

[0024] “Non-homologous end joining” or“NHEJ” refers to ligation-mediated repair and / or non-template mediated repair, including classical NHEJ (cNHEJ) and alternative NHEJ (altNHEJ), which in turn includes microhomology-mediated end joining (MMEJ), single-strand annealing (SSA), and synthetic-dependent microhomology-mediated end joining (SD-MMEJ).

[0025] “Alternative” or“alternatively,” when used in connection with a modification of a molecule (e.g., a nucleic acid or a protein), does not require a limitation on the method, but only indicates that the alternative entity is present.

[0026] The term“knock-out” refers to an inactivating mutation of a target gene, wherein the product of the target gene comprises a loss of function.

[0027] “Gene product” refers to a biochemical product produced by the expression of a gene, and includes an RNA or a protein encoded by the gene.

[0028] “On-target site” refers to an exact genomic sequence or locus within a gene of interest that a guide RNA is designed to target. “Off-target site” refers to a genomic sequence or locus that is not within a gene of interest and that is found to be edited by an RNA-guided nuclease.

[0029] “Subject” means a human or non-human animal. A human subject can be of any age (e.g., infant, child, adolescent, or adult), and can have a disease, or can need a genetic alteration. Alternatively, a subject can be an animal, which term includes, but is not limited to, mammals, birds, fish, reptiles, amphibians, and more particularly non-human primates, rodents (e.g., mice, rats, hamsters, etc.), rabbits, guinea pigs, dogs, cats, etc. In certain embodiments of the disclosure, the subject is a livestock animal, e.g., a cow, a horse, a sheep, or a goat. In certain embodiments, the subject is a poultry animal.

[0030] “a / b T cells” refer to T lymphocytes that express a b T cell receptor (TCR), while “g / d T cells” express g d TCR.

[0031] As used herein, “therapeutically effective amount” refers to the amount of a cell and / or composition that, when administered to a subject for treating a disease, is sufficient to beneficially affect such disease treatment.

[0032] “Treat,” “treating,” and “treatment” mean treating a disease in a subject (e.g., a human subject), including one or more of: inhibiting the disease, i.e., arresting or preventing its development or progression; relieving the disease, i.e., causing regression of the disease state; relieving one or more symptoms of the disease; and curing the disease.

[0033] “Prevent,” “preventing,” and “prevention” mean preventing a disease in a mammal (e.g., a human), including: (a) avoiding or precluding the disease; (b) affecting a predisposition toward the disease; or (c) preventing or delaying the onset of at least one symptom of the disease.

[0034] “Kit” refers to any collection of two or more components that together constitute a functional unit useful for a particular purpose. By way of illustration (and not limitation), a kit according to the present disclosure can include a guide RNA complexed with, or capable of complexing with, an RNA-guided nuclease, and accompanied (e.g., suspended in, or suspendable in) a pharmaceutically acceptable carrier. The kit can be used to introduce the complex into, for example, a cell or a subject, for the purpose of causing a desired genomic alteration in such cell or subject. The components of the kit can be packaged together, or the components can be packaged separately. A kit according to the present disclosure also optionally includes a description of use (DFU) that describes, for example, use of the kit according to a method of the present disclosure. The DFU can be packaged physically with the kit, or it can be provided to a user of the kit, for example, electronically.

[0035] The terms "polynucleotide," "nucleotide sequence," "nucleic acid," "nucleic acid molecule," "nucleic acid sequence," and "oligonucleotide" refer to a series of nucleotide bases (also referred to as "nucleotides") in DNA and RNA and mean any chain of two or more nucleotides. Polynucleotides, nucleotide sequences, nucleic acids, and the like can be in the form of chimeric mixtures or derivatives or modified versions thereof, single or double stranded. They can be modified at the base moiety, sugar moiety, or phosphate backbone, for example, to improve stability of the molecule, its hybridization properties, and the like. Nucleotide sequences typically carry genetic information, including but not limited to information that is used by cellular machinery to make proteins and enzymes. These terms include double- or single-stranded genomic DNA, RNA, any synthetic and genetically manipulated polynucleotides, and both sense and antisense polynucleotides. These terms also include nucleic acids containing modified bases.

[0036] Conventional IUPAC notation is used in the nucleotide sequences presented herein, as shown in Table 1 below (see also Cornish-Bowden A, Nucleic Acids Res. 1985 May 10; 13(9):3021-30, which is incorporated herein by reference). It should be noted, however, that in those instances where the sequence can be encoded by either DNA or RNA, for example in gRNAs, for example in gRNA targeting domains, "T" denotes "thymine or uracil."

[0037] Table 1: IUPAC nucleic acid notation

[0038]

[0039] The terms "protein," "peptide," and "polypeptide" are used interchangeably and refer to a contiguous chain of amino acids linked together via peptide bonds. These terms include individual proteins, groups or complexes of proteins associated together, as well as fragments or portions, variants, derivatives, and analogs of such proteins. Peptide sequences are presented herein using conventional notation, starting at the left with the amino or N-terminus and proceeding to the right carboxyl or C-terminus. Standard one-letter or three-letter abbreviations can be used.

[0040] The term "variant" refers to a polypeptide, polynucleotide, or small molecule, etc. entity that exhibits substantial structural identity to a reference entity, but which has structural differences from the reference entity in the presence or level of one or more chemical moieties as compared to the reference entity. In many embodiments, a variant is also functionally different from its reference entity. Generally, whether a particular entity is properly considered a "variant" of a reference entity is based on the degree of structural identity it shares with the reference entity.

[0041] The term "promoter," as used herein, refers to a genomic region (i.e., a DNA sequence) that initiates transcription of a gene.

[0042] As used herein, the term "endogenous" in the context of nucleic acids (e.g., genes, protein-coding genomic regions, promoters) refers to a native nucleic acid or protein in its natural location (e.g., within the genome of a cell). In contrast, the term "exogenous" as used herein in the context of nucleic acids such as expression constructs, cDNAs, insertions / deletions, and nucleic acid vectors refers to a nucleic acid that has been artificially introduced into the genome of a cell using, for example, gene editing or genetic engineering techniques (e.g., CRISPR-based editing techniques).

[0043] The terms "RNA-guided nuclease" and "RNA-guided nuclease molecule" are used interchangeably herein. In some embodiments, the RNA-guided nuclease is an RNA-guided DNA endonuclease. In some embodiments, the RNA-guided nuclease is a CRISPR nuclease. Non-limiting examples of RNA-guided nucleases are listed in Table 2 below, and the methods and compositions disclosed herein can use any combination of RNA-guided nucleases disclosed herein or known to one of ordinary skill in the art. One of ordinary skill in the art will know of additional nucleases and nuclease variants suitable for use in the context of the present disclosure, and it should be understood that the present disclosure is not limited in this respect.

[0044] Table 2: RNA-guided nucleases

[0045]

[0046]

[0047] Additional suitable RNA-guided nucleases (e.g., Cas9 and Cas12 nucleases) will be apparent to those of skill in the art in light of the present disclosure, and the present disclosure is not limited by the exemplary suitable nucleases provided herein. In some embodiments, a suitable nuclease is a Cas9 or Cas12a (Cpf1) nuclease. In some embodiments, the present disclosure also includes nuclease variants, e.g., Cas9 or Cas12a nuclease variants. A nuclease variant refers to a nuclease comprising an amino acid sequence characterized by one or more amino acid substitutions, deletions, or additions compared to the wild-type amino acid sequence of the nuclease. Suitable nucleases and nuclease variants can also comprise purification tags (e.g., polyhistidine tags) and signal peptides (e.g., comprising or consisting of a nuclear localization signal sequence). Non-limiting examples of suitable nucleases and nuclease variants are described in greater detail elsewhere herein, and also include those described in PCT Application PCT / US2019 / 22374, filed March 14, 2019, and entitled “Systems and Methods for the Treatment of Hemoglobinopathies,” the entire contents of which are incorporated herein by reference.

[0048] In some embodiments, the RNA-guided nuclease is an Acidaminococcus sp. Cas12a Cpf1 (Cpfl) variant (also referred to as AsCas12a or AsCpfl). Suitable Cas12a (Cpfl) nuclease variants, including suitable AsCas12a variants, will be known or apparent to one of ordinary skill in the art based on the present disclosure, and include, but are not limited to, those disclosed herein or others known in the art. For example, in some embodiments, the RNA-guided nuclease is an Acidaminococcus sp. Cas12a RR variant (AsCas12-RR). In another embodiment, the RNA-guided nuclease is an AsCas12RVR variant. For example, suitable AsCas12 variants include those having an M537R substitution, an H800A substitution, and / or an F870L substitution, or any combination thereof (according to the numbering scheme of the AsCas12 wild-type sequence). Other non-limiting examples of suitable Cas12a variants are described in PCT Application PCT / US2018 / 065032, filed December 11, 2018, the entire contents of each of which are incorporated herein by reference.

[0049] As used herein, the term “hematopoietic stem cell” refers to a CD34+ stem cell that is capable of generating mature myeloid and lymphoid cell types, including T cells, natural killer cells, and B cells.

[0050] Genome editing system

[0051] Various genome editing systems known in the art can be used in the methods disclosed herein. Non-limiting examples of genome editing systems that can be used in connection with the subject matter of the present disclosure include, but are not limited to, CRISPR systems, zinc finger nuclease (ZFN) systems, transcription activator-like effector nuclease (TALEN) systems, meganucleases (MN) systems, MegaTAL systems, other targeted endonuclease systems, and other chimeric endonuclease systems.

[0052] In certain embodiments, the genome editing system has RNA-guided DNA editing activity. In certain embodiments, the genome editing system comprises at least two components adapted from naturally occurring CRISPR systems: a guide RNA (gRNA) and an RNA-guided nuclease. These two components form a complex that is capable of associating with a particular nucleic acid sequence and optionally editing DNA in or around that nucleic acid sequence, for example by making one or more of a single-strand break (SSB or nick), a double-strand break (DSB), and / or a point mutation.

[0053] Naturally occurring CRISPR systems are evolutionarily organized into two classes and five types (Makarova et al., Nat Rev Microbiol [Nature Reviews Microbiology]. June 2011; 9(6): 467-477 (Makarova), incorporated herein by reference), and while genome editing systems of the present disclosure can adapt components of any type or class of naturally occurring CRISPR systems, the embodiments presented herein are generally adapted from Class 2 and Type II or Type V CRISPR systems. Class 2 systems, which encompass Type II and Type V, are characterized by a relatively large, multi-domain RNA-guided nuclease protein (e.g., Cas9 or Casl2a) and one or more guide RNAs (e.g., crRNA and optionally tracrRNA), which form ribonucleoprotein (RNP) complexes that associate with (i.e., target) and cleave specific loci that are complementary to the targeting sequence (or spacer sequence) of the crRNA. Genome editing systems according to the present disclosure similarly target and optionally edit cellular DNA sequences, but differ significantly from CRISPR systems found in nature. For example, the single-molecule guide RNAs described herein do not exist in nature, and both the guide RNAs and the RNA-guided nucleases according to the present disclosure can incorporate any number of non-naturally occurring modifications.

[0054] The genome editing systems disclosed herein can be delivered into cells by electroporation. Other non-viral methods can also be used for gene editing of the target cells disclosed herein. For example, nucleic acid molecules can be introduced into cells / subjects by administering the nucleic acid in the presence of lipofection (Feigner et al., Proc. Natl. Acad. Sci. U.S.A. 84:7413, 1987; Ono et al., Neuroscience Letters 17:259, 1990; Brigham et al., Am. J. Med. Sci. 298:278, 1989; Staubinger et al., Methods in Enzymology 101:512, 1983), asialosialomucin-polylysine conjugation (Wu et al., Journal of Biological Chemistry 263:14621, 1988; Wu et al., Journal of Biological Chemistry 264:16985, 1989), or by microinjection under surgical conditions (Wolff et al., Science 247:1465, 1990). Other non-viral means for gene transfer include in vitro transfection using calcium phosphate, DEAE dextran, electroporation, and protoplast fusion. Lipid nanoparticles (LNP) or liposomes are also contemplated for use in delivering nucleic acid molecules into cells.

[0055] The genome editing systems disclosed herein can be delivered into a subject or cell using a viral vector (e.g., a retroviral vector, e.g., a gamma retroviral vector or a lentiviral vector). Combinations of retroviral vectors and appropriate packaging lines are suitable, where the capsid proteins will have the function of infecting human cells. Various amphotropic virus-producing cell lines are known, including but not limited to PA12 (Miller, et al. (1985) Mol. Cell. Biol. 5:431-437); PA317 (Miller, et al. (1986) Mol. Cell. Biol. 6:2895-2902); and CRIP (Danos, et al. (1988) Proc. Natl. Acad. Sci. USA 85:6460-6464). Non-amphotropic particles are also suitable, such as particles pseudotyped with VSVG, RD114, or GALV envelope and any other particles known in the art. Possible transduction methods also include co-culturing the cells with producer cells directly (e.g., by the method of Bregni, et al. (1992) Blood 80:1418-1422), or culturing with separate viral supernatant or with concentrated stock of the vector with or without appropriate growth factors and polycations (e.g., by the methods of Xu, et al. (1994) Exp. Hemat. 22:223-230; and Hughes, et al. (1992) J. Clin. Invest. 89:1817).

[0056] The genome editing systems can be implemented (e.g., administered or delivered to a cell or subject) in a variety of ways, and different implementations can be suitable for different applications. For example, in certain embodiments, the genome editing system is implemented as a protein / RNA complex (ribonucleoprotein or RNP), which can be contained in a pharmaceutical composition that optionally includes a pharmaceutically acceptable carrier and / or encapsulating agent, such as a lipid or polymeric microparticle or nanoparticle, micelle, liposome, etc. In certain embodiments, the genome editing system is implemented as one or more nucleic acids encoding the aforementioned RNA-guided nuclease and guide RNA components, optionally with one or more additional components. In certain embodiments, the genome editing system is implemented as one or more vectors containing such nucleic acids, such as a viral vector, e.g., an adeno-associated virus. In certain embodiments, the genome editing system is implemented as a combination of any of the foregoing. Additional or modified implementations operating according to the principles described herein will be apparent to the skilled artisan and are within the scope of the present disclosure.

[0057] It should be noted that the genome editing systems of the present disclosure can target a single specific nucleotide sequence, or can target (and enable parallel editing of) two or more specific nucleotide sequences through the use of two or more guide RNAs. Throughout the present disclosure, the use of multiple gRNAs is referred to as "multiplexing," and can be used to target multiple, unrelated, target sequences of interest, or to form multiple SSBs or DSBs within a single target domain, and in some cases, to produce a specific edit within such a target domain. For example, International Patent Publication No. WO 2015 / 138510 to Maeder (incorporated herein by reference) describes a genome editing system for correcting a point mutation (C.2991+1655A to G) in the human CEP290 gene that results in the creation of a cryptic splice site, which in turn reduces or eliminates the function of the gene. The genome editing system of Maeder utilizes two guide RNAs that target sequences on either side of (i.e., flanking) the point mutation, and form a DSB that flanks the mutation. This in turn facilitates the deletion of the intervening sequence including the mutation, thereby eliminating the cryptic splice site and restoring normal gene function.

[0058] In some cases, the genome editing system can form double-stranded breaks that are repaired by cellular DNA double-stranded break mechanisms, such as NHEJ or HDR. Descriptions of these mechanisms are widespread in the literature, such as Davis and Maizels, PNAS, 111(10):E924-932, March 11, 2014 (Davis) (describing Alt-HDR); Frit et al., DNA Repair 17 (2014) 81-97 (Frit) (describing Alt-NHEJ); and Iyama and Wilson III, DNA Repair (Amst.) 2013 Aug; 12(8): 620-636 (Iyama) (generally describing the canonical HDR and NHEJ pathways).

[0059] If the genome editing system operates by forming a DSB, then such a system optionally includes one or more components that facilitate or contribute to a particular double-stranded break repair mode or a particular repair outcome. For example, Cotta-Ramusino also describes a genome editing system in which a single-stranded oligonucleotide "donor template" is added; the donor template is incorporated into the target region of the cellular DNA that was cleaved by the genome editing system, and can result in a change in the target sequence.

[0060] In certain embodiments, the genome editing system modifies the target sequence without causing a double-stranded break, or modifies gene expression in or near the target sequence, e.g., by causing a single-stranded break or not making a cut (i.e., not creating a strand break). For example, the genome editing system can include an RNA-guided nuclease fused to a functional domain that acts on DNA, thereby modifying the target sequence or its expression. As one example, the RNA-guided nuclease can be linked to (e.g., fused to) a cytidine deaminase functional domain, and can operate by creating a targeted C-to-A substitution. For example, the RNA-guided nuclease can also be linked to (e.g., fused to) an adenosine deaminase functional domain. Exemplary nuclease / deaminase fusions are described in Komor et al. Nature 533, 420-424 (May 19, 2016) and Kantor et al., Int. J. Mol. Sci. 21(17) 6240 (2020), which are hereby incorporated by reference in their entireties. Additional non-limiting examples of suitable base editors, variants thereof, and strategies for making RNA-guided nucleases comprising the same are described in PCT applications: PCT / US2020 / 016664, filed February 4, 2020; PCT / US2020 / 018192, filed February 13, 2020; PCT / US2020 / 049975, filed September 9, 2020; PCT / US2022 / 012054, filed January 11, 2022; and PCT / US2022 / 078655, filed October 25, 2022, the entire contents of each of which are incorporated herein by reference. Alternatively, the genome editing system can utilize a cleavage-inactivated (i.e., “dead”) nuclease, e.g., a dead Cas9 (dCas9), and can operate by forming a stable complex over one or more targeted regions of cellular DNA, thereby recruiting other functional domains and / or interfering with functions involving the one or more targeted regions, including but not limited to mRNA transcription, chromatin remodeling, etc.

[0061] In certain embodiments, the RNA-guided nuclease of the present disclosure can comprise a polymerase domain (e.g., a reverse transcriptase domain). In certain embodiments, the RNA-guided nuclease can use a gRNA having a primer binding sequence and / or a polymerase domain template.

[0062] In certain embodiments, the RNA-guided nuclease can be a prime editor (PE), where the PE is an RNA-guided nuclease with nickase activity fused to a reverse transcriptase domain. In certain embodiments, the PE can use a prime editing gRNA (pegRNA), where the pegRNA is a gRNA with a primer binding sequence (PBS) and a donor template, e.g., added at one of the ends (e.g., the 3’ end). In certain embodiments, the PE:pegRNA complex binds to the target DNA, and the nickase domain of the prime editor cuts only one strand, creating a flap. The PBS located on the pegRNA binds to the DNA flap, and the edited RNA sequence is reverse transcribed using the reverse transcriptase domain of the prime editor. The edited strand is incorporated into the DNA at the end of the nicked flap, and the target DNA is repaired with the new reverse transcribed DNA. The original DNA segment is removed by endonucleases within the cell. Additional methods of template-mediated gene editing using RNA-guided nucleases and polymerases are described in the following PCT publications: WO 2020 / 191233, WO 2020 / 191248, WO 2021226558, WO 2023283246, WO 2023 / 235501, and WO 2023 / 076898, each of which is incorporated herein by reference for all purposes.

[0063] Guide RNA (gRNA) molecule

[0064] The terms “guide molecule,” “guide RNA,” and “gRNA” refer to any nucleic acid that facilitates the specific association (or “targeting”) of an RNA-guided nuclease (e.g., Cas9 or Cas12a (Cpfl)) to a target sequence (e.g., a genomic or episomal sequence) in a cell. A gRNA can be a single molecule (comprising a single RNA molecule, and alternatively referred to as a chimera) or a module (comprising more than one, and typically two, separate RNA molecules, e.g., a crRNA and a tracrRNA, which are typically associated with each other, e.g., by duplexing). Descriptions of gRNAs and their components are found throughout the literature, e.g., Briner et al. (Molecular Cell 56(2), 333-339, October 23, 2014 (Briner), which is incorporated by reference), and Cotta-Ramusino. A guide molecule can be an RNA molecule. A guide molecule can also comprise one or more nucleotides other than RNA nucleotides, e.g., a guide molecule can be a DNA / RNA hybrid molecule, and / or a guide molecule can comprise one or more modified nucleotides (including but not limited to one or more modified DNA or RNA nucleotides).

[0065] In bacteria and archaea, Type II CRISPR systems generally comprise an RNA- guided nuclease protein (e.g., Cas9), a CRISPR RNA (crRNA) comprising a 5’ region that is complementary to a foreign sequence, and a trans-activating crRNA (tracrRNA) comprising a 5’ region that is complementary to a 3’ region of the crRNA and forms a duplex. Such duplexes can facilitate formation of Cas9 / gRNA complexes and are necessary for their activity. When Type II CRISPR systems are adapted for use in gene editing, it was discovered that crRNA and tracrRNA can be joined into a single single molecule or chimeric guide RNA, in one non-limiting example, by means of a four-nucleotide (e.g., GAAA) “tetraloop” or “linker” sequence that bridges the complementary regions of the crRNA (at its 3’ end) and tracrRNA (at its 5’ end). (Mali et al. Science. 2013 Feb 15; 339(6121): 823-826 (“Mali”); Jiang et al. Nat Biotechnol. 2013 Mar; 31(3): 233-239 (“Jiang”); and Jinek et al., 2012 Science Aug 17; 337(6096): 816-821 (“Jinek”), all incorporated herein by reference).

[0066] A guide RNA, whether single molecule or modular, comprises a “targeting domain” that is fully or partially complementary to a target domain within a target sequence, e.g., a DNA sequence in the genome of a cell in which editing is desired. Targeting domains are referred to in the literature by a variety of names, including but not limited to “guide sequence” (Hsu et al., Nat Biotechnol. 2013 Sep; 31(9): 827-832 (“Hsu”), incorporated herein by reference), “complementarity region” (Cotta-Ramusino), “spacer” (Briner), and collectively as “crRNA” (Jiang). Regardless of what name is given to it, a targeting domain is generally 10-30 nucleotides in length, and in certain embodiments 16-24 nucleotides in length (e.g., 16, 17, 18, 19, 20, 21, 22, 23, or 24 nucleotides in length), and in the Cas9 gRNA context is located at or near the 5’ end, and in the Cas12a gRNA context is located at or near the 3’ end.

[0067] In addition to the targeting domain, gRNAs typically (but not necessarily, as discussed below) include multiple domains that can influence the formation or activity of the gRNA / Cas complex. For example, as mentioned above, a duplexed structure formed by the first and second complementarity domains of the gRNA (also referred to as a repeat:anti-repeat duplex) interacts with the recognition (REC) lobe of Cas9 and can mediate formation of the Cas9 / gRNA complex. (Nishimasu et al., Cell 156, 935-949, February 27, 2014 (Nishimasu 2014) and Nishimasu et al., Cell 162, 1113-1126, August 27, 2015 (Nishimasu 2015), both of which are incorporated herein by reference). It is noted that the first and / or second complementarity domains can contain one or more poly-A stretches, which can be recognized by RNA polymerases as a termination signal. Thus, the sequence of the first and second complementarity domains is optionally modified to eliminate these stretches and to facilitate completion of in vitro transcription of the gRNA, for example by modifying using A-G exchanges as described in Briner, or by using A-U exchanges. These and other similar modifications to the first and second complementarity domains are within the scope of the present disclosure.

[0068] In addition to the first and second complementarity domains, Cas9 gRNAs typically include two or more additional duplexed regions that participate in nuclease activity in vivo, but not necessarily in vitro. (Nishimasu 2015). The first stem loop 1, near the 3' portion of the second complementarity domain, is variously referred to as the "proximal domain" (Cotta-Ramusino), "stem loop 1" (Nishimasu 2014 and 2015), and "nexus" (Briner). One or more additional stem loop structures are typically present near the 3' end of the gRNA, the number of which varies by species: s. pyogenes gRNAs typically include 2 3' stem loops (for a total of 4 stem loop structures, including the repeat:anti-repeat duplex), while S. aureus and other species have only one (for a total of 3 stem loop structures). A description of the conserved stem loop structures (more generally, and gRNA structures) organized by species is provided in Briner.

[0069] While the foregoing description focuses on gRNAs for use with Cas9, it will be appreciated that other RNA-guided nucleases have been (or can in the future) discovered or invented that utilize gRNAs that differ in some respects from those described in this regard. For example, Casl2a (also known as Cpf1; "CRISPR from Prevotella and Francisella 1") is an RNA-guided nuclease that does not require a tracrRNA to function. (Zetsche et al., 2015, Cell 163, 759-771 Oct 22, 2015 (Zetsche I), which is incorporated herein by reference). gRNAs for Casl2a genome editing systems generally include a targeting domain and a complementarity domain (alternatively referred to as a "handle"). It will also be noted that in gRNAs for use with Casl2a, the targeting domain is generally present at or near the 3' end, as opposed to the 5' end as described above in connection with Cas9 gRNAs (the handle is at or near the 5' end of Casl2a gRNAs).

[0070] Those skilled in the art will appreciate that while there can be structural differences between gRNAs from different prokaryotic species or between Casl2a and Cas9 gRNAs, the principles of operation of gRNAs are generally consistent. Because of this operational consistency, gRNAs can be broadly defined by their targeting domain sequences, and the skilled artisan will appreciate that a given targeting domain sequence can be incorporated into any suitable gRNA, including single molecule or chimeric gRNAs, or gRNAs that include one or more chemical modifications and / or sequence modifications (substitutions, additional nucleotides, truncations, etc.). Thus, for ease of presentation of the disclosure, gRNAs can be described only in terms of their targeting domain sequences.

[0071] More generally, the skilled artisan will appreciate that some aspects of the disclosure relate to systems, methods, and compositions that can be implemented using a variety of RNA-guided nucleases. To this end, unless otherwise specified, the term gRNA should be understood to encompass not only those gRNAs that are compatible with a particular RNA-guided nuclease (e.g., a particular species of Cas9 or Casl2a), but also any suitable gRNA that can be used with any RNA-guided nuclease. By way of illustration, in certain embodiments, the term gRNA can include gRNAs for use with any RNA-guided nuclease present in a class 2 CRISPR system (e.g., a type II or type V CRISPR system) or a RNA-guided nuclease derived or adapted from the same.

[0072] In some embodiments, the guide RNA used comprises modifications compared to a standard gRNA scaffold. Such modifications can include, for example, chemical modifications of a portion of the gRNA, such as a nucleobase or scaffold portion. In some embodiments, such modifications can also include the presence of DNA nucleotides within the gRNA, for example, internal or external to the targeting domain. In some embodiments, the modifications can include extensions of the gRNA scaffold, for example, by adding 1-100 nucleotides, including RNA and / or DNA nucleotides, at the 3’ or 5’ end of the guide RNA, for example, distal to the targeting domain.

[0073] In certain embodiments, a gRNA complexed with an unmodified or modified Cas12a protein can be modified to improve the editing efficiency of a target nucleic acid. In certain embodiments, the modified gRNA can comprise one or more modifications, including a phosphorothioate (PS2) bond modification, a 2’-O-methyl modification, one or more or a stretch of deoxyribonucleic acid (DNA) bases (also referred to herein as a “DNA extension”), or a combination thereof.

[0074] In some embodiments, a gRNA disclosed herein comprises one or more or a stretch of deoxyribonucleic acid (DNA) bases, also referred to herein as a “DNA extension.” In some embodiments, a gRNA disclosed herein comprises a DNA extension at the 5’ end of the gRNA, at the 3’ end of the gRNA, or a combination thereof. In certain embodiments, a DNA extension can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 DNA bases long. For example, in certain embodiments, a DNA extension can be 1, 2, 3, 4, 5, 10, 15, 20, or 25 DNA bases long. In certain embodiments, a DNA extension can comprise one or more DNA bases selected from adenine (A), guanine (G), cytosine (C), or thymine (T). In certain embodiments, a DNA extension comprises identical DNA bases. For example, a DNA extension can comprise a stretch of adenine (A) bases. In certain embodiments, a DNA extension can comprise a stretch of thymine (T) bases. In certain embodiments, a DNA extension comprises a combination of different DNA bases. In certain embodiments, a DNA extension can comprise or consist of a sequence set forth in Table 3. In certain embodiments, a gRNA disclosed herein comprises a DNA extension and one or more phosphorothioate bond modifications, one or more disulfide phosphorothioate (PS2) bond modifications, one or more 2’-O-methyl modifications, or a combination thereof. In certain embodiments, one or more modifications can be at the 5’ end of the gRNA, at the 3’ end of the gRNA, or a combination thereof. In certain embodiments, a gRNA comprising a DNA extension can comprise a sequence set forth in Table 3 comprising a DNA extension. Without wishing to be bound by theory, it is contemplated that any DNA extension can be used herein so long as it does not hybridize to the target nucleic acid targeted by the gRNA. In some embodiments, a DNA extension also exhibits an increase in editing efficiency at a target nucleic acid site relative to a gRNA that does not comprise such a DNA extension, for example, via altering gRNA stability, uptake, and / or activity.

[0075] In some embodiments, a gRNA disclosed herein comprises one or more or a stretch of ribonucleic acid (RNA) bases, also referred to herein as an "RNA extension." In some embodiments, a gRNA disclosed herein comprises an RNA extension at the 5' end of the gRNA, at the 3' end of the gRNA, or a combination thereof. In certain embodiments, an RNA extension can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 RNA bases long. For example, in certain embodiments, an RNA extension can be 1, 2, 3, 4, 5, 10, 15, 20, or 25 RNA bases long. In certain embodiments, an RNA extension can comprise one or more RNA bases selected from adenine (rA), guanine (rG), cytosine (rC), or uracil (rU), where "r" represents RNA, 2'-hydroxyl. In certain embodiments, an RNA extension comprises the same RNA base. For example, an RNA extension can comprise a stretch of adenine (rA) bases. In certain embodiments, an RNA extension comprises a combination of different RNA bases. In certain embodiments, an RNA extension can comprise or consist of a sequence set forth in Table 3. In certain embodiments, a gRNA disclosed herein comprises an RNA extension and one or more phosphorothioate bond modification, one or more disulfide phosphorothioate (PS2) bond modification, one or more 2'-O-methyl modification, or a combination thereof. In certain embodiments, the one or more modifications can be at the 5' end of the gRNA, at the 3' end of the gRNA, or a combination thereof. In certain embodiments, a gRNA comprising an RNA extension can comprise a sequence set forth in Table 3 comprising an RNA extension. A gRNA comprising an RNA extension at the 5' end of the gRNA can comprise a sequence disclosed herein. A gRNA comprising an RNA extension at the 3' end of the gRNA can comprise a sequence disclosed herein.

[0076] It is contemplated that the gRNAs disclosed herein can also include RNA extensions and DNA extensions. In certain embodiments, both RNA extensions and DNA extensions can be at the 5’ end of the gRNA, the 3’ end of the gRNA, or a combination thereof. In certain embodiments, the RNA extension is at the 5’ end of the gRNA and the DNA extension is at the 3’ end of the gRNA. In certain embodiments, the RNA extension is at the 3’ end of the gRNA and the DNA extension is at the 5’ end of the gRNA.

[0077] In some embodiments, the gRNA comprising a modification (e.g., a DNA extension at the 5’ end) is complexed with an RNA-guided nuclease (e.g., an AsCas12a nuclease) to form an RNP, which is then used to edit a target cell, e.g., a T cell. Exemplary suitable 5’ extensions for guide RNAs (e.g., Cas12a guide RNAs) are provided in the table below:

[0078] Table 3: gRNA 5’ extensions

[0079]

[0080]

[0081] Additional suitable gRNA modifications will be apparent to one of ordinary skill in the art based on the present disclosure. Suitable gRNA modifications include, for example, those described in PCT Application PCT / US2018 / 054027, filed October 2, 2018, and titled “MODIFIED CPF1 GUIDE RNA”; PCT Application PCT / US2015 / 000143, filed December 3, 2015, and titled “GUIDE RNA WITH CHEMICAL MODIFICATIONS”; PCT Application PCT / US2016 / 026028, filed April 5, 2016, and titled “CHEMICALLY MODIFIED GUIDE RNAs FOR CRISPR / CAS-MEDIATED GENE REGULATION”; and PCT Application PCT / US2016 / 053344, filed September 23, 2016, and titled “NUCLEASE-MEDIATED GENOME EDITING OF PRIMARY CELLS AND ENRICHMENT THEREOF”; the entire contents of each of which are incorporated herein by reference.

[0082] gRNA design

[0083] Methods for selection and validation of target sequences and off-target analysis have been previously described (e.g., Mali; Hsu; Fu et al., 2014 Nat biotechnol 32(3):279-84, Heigwer et al., 2014 Nat methods 11(2):122-3; Bae et al. (2014) Bioinformatics 30(10): 1473-5; and Xiao A et al. (2014) Bioinformatics 30(8): 1180-1182. Each of these references is incorporated herein by reference. In certain non-limiting embodiments, gRNA design can include the use of software tools to optimize selection of potential target sequences corresponding to a user’s target sequence, for example, to minimize total off-target activity across the genome. These and other guide selection methods are described in detail in Maeder and Cotta-Ramusino.

[0084] In certain embodiments, one or more or all of the nucleotides in a gRNA molecule are modified. Strategies for modifying gRNAs are described in WO 2019 / 152519, published August 8, 2019, the entire contents of which are expressly incorporated herein by reference.

[0085] Non-limiting examples of guide RNAs suitable for certain embodiments encompassed by the disclosure are provided herein (e.g., in the tables below). One of ordinary skill in the art will be able to envision suitable guide RNA sequences for use with a specific nuclease (e.g., Cas9 or Casl2a nuclease) given the disclosure of the target domain sequence as a DNA or RNA sequence. For example, a guide RNA comprising a targeting sequence consisting of RNA nucleotides will comprise an RNA sequence corresponding to the targeting domain sequence provided as a DNA sequence, and thus containing uracil, rather than thymidine nucleotides. For example, a guide RNA comprising a targeting domain sequence consisting of RNA nucleotides and described by the DNA sequence TTCCAGTGGGACGTAGCTGAG (SEQ ID NO: 27) will have a targeting domain of the corresponding RNA sequence rUrUrCrCrArGrUrGrGrGrArCrGrUrArGrCrUrGrArG (SEQ ID NO: 31). As will be apparent to one of skill in the art, such a targeting sequence will be linked to a suitable guide RNA scaffold (e.g., a crRNA scaffold sequence or a chimeric crRNA / tracrRNA scaffold sequence). Suitable gRNA scaffold sequences are known to one of ordinary skill in the art. For AsCasl2a, for example, a suitable scaffold sequence comprises the sequence rUrArArUrUrUrCrUrArCrUrCrUrUrGrUrArGrArU (SEQ ID NO: 36), added to the 5’ end of the targeting domain. One of skill in the art will further understand how to modify such a guide RNA. For example, the addition of a 25-mer DNA extension (SEQ ID NO: 7) will result in a guide RNA having, for example, the sequence ATGTGTTTTTGTCAAAAGACCTTTTrUrArArUrUrUrCrUrArCrUrCrUrUrGrUrArGrArUrUrUrCrCrArGrUrGrGrGrArCrGrUrArGrCrUrGrArG (SEQ ID NO: 35). It will be understood that the exemplary targeting sequences provided herein are not limiting, and that additional suitable sequences (e.g., variants of the particular sequences disclosed herein) will be apparent to one of skill in the art in light of the disclosure, given the general knowledge in the art.

[0086] In some embodiments, a gRNA for use in the disclosure is a gRNA targeting CD70 (CD70 gRNA). In some embodiments, a target sequence of a CD70 gene comprises or consists of a nucleotide sequence of at least 10, at least 16, at least 17, at least 18, at least 20, or at least 21 nucleotides in length. In certain embodiments, a target sequence or target locus of a CD70 gene has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity to the nucleotide sequence set forth in SEQ ID NOs: 24-52. In some embodiments, a target sequence or target locus of a CD70 gene has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequence set forth in SEQ ID NOs: 24-52. In some embodiments, a target sequence of a CD70 gene has fewer than 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequence set forth in SEQ ID NOs: 24-52. In some embodiments, a target sequence of a CD70 gene comprises or consists of the nucleotide sequence set forth in SEQ ID NOs: 24-27. In some embodiments, a target locus of a CD70 gene comprises the nucleic acid sequence set forth in SEQ ID NOs: 24-27.

[0087] In certain embodiments, a target sequence or target locus of a CD70 gene is in exon 2 of CD70. In certain embodiments, a target sequence of a CD70 gene comprises or consists of a nucleotide sequence of at least 10, at least 16, at least 17, at least 18, at least 20, or at least 21 nucleotides in length. In certain embodiments, a target sequence of a CD70 gene has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 55. SEQ ID NO: 55 is set forth below.

[0088] tttctggtcttttcttccagTGGGACGTAGCTGAGCTGCAGCTGAATCACACAGgtaacacgggggacgtggag [SEQ ID NO: 55]

[0089] In certain embodiments, a target sequence of a CD70 gene comprises or consists of the nucleotide set forth in SEQ ID NO: 26 or SEQ ID NO: 27. In certain embodiments, a target sequence of a CD70 gene comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 27.

[0090] In certain embodiments, the targeting domain of a gRNA can be complementary to either strand of a target sequence or locus of a CD70 gene. In some embodiments, the targeting domain of a gRNA molecule has at least 50%, 60%, 70%, 75%, 80%, 85%, 90%, or 95% sequence identity to the nucleotide sequence set forth in SEQ ID NO: 28-31. In some embodiments, the targeting domain of a gRNA molecule has 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequence set forth in SEQ ID NO: 28-31. In some embodiments, the targeting domain of a gRNA molecule has fewer than 2, 3, 4, 5, 6, 7, 8, 9, or 10 mutations relative to the nucleotide sequence set forth in SEQ ID NO: 28-31. In some embodiments, the targeting domain of a gRNA molecule comprises or consists of the nucleotide sequence set forth in SEQ ID NO: 28-31. In certain embodiments, the targeting domain of a gRNA targeting a CD70 gene is SEQ ID NO: 31. In some embodiments, a gRNA molecule targeting a CD70 gene comprises the nucleotide sequence set forth in SEQ ID NO: 32-35. In certain embodiments, a gRNA molecule targeting a CD70 gene comprises or consists of the sequence set forth in SEQ ID NO: 35. Exemplary CD70 gene target sequences, gRNA targeting domains, scaffold sequences, and DNA extensions are listed in Table 7.

[0091] Table 4: CD70 target sequences

[0092]

[0093] Table 5: CD70 guide sequences

[0094]

[0095] Table 6: CD70 (DNA / RNA oligos)

[0096]

[0097] Table 7: Exemplary guide RNAs (DNA / RNA oligos)

[0098]

[0099] gRNA modification

[0100] The activity, stability, or other characteristics of a gRNA can be altered by the incorporation of certain modifications. As one example, transiently expressed or delivered nucleic acids can be susceptible to degradation by, for example, cellular nucleases. Thus, a gRNA described herein can contain one or more modifications to the nucleosides or nucleotides that introduce stability against nucleases. While not wishing to be bound by theory, it is also believed that certain modified gRNAs described herein can exhibit reduced innate immune responses when introduced into a cell. Those of skill in the art will be aware of certain cellular responses that are generally observed in response to exogenous nucleic acids, particularly those of viral or bacterial origin, in cells, such as mammalian cells. Such responses can include induction of cytokine expression and release as well as cell death, which can be reduced or completely eliminated by the modifications presented herein.

[0101] Certain exemplary modifications discussed in this section can be included at any position within a gRNA sequence, including but not limited to at or near the 5’ end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 5’ end) and / or at or near the 3’ end (e.g., within 1-10, 1-5, or 1-2 nucleotides of the 3’ end). In some cases, the modification is positioned within a functional motif, such as a repeat-anti-repeat duplex of a Cas9 gRNA, a stem-loop structure of a Cas9 or Cas12a gRNA, and / or a targeting domain of a gRNA.

[0102] As one example, the 5’ end of a gRNA can include a eukaryotic mRNA cap structure or cap analog (e.g., a G(5’)ppp(5’)G cap analog, m7G(5’)ppp(5’)G cap analog, or 3’-O-Me-m7G(5’)ppp(5’)G anti-reverse cap analog (ARCA)), as shown below:

[0103]

[0104] A cap or cap analog can be added during chemical synthesis or in vitro transcription of a gRNA.

[0105] In a similar manner, the 5’ end of a gRNA can lack a 5’ triphosphate group. For example, an in vitro transcribed gRNA can be treated with a phosphatase (e.g., using calf intestinal alkaline phosphatase) to remove the 5’ triphosphate group.

[0106] Another modification includes the addition of a number (e.g., 1-10, 10-20, or 25-200) of adenine (A) residues to the 3’ end of a gRNA, referred to as a polyA tract. A polyA tract can be added to a gRNA during chemical synthesis, using a polyadenyl polymerase (e.g., E. coli poly(A) polymerase) after in vitro transcription, or in vivo with a polyadenylation sequence, as described in Maeder.

[0107] It should be noted that the modifications described herein can be combined in any suitable manner, e.g., either gRNAs transcribed from a DNA vector in vivo, or gRNAs transcribed in vitro, can include one or both of a 5' cap structure or cap analog and a 3' poly A stretch.

[0108] A guide RNA can be modified at the 3' terminal U ribose. For example, the two terminal hydroxyl groups of the U ribose can be oxidized to aldehyde groups, with concomitant opening of the ribose ring, to provide a modified nucleoside as shown below:

[0109]

[0110] wherein "U" can be unmodified or modified uridine. The 3' terminal U ribose can be modified by a 2'3' cyclic phosphate as shown below:

[0111]

[0112] wherein "U" can be unmodified or modified uridine.

[0113] A guide RNA can contain 3' nucleotides that are stabilized against degradation, e.g., by the incorporation of one or more of the modified nucleotides described herein. In certain embodiments, uridines can be replaced by modified uridines (e.g., 5-(2-amino)propyl uridine and 5-bromouridine), or by any of the modified uridines described herein; adenosines and guanosines can be replaced by modified adenosines and guanosines (e.g., with modifications at the 8 position, such as 8-bromoguanosine), or by any of the modified adenosines and guanosines described herein.

[0114] In certain embodiments, sugar modified ribonucleotides can be incorporated into a gRNA, e.g., wherein the 2' OH-group is replaced by a group selected from H, -OR, -R (where R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), halo, -SH, -SR (where R can be, e.g., alkyl, cycloalkyl, aryl, aralkyl, heteroaryl, or sugar), amino (where amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, diheteroarylamino, or an amino acid); or cyano (-CN). In certain embodiments, the phosphate backbone can be modified as described herein, e.g., with a phosphorothioate (PhTx) group. In certain embodiments, one or more nucleotides of a gRNA can each independently be a modified or unmodified nucleotide, including but not limited to 2'-sugar modified, e.g., 2'-O-methyl, 2'-O-methoxyethyl, or 2'-fluoro modified, including, e.g., 2'-F or 2'-O-methyl adenosine (A), 2'-F or 2'-O-methyl cytosine (C), 2'-F or 2'-O-methyl uridine (U), 2'-F or 2'-O-methyl thymidine (T), 2'-F or 2'-O-methyl guanosine (G), 2'-O-methoxyethyl-5-methyl uridine (Teo), 2'-O-methoxyethyl adenosine (Aeo), 2'-O-methoxyethyl-5-methyl cytosine (m5Ceo), and any combination thereof.

[0115] A guide RNA can also include a“locked” nucleic acid (LNA), in which the 2' OH-group can be linked to the 4' carbon of the same ribose, e.g., by a C1-6 alkylene or C1-6 heteroalkylene bridge. Any suitable moiety can be used to provide such a bridge, including but not limited to a methylene, propylene, ether, or amino bridge; O-amino (where amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino) and aminoalkoxy or O(CH2) n amino (where amino can be, e.g., NH2; alkylamino, dialkylamino, heterocyclyl, arylamino, diarylamino, heteroarylamino, or diheteroarylamino, ethylenediamine, or polyamino).

[0116] In certain embodiments, a gRNA can include modified nucleotides that are polycyclic (e.g., tricyclic; and“unlocked” forms, such as glycol nucleic acids (GNAs) (e.g., R-GNA or S-GNA, in which the ribose is replaced by a glycol unit attached to the phosphodiester bond), or threose nucleic acids (TNAs, in which the ribose is replaced by an alpha-L-threofuranosyl-(3'→2')).

[0117] Typically, gRNAs include a glycosyl ribose, which is a 5-membered ring with an oxygen. Exemplary modified gRNAs can include, but are not limited to, replacement of the oxygen in the ribose (e.g., with sulfur (S), selenium (Se), or an alkylene group, such as, for example, methylene or ethylene); addition of a double bond (e.g., to replace the ribose with a cyclopentenyl or cyclohexenyl group); annulation of the ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); expansion of the ribose (e.g., to form a 6- or 7-membered ring with additional carbons or heteroatoms, such as, for example, an anhydrohexitol, altitol, mannitol, cyclohexyl, cyclohexenyl, and morpholino, which also has a phosphoramidate backbone). While most sugar analogs alter the 2' position, other positions are amenable to modification as well, including the 4' position. In certain embodiments, the gRNA comprises a 4'-S, 4'-Se, or 4'-C-aminomethyl-2'-O-Me modification.

[0118] In certain embodiments, deazanucleotides (e.g., 7-deaza-adenosine) can be incorporated into gRNAs. In certain embodiments, O-alkylated and N-alkylated nucleotides (e.g., N6-methyladenosine) can be incorporated into gRNAs. In certain embodiments, one or more or all of the nucleotides in a gRNA molecule are deoxynucleotides.

[0119] RNA-guided nuclease

[0120] RNA-guided nucleases according to the disclosure include, but are not limited to, naturally occurring Class 2 CRISPR nucleases, such as Cas9 and Cas12a, and other nucleases derived or obtained therefrom. In terms of function, RNA-guided nucleases are defined as those nucleases that (a) interact with (e.g., complex with) a gRNA; and (b) associate with the gRNA or, optionally, cleave or modify a target region of DNA that includes (i) a sequence complementary to the targeting domain of the gRNA, and, optionally, (ii) another sequence termed the “protospacer adjacent motif” or “PAM,” which is described in more detail below. In describing the following examples, RNA-guided nucleases can be defined broadly in terms of their PAM specificity and cleavage activity, even though there can be variations among individual RNA-guided nucleases that share the same PAM specificity or cleavage activity. Those skilled in the art will appreciate that some aspects of the disclosure relate to systems, methods, and compositions that can be practiced using any suitable RNA-guided nuclease having a certain PAM specificity and / or cleavage activity. To this end, unless otherwise specified, the term RNA-guided nuclease should be understood as a generic term and is not limited to any particular type (e.g., Cas9 vs. Cas12a), species (e.g., S. pyogenes vs. S. aureus), or variant (e.g., full-length vs. truncated or split; naturally occurring PAM specificity vs. engineered PAM specificity, etc.) of RNA-guided nuclease.

[0121] The name PAM sequence derives from its sequential relationship to a “protospacer” sequence, which is complementary to the gRNA targeting domain (or “spacer sequence”). Together with the protospacer, the PAM sequence defines the target region or sequence for a particular RNA-guided nuclease / gRNA combination.

[0122] Different sequential relationships between PAM and protospacer can be required for various RNA-guided nucleases. For example, Cas9 nucleases recognize PAM sequences 3’ of the protospacer, while Cas12a, on the other hand, typically recognizes PAM sequences 5’ of the protospacer.

[0123] In addition to recognizing a particular sequential orientation of PAM and protospacer, RNA-guided nucleases can also recognize particular PAM sequences. For example, S. aureus Cas9 recognizes PAM sequences of NNGRRT or NNGRRV, where the N residues are immediately 3’ of the region recognized by the gRNA targeting domain. S. pyogenes Cas9 recognizes NGG PAM sequences. And F. novicida Cas12a recognizes TTN PAM sequences. PAM sequences have been identified for a variety of RNA-guided nucleases, and strategies for identifying novel PAM sequences have been described in Shmakov et al., 2015, Molecular Cell 60, 385-397, November 5, 2015. It should also be noted that an engineered RNA-guided nuclease can have a different PAM specificity than that of a reference molecule (e.g., in the case of an engineered RNA-guided nuclease, the reference molecule can be a naturally-occurring variant from which the RNA-guided nuclease was derived, or a naturally-occurring variant having the greatest amino acid sequence homology to the engineered RNA-guided nuclease).

[0124] In addition to its PAM specificity, an RNA-guided nuclease can be characterized by its DNA cleavage activity: naturally-occurring RNA-guided nucleases typically form DSBs in the target nucleic acid, but engineered variants have been generated that only generate SSBs (discussed above) (Ran and Hsu et al., Cell 154(6), 1380-1389, September 12, 2013 (Ran), incorporated herein by reference), or that do not cleave at all.

[0125] Cas9

[0126] The crystal structure of S. pyogenes Cas9 has been determined (Jinek 2014) as well as the crystal structure of S. aureus Cas9 complexed with a single molecule of guide RNA and target DNA (Nishimasu 2014; Anders 2014; and Nishimasu 2015).

[0127] Naturally occurring Cas9 proteins comprise two lobes: a recognition (REC) lobe and a nuclease (NUC) lobe; each lobe comprises specific structural and / or functional domains. The REC lobe comprises an arginine-rich bridge helix (BH) domain, as well as at least one REC domain (e.g., a REC1 domain and optionally a REC2 domain). The REC lobe shares no structural similarity with other known proteins, indicating that it is a unique functional domain. Without wishing to be bound by any theory, mutational analysis suggests a special functional role for the BH and REC domains: the BH domain appears to play a role in gRNA:DNA recognition, while the REC domain is thought to interact with the repeat:anti-repeat duplex of the gRNA and mediate formation of the Cas9 / gRNA complex.

[0128] The NUC lobe comprises a RuvC domain, an HNH domain, and a PAM interaction (PI) domain. The RuvC domain shares structural similarity with members of the retroviral integrase superfamily, and cleaves the non-complementary (i.e., bottom) strand of the target nucleic acid. It can be formed from two or more split RuvC motifs (e.g., RuvCI, RuvCII, and RuvCIII in S. pyogenes and S. aureus). Meanwhile, the HNH domain is structurally similar to the HNN endonuclease motif, and cleaves the complementary (i.e., top) strand of the target nucleic acid. As the name suggests, the PI domain contributes to PAM specificity.

[0129] While certain functions of Cas9 are associated with (but not necessarily entirely dependent on) specific domains described above, these and other functions can be mediated or influenced by other Cas9 domains or multiple domains on either lobe. For example, in S. pyogenes Cas9, as described in Nishimasu 2014, the repeat:anti-repeat duplex of the gRNA falls in a groove between the REC lobe and the NUC lobe, and nucleotides in the duplex interact with amino acids in the BH, PI, and REC domains. Some nucleotides in the first stem-loop structure also interact with amino acids in multiple domains (PI, BH, and REC1), as do some nucleotides in the second and third stem-loops (RuvC and PI domains).

[0130] Cas12a (formerly known as Cpf1)

[0131] A crystal structure of Acidaminococcus sp. Casl2a complexed with a crRNA and a double-stranded (ds) DNA target including a TTN PAM sequence has been solved by Yamano et al. (Cell. 2016 May 5; 165(4):949-962 (Yamano), which is incorporated herein by reference). Casl2a, like Cas9, has two lobes: a REC (recognition) lobe and a NUC (nuclease) lobe. The REC lobe includes REC1 and REC2 domains, which lack similarity to any known protein structure. Meanwhile, the NUC lobe includes three RuvC domains (RuvC-I, -II, and -III) and a BH domain. In contrast to Cas9, however, the Casl2a REC lobe lacks an HNH domain and includes other domains that also lack similarity to known protein structures: a structurally unique PI domain, three wedge (WED) domains (WED-I, -II, and -III), and a nuclease (Nuc) domain.

[0132] While Cas9 and Casl2a share similarities in structure and function, it should be appreciated that certain Casl2a activities are mediated by domains that are not analogous to any Cas9 domain. For example, cleavage of the complementary strand of the target DNA appears to be mediated by the Nuc domain, which is distinct in both order and space from the HNH domain of Cas9. Additionally, the non-targeting portion of the Casl2a gRNA (the handle) adopts a pseudoknot structure, rather than the stem-loop structure formed by the repeat:anti-repeat duplex in Cas9 gRNAs.

[0133] Modifications of RNA-guided nucleases

[0134] The RNA-guided nucleases described above have activities and properties that are useful for a variety of applications, but the skilled artisan will appreciate that RNA-guided nucleases can also be modified in certain cases to alter cleavage activity, PAM specificity, or other structural or functional features.

[0135] Referring first to modifications that alter cleavage activity, mutations that reduce or eliminate activity of a domain within the NUC lobe have been described above. Exemplary mutations that can be made in the RuvC domains, in the Cas9 HNH domain, or in the Casl2a Nuc domain are described in Ran and Yamano and in Cotta-Ramusino. Generally, mutations that reduce or eliminate activity in one of the two nuclease domains result in an RNA-guided nuclease with nickase activity, although it should be noted that the type of nickase activity varies depending on which domain is inactivated. As one example, inactivation of the RuvC domain or the Cas9 HNH domain results in a nickase.

[0136] For S. pyogenes (Kleinstiver et al., Nature. 2015 Jul 23; 523(7561): 481-5 (Kleinstiver I)) and S. aureus (Kleinstiver et al., Nat Biotechnol. 2015 Dec; 33(12): 1293-1298 (Klienstiver II)), modifications to PAM specificity relative to the naturally occurring Cas9 reference molecule have been described by Kleinstiver et al. Kleinstiver et al. also describe modifications that improve the targeting fidelity of Cas9 (Nature, 2016 Jan 28; 529, 490-495 (Kleinstiver III)). Each of these references is incorporated herein by reference.

[0137] RNA-guided nucleases have been split into two or more parts, as described by Zetsche et al. (Nat Biotechnol. 2015 Feb; 33(2): 139-42 (Zetsche II), which is incorporated by reference) and Fine et al. (Sci Rep. 2015 Jul 1; 5: 10777 (Fine), which is incorporated by reference).

[0138] In certain embodiments, the RNA-guided nuclease can be size-optimized or truncated, for example via one or more deletions that reduce the size of the nuclease while still retaining gRNA association, target and PAM recognition, and cleavage activity. In certain embodiments, the RNA-guided nuclease is bound to another polypeptide, nucleotide, or other structure, either covalently or non-covalently, optionally through a linker. Exemplary bound nucleases and linkers are described in Guilinger et al., Nature Biotechnology 32, 577-582 (2014), which is incorporated herein by reference for all purposes.

[0139] The RNA-guided nuclease also optionally includes a tag, such as but not limited to a nuclear localization signal, to facilitate movement of the RNA-guided nuclease protein into the nucleus. In certain embodiments, the RNA-guided nuclease can incorporate a C-terminal and / or N-terminal nuclear localization signal. Nuclear localization sequences are known in the art and described in Maeder and other literature.

[0140] The foregoing list of modifications is intended to be exemplary in nature, and the skilled artisan will appreciate that other modifications can be possible or desirable in certain applications in light of the present disclosure. Thus, for the sake of brevity, exemplary systems, methods, and compositions of the present disclosure are presented with reference to a particular RNA-guided nuclease, but it is to be understood that the RNA-guided nuclease used can be modified in a manner that does not change its operating principles. Such modifications are within the scope of the present disclosure.

[0141] Exemplary suitable nuclease variants include, but are not limited to, AsCasl2a variants comprising a M537R substitution, a H800A substitution, and / or a F870L substitution, or any combination thereof (according to the numbering scheme of the AsCasl2a wild-type sequence). Other suitable modifications to the AsCasl2a amino acid sequence are known to those of ordinary skill in the art. Some non-limiting exemplary sequences of wild-type AsCasl2a and AsCasl2a variants are as follows:

[0142] His-AsCasl2a-sNLS-sNLS H800A amino acid sequence

[0143]

[0144] Cas12a variant 1 amino acid

[0145]

[0146] Cas12a variant 2 amino acid sequence

[0147]

[0148] Cas12a variant 3 amino acid sequence

[0149]

[0150] Cas12a variant 4 amino acid sequence

[0151]

[0152] Cas12a variant 4 amino acid sequence

[0153]

[0154] Cas12a variant 5 amino acid sequence

[0155]

[0156] Cas12a variant 6 amino acid sequence

[0157]

[0158] Cas12a variant 7 amino acid sequence

[0159]

[0160] Exemplary AsCas12a wild type amino acid sequence

[0161]

[0162] In some embodiments, the RNA-guided nuclease has at least 80%, at least 85%, at least 86%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity relative to a wild-type RNA-guided nuclease and / or an RNA-guided nuclease disclosed herein (e.g., an RNA-guided nuclease comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 38-46 and SEQ ID NO: 56). In some embodiments, the RNA-guided nuclease has 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mutations relative to a wild-type RNA-guided nuclease and / or an RNA-guided nuclease disclosed herein (e.g., an RNA-guided nuclease comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 38-46 and SEQ ID NO: 56). In some embodiments, the RNA-guided nuclease has fewer than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 mutations relative to a wild-type RNA-guided nuclease and / or an RNA-guided nuclease disclosed herein (e.g., an RNA-guided nuclease comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 38-46 and SEQ ID NO: 56).

[0163] Nucleic acids encoding RNA-guided nucleases

[0164] Provided herein are nucleic acids encoding an RNA-guided nuclease (e.g., Cas9, Cas12a, or a functional fragment thereof). Exemplary nucleic acids encoding RNA-guided nucleases have been previously described (see, e.g., Cong 2013; Wang 2013; Mali 2013; Jinek 2012).

[0165] In some cases, the nucleic acid encoding the RNA-guided nuclease can be a synthetic nucleic acid sequence. For example, the synthetic nucleic acid molecule can be chemically modified. In certain embodiments, the nucleic acid encoding the RNA-guided nuclease is RNA. In certain embodiments, the nucleic acid encoding the RNA-guided nuclease is mRNA. In certain embodiments, the mRNA encoding the RNA-guided nuclease will have one or more (e.g., all) of the following properties: it can be capped; polyadenylated; and substituted with 5-methylcytosine and / or pseudouridine.

[0166] The synthetic nucleic acid sequence can also be codon-optimized, e.g., at least one uncommon codon or less common codon has been replaced with a common codon. For example, the synthetic nucleic acid can direct the synthesis of an optimized messenger mRNA (e.g., optimized for expression in a mammalian expression system such as described herein). An example of a codon-optimized Cas9-encoding sequence is presented in Cotta-Ramusino.

[0167] Additionally, or alternatively, the nucleic acid encoding the RNA-guided nuclease can comprise nucleic acid encoding a nuclear localization sequence (NLS). Nuclear localization sequences are known in the art.

[0168] Functional analysis of candidate molecules

[0169] Candidate RNA-guided nucleases, gRNAs, and complexes thereof can be evaluated by standard methods known in the art. See, e.g., Cotta-Ramusino. The stability of the RNP complex can be evaluated by differential scanning fluorimetry, as described below.

[0170] Differential scanning fluorimetry (DSF)

[0171] The thermal stability of the ribonucleoprotein (RNP) complex comprising the gRNA and the RNA-guided nuclease can be measured via DSF. DSF technology measures the thermal stability of proteins, which can be increased under favorable conditions, such as the addition of a binding RNA molecule, e.g., a gRNA.

[0172] DSF assays can be performed according to any suitable protocol, and can be used in any suitable environment, including but not limited to (a) testing different conditions (e.g., different stoichiometric ratios of gRNA:RNA-guided nuclease protein, different buffer solutions, etc.) to identify optimal conditions for RNP formation; and (b) testing modifications (e.g., chemical modifications, sequence alterations, etc.) of RNA-guided nuclease and / or gRNA to identify those that improve RNP formation or stability. One readout of a DSF assay is a shift in the melting temperature of the RNP complex; a relatively high shift indicates that the RNP complex is more stable (and can therefore have higher activity or more favorable formation kinetics, degradation kinetics, or another functional characteristic) relative to a reference RNP complex that is characterized by a lower shift. In arranging a DSF assay as a screening tool, a threshold melting temperature shift can be specified, such that the output is one or more RNPs with a melting temperature shift equal to or higher than the threshold. For example, the threshold can be 5°C-10°C (e.g., 5º, 6º, 7º, 8º, 9º, 10º) or higher, and the output can be one or more RNPs characterized by a melting temperature shift greater than or equal to that threshold.

[0173] Two non-limiting examples of DSF assay conditions are set forth below:

[0174] To determine optimal solutions for RNP complex formation, a fixed concentration (e.g., 2 µM) of RNA-guided nuclease (e.g., Cas9 or Cas12a) in water + 10x SYPRO Orange® (Life Techonologies catalog number S-6650) is dispensed into a 384-well plate. Equal molar amounts of gRNA are then added, diluted in solutions with different pH and salts. After incubation at room temperature for 10 minutes and a brief centrifugation to remove any air bubbles, a gradient from 20°C to 90°C is run using a Bio-Rad CFX384™ Real-Time System C1000 Touch™ thermal cycler and Bio-Rad CFX Manager software, with a 1°C increase per 10 seconds.

[0175] The second assay involves the following steps: mixing different concentrations of gRNA with a fixed concentration (e.g., 2 µM) of RNA-guided nuclease (e.g., Cas9 or Cas12a) in the optimal buffer from Assay 1 above, and incubating in a 384-well plate (e.g., for 10 minutes at room temperature). An equal volume of optimal buffer + 10x SYPRO Orange® (Life Technologies Cat# S-6650) is added, and the plate is sealed with Microseal® B adhesive (MSB-1001). After a brief centrifugation to remove any air bubbles, a gradient from 20°C to 90°C is run using a Bio-Rad CFX384™ Real-Time System C1000 Touch™ thermal cycler and Bio-Rad CFX Manager software, with a 1°C increase every 10 seconds.

[0176] Genome editing strategies

[0177] In various embodiments of the disclosure, the above-described genome editing systems are used to produce edits (i.e., alterations) in targeted regions of DNA within cells or obtained from cells. Various strategies for producing particular edits are described herein, and these strategies are generally described in terms of desired repair outcomes, the number and positioning of individual edits (e.g., SSBs or DSBs), and the target site of such edits.

[0178] Genome editing strategies involving the formation of SSBs or DSBs are characterized by the repair outcomes, which include: (a) deletion of all or part of the targeted region; (b) insertion in or replacement of all or part of the targeted region; or (c) disruption of all or part of the targeted region. This grouping is not intended to be limiting, or tied to any particular theory or model, but is provided merely for ease of presentation. The skilled person will appreciate that the listed outcomes are not mutually exclusive, and that some repairs can result in other outcomes. Unless otherwise specified, descriptions of particular editing strategies or methods are not to be understood as requiring a particular repair outcome.

[0179] In certain embodiments, replacement of a targeted region involves replacing all or part of an existing sequence within the targeted region with a homologous sequence, for example by gene correction or gene conversion, both of which outcomes are mediated through the HDR pathway. HDR is facilitated through the use of a donor template, which can be single-stranded or double-stranded, as described in more detail below. The single-stranded or double-stranded template can be exogenous, in which case it will facilitate gene correction, or can be endogenous (e.g. a homologous sequence within the cell genome) to facilitate gene conversion. The exogenous template can have an asymmetric overhang (i.e. the portion of the template that is complementary to the DSB site can be offset in the 3' or 5' direction, rather than being centered within the donor template), for example as described by Richardson et al. (Nature Biotechnology 34, 339-344 (2016), (Richardson), which is incorporated by reference). In the case where the template is single-stranded, it can correspond to the complementary (top) or non-complementary (bottom) strand of the targeted region.

[0180] In some cases, gene conversion and gene correction are facilitated by creating one or more nicks in or around the targeted region, as described in Ran and Cotta-Ramusino. In some cases, a dual-nicking enzyme strategy is used to create two offset SSBs, which in turn create a single DSB with an overhang (e.g. a 5' overhang).

[0181] Disruption and / or deletion of all or part of a targeted sequence can be achieved through a variety of repair outcomes. As one example, a sequence can be deleted by creating two or more DSBs that flank the targeted region, then excising the targeted region when the DSBs are repaired, as described in Maeder for the LCA10 mutation. As another example, a sequence can be disrupted by a deletion created by forming a double-stranded break with a single-stranded overhang, followed by exonucleolytic processing of the overhang prior to repair.

[0182] One particular subset of targeted sequence disruptions is mediated by forming an indel within the targeted sequence, where the repair outcome is typically mediated through the NHEJ pathway (including Alt-NHEJ). NHEJ is referred to as an "error-prone" repair pathway due to its association with indel mutations. However, in some cases, a DSB is repaired through NHEJ without changing the sequence around it (so-called "perfect" or "scarless" repair); this typically requires perfect ligation of the two ends of the DSB. Meanwhile, indels are thought to arise from enzymatic processing of DNA free ends prior to ligation, which adds and / or removes nucleotides in one or both strands of one or both free ends.

[0183] Because enzyme processing of DSB ends can be random, indel mutations tend to be variable, occur along a distribution, and can be influenced by a variety of factors, including the particular target site, the cell type used, the genome editing strategy used, etc. Even so, it is possible to draw limited generalizations about indel formation: deletions formed by repair of a single DSB most often range from 1-50 bp, but can reach greater than 100-200 bp. Insertions formed by repair of a single DSB tend to be short, and often include short repeats of sequence immediately surrounding the break site. However, large insertions are possible, and in these cases the sequence of the insertion often has been traced to other regions of the genome or to plasmid DNA present in the cell.

[0184] Indel mutations and genome editing systems configured to produce indels can be used, for example, to disrupt a target sequence when it is not necessary to produce a particular final sequence and / or where frameshift mutations can be tolerated. They can also be used in environments where a particular sequence is preferred, so long as certain desired sequences tend to occur preferentially through repair of SSBs or DSBs at a given site. Indel mutations are also useful as a tool to assess or screen the activity of particular genome editing systems and components thereof. In these and other environments, indels can be characterized by (a) their relative and absolute frequency in the genomes of cells contacted with the genome editing system, and (b) the distribution of numerical differences relative to the unedited sequence, e.g., ± 1, ± 2, ± 3, etc. As one example, in a lead-finding environment, multiple gRNAs can be screened based on indel readouts under controlled conditions to identify those gRNAs that most effectively drive cleavage at a target site. Guides that produce indels or particular distributions of indels at threshold frequencies or at frequencies higher than threshold can be selected for further study and development. Indel frequencies and distributions can also be used as readouts for assessing different genome editing system implementations or configurations and delivery methods, e.g., by keeping the gRNA constant and varying certain other reaction conditions or delivery methods.

[0185] Multiplexing strategies

[0186] While the exemplary strategies discussed above focus on repair outcomes mediated through a single DSB, genome editing systems according to the present disclosure can also be used to produce two or more DSBs in the same locus or in different loci. Editing strategies involving the formation of multiple DSBs or SSBs are described, for example, in Cotta-Ramusino.

[0187] In certain embodiments, the disclosure provides an isolated T cell or population of T cells comprising a modification (e.g., disruption) in two or more endogenous genes of the T cell. In certain embodiments, such modifications are introduced into the T cell or population of T cells by one or more genome editing systems described herein. In certain embodiments, the disclosure relates to the use of a genome editing system to edit a target CD70 target nucleic acid sequence and one or more additional endogenous genes of a T cell. For example, the additional endogenous gene can be selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, CIITA, TRBC, and any combination thereof. For example, but not by way of limitation, multiple modifications in the genome of a T cell can be made by delivering two or more complexes comprising an RNA-guided nuclease (e.g., Cas9 and / or Cas12a) and a gRNA molecule, e.g., an RNP complex, that target one or more of a CD70 gene sequence and a FAS gene sequence, a BID gene sequence, a CTLA4 gene sequence, a PDCD1 gene sequence, a CBLB gene sequence, a PTPN6 gene sequence, a B2M gene sequence, a TRAC gene sequence, a CIITA gene sequence, a TRBC gene sequence, or a combination thereof. For example, but not by way of limitation, two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, nine or more, or ten complexes, e.g., RNP complexes, can be delivered, where each of the complexes targets a different gene. In certain embodiments, the gRNA can be complementary to either strand of the gene to be targeted. In certain embodiments, the gRNA molecule can target a regulatory region, an intron, or an exon of the gene to be targeted. In certain embodiments, the genome editing system comprises a gRNA complementary to a CD70 target nucleic acid sequence and a gRNA complementary to a target nucleic acid sequence of one or more additional endogenous genes selected from the group consisting of FAS, BID, CTLA4, PDCD1, CBLB, PTPN6, B2M, TRAC, CIITA, TRBC, and combinations thereof. In certain embodiments, the gRNA can be complementary to either strand of the additional endogenous gene. In certain embodiments, the targeted portion of the additional endogenous gene is within the coding sequence of the additional endogenous gene. In certain embodiments, the targeted portion of the additional endogenous gene is within an exon. In certain embodiments, the targeted portion of the additional endogenous gene is within an intron. In certain embodiments, the targeted portion of the additional endogenous gene is within a regulatory region of the gene. In certain embodiments, more than one sequence of the additional endogenous gene is targeted, and the targeted portion of the additional endogenous gene is within one or more exons, one or more introns, one or more regulatory regions, or one or more exons, one or more introns, and one or more regulatory regions.In certain embodiments, the sequence of one or more gRNAs targeting an additional endogenous gene, or the sequence of one or more target DNA sequences of the additional endogenous gene, is set forth in International Patent Publication No. WO 2019 / 118516 or International Publication No. WO 2015 / 161276, both of which are incorporated herein by reference in their entirety.

[0188] Donor template design

[0189] Donor template design is described in detail in the literature, for example, in Cotta-Ramusino. DNA oligo donor templates (oligodeoxynucleotides or ODNs) can be single-stranded (ssODNs) or double-stranded (dsODNs), can be used to facilitate HDR-based repair of DSBs, and are particularly useful for introducing changes into a target DNA sequence, inserting new sequences into a target sequence, or replacing a target sequence entirely.

[0190] Whether single-stranded or double-stranded, donor templates typically include regions that are homologous to regions within or near (e.g., flanking or adjacent to) the target sequence to be cleaved. These homologous regions are referred to herein as “homology arms,” and are illustrated schematically below:

[0191] [5’ homology arm] - [replacement sequence] - [3’ homology arm].

[0192] Homology arms can have any suitable length (including zero nucleotides if only one homology arm is used), and the 3’ and 5’ homology arms can be the same length or can be different lengths. Selection of an appropriate homology arm length can be influenced by a variety of factors, such as a desire to avoid homology or microhomology to certain sequences (e.g., Alu repeat sequences or other elements). For example, the 5’ homology arm can be shortened to avoid sequence repeat elements. In other embodiments, the 3’ homology arm can be shortened to avoid sequence repeat elements. In certain embodiments, both the 5’ and 3’ homology arms can be shortened to avoid including certain sequence repeat elements. Additionally, some homology arm designs can improve editing efficiency or increase the frequency of a desired repair outcome. For example, Richardson et al. (Nature Biotechnology 34, 339-344 (2016) (Richardson), which is incorporated by reference) found that the relative asymmetry of the 3’ and 5’ homology arms of a single-stranded donor template influences repair rates and / or outcomes.

[0193] Substitution sequences in donor templates have been described in other literature, including in Cotta-Ramusino et al. The substitution sequence can be any suitable length (including 0 nucleotides if the desired repair outcome is a deletion), and typically includes 1, 2, 3, or more sequence modifications relative to the naturally occurring sequence within the cell that needs to be edited. One exemplary sequence modification involves altering the naturally occurring sequence to repair a mutation associated with a disease or condition that needs to be treated. Another exemplary sequence modification involves altering one or more sequences that are complementary to or encode a PAM sequence of an RNA-guided nuclease or a targeting domain of one or more gRNAs used to generate an SSB or DSB to reduce or eliminate repeated cleavage of the target site after the substitution sequence is incorporated into the target site.

[0194] If a linear ssODN is used, it can be configured to (i) anneal to the nicked strand of the target nucleic acid, (ii) anneal to the intact strand of the target nucleic acid, (iii) anneal to the plus strand of the target nucleic acid, and / or (iv) anneal to the minus strand of the target nucleic acid. The ssODN can have any suitable length, such as about, at least, or no more than 150-200 nucleotides (e.g., 150, 160, 170, 180, 190, or 200 nucleotides).

[0195] It should be noted that the template nucleic acid can also be a nucleic acid vector, such as a viral genome or a circular double-stranded DNA, such as a plasmid. The nucleic acid vector comprising the donor template can include other coding or non-coding elements. For example, the template nucleic acid can be delivered as part of a viral genome (e.g., in an AAV or lentiviral genome) that includes certain genomic backbone elements (e.g., inverted terminal repeat sequences in the case of an AAV genome) and optionally includes additional sequences encoding a gRNA and / or an RNA-guided nuclease. In certain embodiments, the donor template can be adjacent to or flanking a target site recognized by one or more gRNAs to facilitate the formation of free DSBs on one or both ends of the donor template, which can participate in repair of the corresponding SSBs or DSBs formed in the cellular DNA using the same gRNAs. Exemplary nucleic acid vectors suitable for use as donor templates are described in Cotta-Ramusino.

[0196] Regardless of the form used, the template nucleic acid can be designed to avoid undesirable sequences. In certain embodiments, one or both homology arms can be shortened to avoid overlapping certain sequence repeat elements (e.g., Alu repeats, LINE elements, etc.).

[0197] Quantitative measurement of on-target and off-target genome editing

[0198] It should be noted that the genome editing systems of the present disclosure allow for detection and quantitative measurement of on-target and off-target gene editing results. The compositions and methods described herein can rely on the use of PCR primer sequences to amplify genomic loci containing the intended cleavage site of the RNA-guided nuclease. In some embodiments, the primers include adaptor tails for a two-step PCR amplification process to prepare amplicon libraries for next generation sequencing (NGS) analysis. Non-limiting examples of primers and amplification sites for assessing on-target genome editing efficiency of the CD70 target site set forth in [SEQ ID NO: 27] are shown in Table 8.

[0199] Table 8: Exemplary primer and amplicon sequences for on-target cleavage site analysis

[0200]

[0201] In certain embodiments, the RNP disclosed herein has minimal or no off-target effects. In certain embodiments, the off-target effects of the RNP are measured by Digenome-seq analysis (Kim et al., Nature Methods (2015); 12:237-243). In certain embodiments, the off-target effects of the RNA are represented by the off-target counts measured by Digenome-seq analysis. In certain embodiments, the off-target counts are measured by Digenome-seq analysis at 1000 nM RNP. In certain embodiments, the off-target counts are measured by Digenome-seq analysis at 100 nM RNP.

[0202] In certain embodiments, the off-target count measured by Digenome-seq of an RNP disclosed herein is less than about 20, less than about 19, less than about 18, less than about 17, less than about 16, less than about 15, less than about 14, less than about 13, less than about 12, less than about 11, less than about 10, less than about 9, less than about 8, less than about 7, less than about 6, less than about 5, less than about 4, less than about 3, less than about 2, or less than about 1 at 1000 nM. In certain embodiments, the off-target count of an RNP disclosed herein measured by Digenome-seq is zero or about zero at 1000 nM. In certain embodiments, the off-target count of an RNP disclosed herein measured by Digenome-seq is less than about 20, less than about 19, less than about 18, less than about 17, less than about 16, less than about 15, less than about 14, less than about 13, less than about 12, less than about 11, less than about 10, less than about 9, less than about 8, less than about 7, less than about 6, less than about 5, less than about 4, less than about 3, less than about 2, or less than about 1 at 100 nM. In certain embodiments, the off-target count of an RNP disclosed herein measured by Digenome-seq is zero or about zero at 100 nM.

[0203] In some embodiments, the method of assessing on- and off-target sites includes integration of an exogenous double-stranded oligonucleotide (dsODN) tag into the genome. For example, GUIDE-Seq (Tsai et al., 2016; Tsai et al., 2014; Tycko et al., 2016, incorporated by reference in their entireties) describes compositions and methods that allow for quantitative analysis of off-target and on-target gene editing results by integrating a dsODN into an RNA-guided nuclease (RGN)-induced double-strand break (DSB). In some embodiments, the dsODN tag is a 34 bp, blunt-ended, 5' phosphorylated, phosphorothioate-linked polynucleotide incorporated into the double-strand break. The dsODN tag contains a priming site that allows for amplification, sequencing, and discovery of the RNG-induced double-strand break. Non-limiting examples of dsODN tags and primers are listed in Table 9.

[0204] Table 9: Exemplary primer and amplicon sequences for off-target cleavage site analysis

[0205]

[0206] Implementation of genome editing systems: delivery, formulation, and routes of administration

[0207] As discussed above, the genome editing systems of the present disclosure can be implemented in any suitable manner, meaning that the components of such systems, including but not limited to the RNA-guided nuclease, the gRNA, and the optional donor template nucleic acid, can be delivered, formulated, or administered in any suitable form or combination of forms, resulting in transduction, expression, or introduction of the genome editing system in a cell, tissue, or subject and / or causing the desired repair outcome. Genome editing systems according to the present disclosure can incorporate multiple gRNAs, multiple RNA-guided nucleases, as well as other components, such as proteins, and a variety of implementations will be apparent to the skilled artisan based on the principles illustrated in the systems of the present disclosure. In some embodiments, the genome editing systems of the present disclosure are delivered into a cell as ribonucleoprotein (RNP) complexes. In some embodiments, one or more RNP complexes are delivered into a cell sequentially or simultaneously, in any order. Tables 10 and 11 demonstrate several non-limiting examples of genome editing system implementations. But the skilled artisan will appreciate that these lists are not comprehensive, and other implementations are possible. With particular reference to Table 10, this table lists several exemplary implementations of genome editing systems comprising a single gRNA and an optional donor template. However, genome editing systems according to the present disclosure can incorporate multiple gRNAs, multiple RNA-guided nucleases, as well as other components, such as proteins, and a variety of implementations will be apparent to the skilled artisan based on the principles illustrated in this table. In this table, [N / A] indicates that the genome editing system does not include the indicated component.

[0208] Table 10

[0209]

[0210]

[0211] Table 10 summarizes various delivery methods for components of genome editing systems as described herein. Again, the lists are intended to be exemplary and not limiting.

[0212] Table 11

[0213]

[0214] Nucleic acid-based delivery of genome editing systems

[0215] Nucleic acids encoding various elements of the genome editing system according to the present disclosure can be administered to a subject or delivered to a cell by methods known in the art or as described herein. For example, DNA encoding an RNA-guided nuclease and / or DNA encoding a gRNA, as well as a donor template nucleic acid, can be delivered by, e.g., a vector (e.g., a viral or non-viral vector), a non-vector based method (e.g., using naked DNA or DNA complexes), or a combination thereof. In some embodiments, the genome editing system of the present disclosure is delivered by AAV.

[0216] Nucleic acids encoding a genome editing system or components thereof can be delivered directly to a cell as naked DNA or RNA, e.g., by transfection or electroporation, or can be conjugated to a molecule that facilitates uptake by a target cell (e.g., N-acetylgalactosamine) by a target cell (e.g., a red blood cell, an HSC, a T cell). Nucleic acid vectors can also be used, such as the vectors summarized in Table 11. In some embodiments, the genome editing system of the present disclosure is delivered into a cell by electroporation.

[0217] One method of a cell therapy process includes the direct delivery of active proteins into human cells. The protein delivery agent, Feldan Shuttle, is a protein-based delivery agent designed specifically for cell therapy (Del'guidice et al., PLoS One. [Public Library of Science·Comprehensive]. April 4, 2018; 13(4):e0195558; incorporated by reference herein in its entirety). In some embodiments, the genome editing system of the present disclosure is delivered into a cell by the Feldan Shuttle.

[0218] A nucleic acid vector can comprise one or more sequences encoding components of a genome editing system (e.g., an RNA-guided nuclease, a gRNA, and / or a donor template). The vector can also comprise a sequence encoding a signal peptide (e.g., for nuclear localization, nucleolar localization, or mitochondrial localization) in association with (e.g., inserted into or fused to) a sequence encoding a protein. As one example, a nucleic acid vector can include an RNA-guided nuclease (e.g., Cas9 or Cas12a) encoding sequence that includes one or more nuclear localization sequences (e.g., a nuclear localization sequence from SV40).

[0219] A nucleic acid vector can also include any suitable number of regulatory / control elements, such as a promoter, enhancer, intron, polyadenylation signal, Kozak consensus sequence, or internal ribosome entry site (IRES). These elements are well known in the art and are described in Cotta-Ramusino.

[0220] Nucleic acid vectors according to the disclosure include recombinant viral vectors. Exemplary viral vectors are shown in Table 11, and other suitable viral vectors, as well as their use and production, are described in Cotta-Ramusino. Other viral vectors known in the art can also be used. Additionally, viral particles can be used to deliver genome editing system components in the form of nucleic acids and / or peptides. For example, "empty" viral particles can be assembled to contain any suitable payload. Viral vectors and viral particles can also be engineered to incorporate targeting ligands, thereby altering target tissue specificity.

[0221] In addition to viral vectors, non-viral vectors can be used to deliver nucleic acids encoding genome editing systems according to the disclosure. One important class of non-viral nucleic acid vectors is nanoparticles, which can be organic or inorganic. Nanoparticles are well known in the art and are summarized in Cotta-Ramusino. Any suitable nanoparticle design can be used to deliver genome editing system components or nucleic acids encoding such components. For example, in certain embodiments of the disclosure, organic (e.g., lipid and / or polymeric) nanoparticles can be suitable for use as delivery vehicles. Exemplary lipids for use in nanoparticle formulations and / or gene transfer are shown in Table 12, and Table 13 lists exemplary polymers for use in gene transfer and / or nanoparticle formulations.

[0222] Table 12: Lipids for gene transfer

[0223]

[0224]

[0225]

[0226] Table 13: Polymers for gene transfer

[0227]

[0228]

[0229] Non-viral vectors optionally include targeting modifications to improve uptake and / or selectively target certain cell types. These targeting modifications can include, for example, cell-specific antigens, monoclonal antibodies, single-chain antibodies, aptamers, polymers, sugars (e.g., N-acetylgalactosamine (GalNAc)), and cell-penetrating peptides. Such vectors also optionally employ fusogenic and endosome-destabilizing peptides / polymers, undergo acid-triggered conformational changes (e.g., to accelerate endosome escape of the payload), and / or incorporate stimuli-cleavable polymers, e.g., for release in a cellular compartment. For example, disulfide-based cationic polymers that cleave in a reducing cellular environment can be used.

[0230] In certain embodiments, one or more nucleic acid molecules (e.g., DNA molecules) are delivered in addition to components of a genome editing system (e.g., RNA-guided nuclease components and / or gRNA components described herein). In certain embodiments, the nucleic acid molecules are delivered simultaneously with one or more components of a genome editing system. In certain embodiments, the nucleic acid molecules are delivered prior to or after (e.g., less than about 30 minutes, 1 hour, 2 hours, 3 hours, 6 hours, 9 hours, 12 hours, 1 day, 2 days, 3 days, 1 week, 2 weeks, or 4 weeks) delivery of one or more components of a genome editing system. In certain embodiments, the nucleic acid molecules are delivered by a different means than the delivery of one or more components of a genome editing system (e.g., RNA-guided nuclease components and / or gRNA components). The nucleic acid molecules can be delivered by any of the delivery methods described herein. For example, the nucleic acid molecules can be delivered by a viral vector (e.g., an integration-deficient lentivirus), and the RNA-guided nuclease molecule components and / or gRNA components can be delivered by electroporation, e.g., such that toxicity caused by nucleic acids (e.g., DNA) can be reduced. In certain embodiments, the nucleic acid molecules encode a therapeutic protein, e.g., a protein described herein. In certain embodiments, the nucleic acid molecules encode an RNA molecule, e.g., an RNA molecule described herein.

[0231] Delivery of RNP and / or RNA encoding components of genome editing systems

[0232] RNPs (complexes of gRNAs with RNA-guided nucleases) and / or RNAs encoding RNA-guided nucleases and / or gRNAs can be delivered into cells or administered to a subject by methods known in the art, some of which are described in Cotta-Ramusino. In vitro, RNAs encoding RNA-guided nucleases and / or encoding gRNAs can be delivered by, e.g., microinjection, electroporation, transient cell compression or squeezing (see, e.g., Lee 2012). Lipid-mediated transfection, peptide-mediated delivery, GalNAc or other conjugate-mediated delivery, and combinations thereof can also be used for in vitro and in vivo delivery.

[0233] In vitro, delivery via electroporation involves mixing the cells with RNAs encoding RNA-guided nucleases and / or gRNAs (with or without a donor template nucleic acid molecule) in a cassette, chamber, or cuvette, and applying one or more electric pulses of defined duration and amplitude. Systems and protocols for electroporation are known in the art, and any suitable electroporation tool and / or protocol can be used in conjunction with various embodiments of the present disclosure.

[0234] In certain embodiments, a ribonucleoprotein (RNP) complex comprises a guide RNA, a Cas12a protein, including a modified Cas12a protein (AsCas12a variant). Non-limiting examples of Cas12a proteins are listed in SEQ ID NOs: 38-46 and SEQ ID NO: 56. In certain embodiments, an RNP complex can include a guide RNA (gRNA) complexed with a Cas12a protein or a modified Cas12a protein. In certain embodiments, a gRNA can comprise a sequence set forth in SEQ ID NOs: 28-31 or SEQ ID NOs: 32-35. In certain embodiments, an RNP complex can comprise an RNP complex set forth in Table 14. For example, an RNP complex can include a gRNA comprising a sequence set forth in SEQ ID NO: 31 or 35, a modified Cas12a protein set forth in SEQ ID NO: 42 or SEQ ID NO: 56, and target a CD70 gene at a sequence set forth in SEQ ID NO: 27 or SEQ ID NO: 55.

[0235] Table 14: Exemplary ribonucleoprotein (RNP) configurations

[0236]

[0237] Target cells

[0238] Genome editing systems according to the present disclosure can be used to manipulate or alter a target cell, for example to edit or alter a target nucleic acid. In various embodiments, manipulation can be performed in vivo or ex vivo.

[0239] In certain embodiments, a target cell comprises an edit in a target sequence of a CD70 gene. In certain embodiments, a target cell comprises an indel in a target sequence of a CD70 gene. In certain embodiments, a target cell comprises a full or partial deletion of a target sequence of a CD70 gene. In certain embodiments, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 99%, or at least 100% of target cells contacted with a genome editing system comprise an indel in a CD70 gene. An indel can be detected by any method known in the art, for example by Illumina amplicon-based sequencing as described in Example 1 herein.

[0240] In certain embodiments, the percentage of target cells comprising an indel increases in a concentration-dependent manner as the concentration of RNP complex is increased.

[0241] In certain embodiments, the RNP complex induces an indel within or near the target site of the CD70 gene with an EC50 value of less than about 20 nM, less than about 25 nM, less than about 30 nM, less than about 35 nM, less than about 40 nM, less than about 45 nM, less than about 50 nM, less than about 55 nM, less than about 60 nM, less than about 65 nM, less than about 70 nM, less than about 75 nM, less than about 80 nM, less than about 85 nM, less than about 90 nM, less than about 95 nM, less than about 100 nM.

[0242] In certain embodiments, the level of CD70 gene product is reduced in the target cell relative to a cell that has not been contacted with the genome editing system. In certain embodiments, the CD70 gene product is mRNA. In certain embodiments, the CD70 gene product is a protein. In certain embodiments, the CD70 protein is reduced by at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 99%, or at least 100% in the target cell contacted with the genome editing system relative to a cell that has not been contacted with the genome editing system. The amount of CD70 protein can be measured by any method known in the art, for example by FACS as described in Example 1 herein.

[0243] In certain embodiments, the level of CD70 gene product is reduced in a concentration-dependent manner as the concentration of the RNP complex is increased. In certain embodiments, the level of CD70 gene product is reduced relative to the concentration of the RNP complex with an EC50 value of less than about 20 nM, less than about 25 nM, less than about 30 nM, less than about 35 nM, less than about 40 nM, less than about 45 nM, less than about 50 nM, less than about 55 nM, less than about 60 nM, less than about 65 nM, less than about 70 nM, less than about 75 nM, less than about 80 nM, less than about 85 nM, less than about 90 nM, less than about 95 nM, less than about 100 nM.

[0244] In certain embodiments, the target cell is an immunocompetent cell, e.g., a T cell, a CD8+ T cell (e.g., a CD8+ naive T cell, a central memory T cell, or an effector memory T cell), a CD4+ T cell, an alpha / beta T cell, a gamma / delta T cell, a natural killer T cell (NKT cell), a regulatory T cell (Treg), a stem cell memory T cell, a lymphoid progenitor cell, a hematopoietic stem cell, a natural killer cell (NK cell), or a dendritic cell. In certain embodiments, the target cell is an induced pluripotent stem (iPS) cell or a cell derived from an iPS cell (e.g., an iPS cell generated from a subject) that has been manipulated to alter one or more target genes (e.g., to induce a mutation therein) or to manipulate expression of these genes, and differentiated into, e.g., a T cell (e.g., a CD8+ T cell (e.g., a CD8+ naive T cell, a central memory T cell, or an effector memory T cell), a CD4+ T cell, a stem cell memory T cell), a lymphoid progenitor cell, or a hematopoietic stem cell.

[0245] In certain embodiments, the target cell has been altered to contain a particular T cell receptor (TCR) gene (e.g., a TRAC and a TRBC gene). In another embodiment, the TCR has binding specificity for a tumor-associated antigen. In certain embodiments, the TCR is an engineered TCR.

[0246] In certain embodiments, the target cell has been altered to contain a particular chimeric antigen receptor (CAR). In embodiments, the CAR has binding specificity for a tumor-associated antigen.

[0247] In another embodiment, the target cell has been altered to bind a tumor antigen, e.g., by a TCR or CAR.

[0248] In certain embodiments, the target cell comprises a genome edit that results in loss of function of CD70. While not wishing to be bound by any particular theory, CD70 is known to be expressed on a variety of tumor cell types and is a therapeutic target for anti-CD70 CAR-T therapy. CD70 is known to be expressed on activated T cells and unintended fratricide can occur in T cells expressing anti-CD70 based immunotherapy. Thus, it is expected that disabling CD70 in a T cell comprising an anti-CD70 CAR or TCR will provide the T cell comprising the anti-CD70 CAR or TCR with fratricide resistance.

[0249] In some embodiments, the target cell is used to treat a disease, disorder, or condition, e.g., a tumor and / or a cancer.

[0250] Provided herein are methods of administering the cells and compositions described herein, as well as uses of such cells and compositions to treat or prevent diseases, conditions, and disorders, including cancer. In some embodiments, the cells and compositions are administered to a subject or patient having a particular disease or condition to be treated, for example via adoptive cell therapy, such as adoptive T cell therapy. In some embodiments, the cells and compositions prepared by the provided methods (e.g., engineered compositions and production terminal compositions after incubation and / or other processing steps) are administered to a subject, for example a subject having or at risk of a disease or condition, in a therapeutically effective amount. In some aspects, these methods thereby treat (e.g., ameliorate) one or more symptoms of the disease or condition, for example by reducing tumor burden in a cancer expressing an antigen recognized by the engineered T cells.

[0251] In some embodiments, the cell therapy (e.g., adoptive T cell therapy) is performed by autologous transplantation, in which the cells are isolated and / or otherwise prepared from a subject who will receive the cell therapy or from a sample derived from such subject. Thus, in some aspects, the cells are derived from a subject (e.g., a patient) in need of treatment, and after isolation and processing, the cells are administered to the same subject.

[0252] In some embodiments, the cell therapy (e.g., adoptive T cell therapy) is performed by allogeneic transplantation, in which the cells are isolated and / or otherwise prepared from a subject other than the subject (e.g., a first subject) who will receive or ultimately receive the cell therapy. In such embodiments, the cells are then administered to a different subject of the same species, for example a second subject. In some embodiments, the first and second subjects are genetically similar. In some embodiments, the second subject expresses the same HLA class or supertype as the first subject.

[0253] Diseases, conditions, and disorders treated with the provided compositions, cells, methods, and uses are tumors, including solid tumors, hematological malignancies, and melanomas, as well as infectious diseases, such as infections with viruses or other pathogens (e.g., HIV, HCV, HBV, CMV) and parasitic diseases. In some embodiments, the disease or condition is a tumor, cancer, malignancy, neoplasm, or other proliferative disease or disorder. Such diseases include, but are not limited to, leukemia, lymphoma, such as chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), non-Hodgkin’s lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, indolent B-cell lymphoma, B-cell malignancies, colon cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer, and brain cancer, ovarian cancer, epithelial cancer, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin’s lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing’s sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma, and / or mesothelioma.

[0254] The cells can be administered by any suitable means, such as by bolus infusion, by injection, such as intravenous or subcutaneous injection, intraocular injection, periocular injection, subretinal injection, intravitreal injection, transseptal injection, subtenon injection, intrachoroidal injection, intracameral injection, subconjunctival injection, subtenon injection, retrobulbar injection, peribulbar injection, or juxtascleral delivery. In some embodiments, they are administered by parenteral, intrapulmonary, and intranasal administration, and, if local treatment is desired, by intralesional administration. Parenteral infusions include intramuscular, intravenous, intra-arterial, intraperitoneal, or subcutaneous administration. In some embodiments, a given dose is administered by a single bolus of cells. In some embodiments, it is administered by multiple boluses of cells (e.g., within a period of no more than 3 days) or by continuous infusion of cells. Exemplary embodiments

[0255] A1. The presently disclosed subject matter provides a genome editing system comprising: (a) a gRNA molecule comprising a targeting domain that targets a target sequence of a CD70 gene, and (b) an RNA-guided nuclease, or a nucleic acid encoding the RNA-guided nuclease.

[0256] A2. The genome editing system of A1, wherein the target sequence of the CD70 gene is in exon 2 of CD70.

[0257] A3. The genome editing system of A1, wherein (a) the target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 24-27; and / or (b) the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 28-31.

[0258] A4. The genome editing system of A2, wherein (a) the target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 26 and SEQ ID NO: 27; and / or (b) the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 30 and SEQ ID NO: 31.

[0259] A5. The genome editing system of any one of A1-A4, wherein (a) the target sequence of the CD70 gene comprises the nucleotide sequence set forth in SEQ ID NO: 27; and / or (b) the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 31.

[0260] A6. The genome editing system of any one of A1-A5, wherein the RNA-guided nuclease is selected from the group consisting of: Cas9 (e.g., SpCas9, SaCas9, (KKH)SaCas9, eSpCas9, Cas9-HFl, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9), Casl2, Casl2a (also known as Cpf1; e.g., AsCasl2a, LbCasl2a), Casl2b (e.g., AaCasl2b, BhCasl2b, BhCasl2b V4), Casl2cl, Casl2c2, Casl2hl, Casl2il, CasX, CasY, and CasF.

[0261] A7. The genome editing system of any one of A1-A6, wherein the RNA-guided nuclease is a Casl2a protein.

[0262] A8. The genome editing system of any one of A1-A7, wherein the Casl2a protein is a modified Casl2a protein.

[0263] A9. The genome editing system of any one of A1-A8, wherein the modified Casl2a protein is an activity-enhanced Casl2a protein.

[0264] A10. The genome editing system of any one of Al-A9, wherein the RNA- guided nuclease comprises an amino acid sequence selected from the group consisting of SEQ ID NOs: 38-46 and SEQ ID NO: 56.

[0265] A11. The genome editing system of any one of Al-A10, wherein the RNA- guided nuclease comprises an amino acid sequence set forth in SEQ ID NO: 42 or SEQ ID NO: 56.

[0266] A12. The genome editing system of any one of Al-A11, wherein the gRNA molecule further comprises a Casl2a stem loop.

[0267] A13. The genome editing system of any one of Al-A12, wherein the gRNA molecule further comprises a nucleotide extension, wherein the nucleotide extension is a 5' extension, a 3' extension, or a combination thereof.

[0268] A14. The genome editing system of any one of Al-A13, wherein the nucleotide extension comprises one or more RNA bases, one or more DNA bases, or a combination thereof.

[0269] A15. The genome editing system of any one of Al-A14, wherein the gRNA molecule contains one or more modified bases.

[0270] A16. The genome editing system of any one of A13-A15, wherein the nucleotide extension is a 5' extension comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 1-23.

[0271] A17. The genome editing system of any one of Al-A16, wherein the extension is a 5' extension comprising a nucleotide sequence set forth in SEQ ID NO: 7.

[0272] A18. The genome editing system of any one of Al-A17, wherein the gRNA molecule comprises a DNA / RNA oligonucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NOs: 32-35.

[0273] A19. The genome editing system of any one of Al-A18, wherein the gRNA molecule comprises a nucleotide sequence set forth in SEQ ID NO: 68, SEQ ID NO: 97, or SEQ ID NO: 112.

[0274] B1. The presently disclosed subject matter provides a ribonucleoprotein (RNP) complex comprising the genome editing system of any one of A1-A19.

[0275] C1. The presently disclosed subject matter provides a vector for delivering the genome editing system of any one of A1-A19, wherein the vector comprises DNA encoding the gRNA molecule and / or RNA-guided nuclease, RNA encoding the gRNA molecule and / or RNA-guided nuclease, or a combination thereof.

[0276] D1. The presently disclosed subject matter provides a method of editing a CD70 gene in a target cell, the method comprising contacting the target cell with the genome editing system of any one of A1-A19, the RNP complex of B1, or the vector of C1.

[0277] E1. The presently disclosed subject matter provides a cell comprising the genome editing system of any one of A1-A19, the RNP complex of B1, or the vector of C1.

[0278] E2. The cell of E1, wherein the level of CD70 gene product is reduced in the cell relative to a cell lacking the genome editing system of any one of A1-A19, the RNP complex of B1, or the vector of C1.

[0279] E3. The cell of any one of E1-E2, wherein the cell comprises an indel in the target sequence of CD70.

[0280] F1. The presently disclosed subject matter provides a cell comprising one or more genome edits in a CD70 gene, wherein the cell is edited by the method of D1.

[0281] F2. The cell of F1, wherein the one or more genome edits comprise an indel in the target sequence of the CD70 gene.

[0282] F3. The cell of F2, wherein the indel comprises a full or partial deletion of the target sequence of the CD70 gene.

[0283] F4. The cell of F1-F3, wherein the cell is a T cell.

[0284] F5. The cell of F4, wherein the T cell is an alpha / beta T cell.

[0285] F6. The cell of any one of F1-F4, wherein the cell further comprises a chimeric antigen receptor (CAR).

[0286] F7. The cell of F6, wherein the CAR binds a tumor antigen.

[0287] G1. The presently disclosed subject matter provides a composition comprising a population of engineered cells comprising an indel at a target sequence of a CD70 gene, wherein the target sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 24-27 and SEQ ID NO: 55.

[0288] G2. The composition of G1, wherein the level of CD70 gene product in the population of cells is reduced relative to a non-engineered population of cells.

[0289] G3. The composition of G1 or G2, wherein the engineered cell is a T cell.

[0290] G4. The composition of G3, wherein the T cell is an alpha / beta T cell.

[0291] H1. The presently disclosed subject matter provides a method of treating a disease or disorder, the method comprising administering to a subject in need thereof a genome editing system of any one of A1-A19, an RNP of B1, a vector of C1, a cell of any one of E1-E3, a cell of any one of F1-F7, or a composition of any one of G1-G4.

[0292] H2. The method of H1, wherein the disease or disorder is a tumor, a cancer, a malignancy, a neoplasm, or other proliferative disease or disorder.

[0293] H3. The method of H1 or H2, wherein the disease or disorder is selected from the group consisting of leukemia, lymphoma, e.g., chronic lymphocytic leukemia (CLL), acute lymphocytic leukemia (ALL), non-Hodgkin’s lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, indolent B-cell lymphoma, B-cell malignancies, colon cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer, and brain cancer, ovarian cancer, epithelial cancer, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin’s lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing’s sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma, and / or mesothelioma.

[0294] I1. The presently disclosed subject matter provides a gRNA molecule comprising a targeting domain that targets a target sequence of a CD70 gene.

[0295] I2. The gRNA molecule of I1, wherein the target sequence of a CD70 gene is in exon 2 of CD70.

[0296] I3. The gRNA molecule of I1 or I2, wherein (a) the target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-27; and / or (b) the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 28-31.

[0297] I4. The gRNA molecule of I1, wherein (a) the target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 26 or SEQ ID NO: 27; and / or (b) the targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 30 or SEQ ID NO: 31.

[0298] I5. The gRNA molecule of any one of I1-I4, wherein (a) the target sequence of the CD70 gene comprises the nucleotide sequence set forth in SEQ ID NO: 27; and / or (b) the targeting domain comprises the nucleotide sequence set forth in SEQ ID NO: 31. Examples

[0299] The following examples are merely illustrative and are not intended to limit the scope or content of the application in any way.

[0300] Example 1: RNP complexes targeting CD70

[0301] Guide RNAs (gRNAs) targeting the CD70 gene located on chromosome 19 were identified using in-house bioinformatics tools. Briefly, CALITAS (CRISPR-Cas-aware Aligner for Computer- Assisted search of off-Target Sequences; Fennell et al., 2021) was used to identify AsCas12a-compatible T-rich protospacer adjacent motif (PAM) sites within the CD70 gene. This program identified each 21 nucleotide long target sequence and corresponding PAM site and filtered out only those sequences within exons 1-3 of the CD70 transcript (ENST00000245903). Sequences were also selected based on site uniqueness with a single exact match in the genome to exclude sequences with 1 base mismatch and gaps. A list of the identified target sites (N = 4) is listed in Table 4.

[0302] Targeting domains targeting four identified target sequences were synthesized and assembled into a crispr RNA (crRNA) sequence with a 25 nucleotide DNA extension as set forth in [SEQ ID NO: 7] and a 20 nucleotide 5’ stem loop scaffold sequence as set forth in [SEQ ID NO: 36] added 5’ to 3’. Each of the resulting 66 nucleotide DNA and RNA oligos (as set forth in [SEQ ID NO: 32-35]) was then complexed with an AsCas12a protein as set forth in [SEQ ID NO: 42] to generate ribonucleoproteins (RNPs) as set forth in Table 15. The resulting ribonucleoprotein complexes (RNPs) were formulated at 88 µM with a gRNA to AsCas12a ratio of 2:1. RNPs 1, 2, 2, and 4 were serially diluted in an equal mixture of Buffer 1 (10 mM HEPES pH 7.5, 150 mM NaCl) and Buffer 2 (10 mM HEPES pH 7.5, 300 mM NaCl, 20% Glycerol, 10 mM TCEP) and transfected into CD4+ and CD8+ T cells by electroporation (Lonza). Cells were incubated at 37°C and 5% CO2 for 96 hours and genomic DNA was extracted and evaluated by next generation sequencing (NGS) analysis. Genomic DNA was isolated using Agencourt DNAdvance kit (Beckman Coulter, Inc.) and quantified using the fluorescent Quant-IT Pico Green dsDNA Assay kit (ThermoFisher Scientific), each according to the manufacturer’s instructions; and the rate of genomic editing was determined by NGS analysis of PCR amplicons containing the expected cleavage site. Amplicon libraries were prepared for sequencing using a two-step PCR amplification method, PCR primers and amplification sites are shown in Table 8. Figure 1 The relationship of editing to concentration as measured by Illumina amplicon based sequencing is shown. Percent editing was determined using the percent of sequencing reads with indels in the expected cleavage site + / - 15 bases. EC50 values for concentration response were calculated by four parameter logistic curve fitting as shown in Table 15.

[0303] Table 15: CD70 EC50 Results

[0304]

[0305] RNP4 was further evaluated in CD4+ and CD8+ T cells from multiple donors to determine CD70 gene editing efficiency and CD70 protein knockdown (in a concentration-dependent manner). To induce endogenous CD70 expression, CD4+ and CD8+ T cells were stimulated with CD3 / CD28 conjugated magnetic beads and cultured with IL2, IL7, and IL15. Next, cells were electroporated with different concentrations of RNP4 by nucleofection (Lonza) and re-stimulated in medium containing CD3 / CD28 conjugated magnetic beads after 72 hours. Genomic DNA was extracted after 96 hours of incubation and RNP4 concentration-dependent genome editing rates were determined by NGS analysis of PCR amplicons containing the expected cleavage site, as previously described. Editing efficiency (e.g., percentage of sequencing reads with + / - 15 base pairs indels) is shown in the upper panel of Figure 2 RNP4 concentration-dependent CD70 protein knockdown was determined by FACS analysis of CD70 surface staining (lower panel of Figure 2 Table 16 shows the percent editing and EC50 values for protein inhibition. Figure 2 Concentration response curves shown were fitted with a four-parameter logistic regression equation. These results indicate that the editing activity of RNP4 increases in a concentration-dependent manner and that editing results in a decrease in cell surface expression of CD70 protein. Furthermore, this response is consistent in CD4+ and CD8+ T cells from the same donor as well as from three different donors. Thus, RNP4 can edit and knock out the CD70 gene in human cells.

[0306] Table 16: Cell donors and EC50 values and functional analysis of RNP4 editing

[0307] incorporated by reference

[0308] All publications, patents, and patent applications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference. In case of conflict, the present application, including that of any definitions herein, will control. equivalents

[0309] Those of skill in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments described herein. Such equivalents are intended to be encompassed by the following claims.

Claims

1. A genome editing system comprising: (a) A gRNA molecule containing a target domain that targets the CD70 gene, and (b) An RNA-directed nuclease, or a nucleic acid encoding the RNA-directed nuclease.

2. The genome editing system of claim 1, wherein the target sequence of the CD70 gene is in exon 2 of CD70.

3. The genome editing system of claim 1, wherein... (a) The target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-27; and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 28-31.

4. The genome editing system of claim 2, wherein... (a) The target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID: 26 and SEQ ID NO: 27, and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 30 and SEQ ID NO:

31.

5. The genome editing system according to any one of claims 1-4, wherein (a) The target sequence of the CD70 gene comprises the nucleotide sequence shown in SEQ ID NO: 27; and / or (b) The target domain comprises the nucleotide sequence shown in SEQ ID NO:

31.

6. The genome editing system according to any one of claims 1-5, wherein the RNA-guided nuclease is selected from the group consisting of: Cas9 (e.g., SpCas9, SaCas9, (KKH)SaCas9, eSpCas9, Cas9-HF1, HypaCas9, dCas9-Fokl, Sniper-Cas9, xCas9, evoCas9, SpCas9-NG, VRQR, VRER, NmeCas9, CjCas9), Cas12, Cas12a (also known as Cpf1; e.g., AsCas12a, LbCas12a), Cas12b (e.g., AaCas12b, BhCas12b, BhCas12b V4), Cas12cl, Cas12c2, Cas12hl, Cas12il, CasX, CasY and CasΦ.

7. The genome editing system of any one of claims 1-6, wherein the RNA-directed nuclease is the Cas12a protein.

8. The genome editing system according to any one of claims 1-7, wherein the Cas12a protein is a modified Cas12a protein.

9. The genome editing system of any one of claims 1-8, wherein the modified Cas12a protein is an enhanced Cas12a protein.

10. The genome editing system of any one of claims 1-9, wherein the RNA-directed nuclease comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 38-46 and SEQ ID NO:

56.

11. The genome editing system according to any one of claims 1-9, wherein the RNA-directed nuclease comprises the amino acid sequence shown in SEQ ID NO: 42 or SEQ ID NO:

56.

12. The genome editing system of any one of claims 1-11, wherein the gRNA molecule further comprises a Cas12a stem-loop.

13. The genome editing system of any one of claims 1-12, wherein the gRNA molecule further comprises a nucleotide extension, wherein the nucleotide extension is a 5' extension, a 3' extension, or a combination thereof.

14. The genome editing system of claim 13, wherein the nucleotide extension comprises one or more RNA bases, one or more DNA bases, or a combination thereof.

15. The genome editing system of any one of claims 1-14, wherein the gRNA molecule contains one or more modified bases.

16. The genome editing system of any one of claims 13-15, wherein the nucleotide extension is a 5' extension of a nucleotide sequence comprising the group consisting of SEQ ID NO: 1-23.

17. The genome editing system of any one of claims 13-16, wherein the extension is a 5' extension comprising the nucleotide sequence shown in SEQ ID NO:

7.

18. The genome editing system of any one of claims 1-17, wherein the gRNA molecule comprises a DNA / RNA oligonucleotide, the DNA / RNA oligonucleotide comprising a nucleotide sequence selected from the group consisting of SEQ ID NO: 32-35.

19. The genome editing system of any one of claims 1-16, wherein the gRNA molecule comprises the nucleotide sequence shown in SEQ ID NO:

35.

20. A ribonucleoprotein (RNP) complex comprising the genome editing system as described in any one of claims 1-19.

21. A vector for delivering a genome editing system as described in any one of claims 1-19, wherein the vector comprises DNA encoding the gRNA molecule and / or an RNA-directed nuclease, RNA encoding the gRNA molecule and / or an RNA-directed nuclease, or a combination thereof.

22. A method for altering the CD70 gene in a target cell, the method comprising contacting the target cell with a genome editing system as described in any one of claims 1-19, an RNP complex as described in claim 20, or a vector as described in claim 21.

23. A cell comprising the genome editing system of any one of claims 1-19, the RNP complex of claim 20, or the vector of claim 21.

24. The cell of claim 23, wherein, relative to a cell lacking any one of the genome editing systems of claims 1-19, the RNP complex of claim 20, or the vector of claim 21, the level of the CD70 gene product in the cell is reduced.

25. The cell of claim 23 or 24, wherein the cell comprises an insertion or deletion in the target sequence of the CD70 gene.

26. A cell comprising one or more genome edits of the CD70 gene, wherein the cell is edited by the method of claim 22.

27. The cell of claim 25, wherein the one or more genome edits comprise an insertion or deletion in the target sequence of the CD70 gene.

28. The cell of claim 27, wherein the insertion deletion comprises all or part of the target sequence of the CD70 gene.

29. The cell of any one of claims 26-28, wherein the cell is a T cell.

30. The cell of claim 29, wherein the T cell is an α / β T cell.

31. The cell of claim 29 or 30, wherein the cell further comprises a chimeric antigen receptor (CAR).

32. The cell of claim 31, wherein the CAR binds to the tumor antigen.

33. A composition comprising an engineered cell population containing an insertion or deletion at a target sequence of the CD70 gene, wherein the target sequence comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-27 and SEQ ID NO:

55.

34. The composition of claim 33, wherein the level of CD70 gene product in the population is reduced relative to the unengineered cell population.

35. The composition of claim 33 or 34, wherein the engineered cell is a T cell.

36. The composition of claim 35, wherein the T cells are α / β T cells.

37. A method of treating a disease or disorder, the method comprising administering to a subject in need a genome editing system as described in any one of claims 1-19, an RNP as described in claim 20, a vector as described in claim 21, a cell as described in any one of claims 23-25, a cell as described in any one of claims 26-32, or a composition as described in any one of claims 33-36.

38. The method of claim 37, wherein the disease or disorder is a tumor, cancer, malignant tumor, growth or other proliferative disease or disorder.

39. The method of claim 37 or 38, wherein the disease or disorder is selected from the group consisting of: leukemia, lymphoma, such as chronic lymphocytic leukemia (CLL), acute lymphoblastic leukemia (ALL), non-Hodgkin's lymphoma, acute myeloid leukemia, multiple myeloma, refractory follicular lymphoma, mantle cell lymphoma, indolent B-cell lymphoma, B-cell malignancy, colon cancer, lung cancer, liver cancer, breast cancer, prostate cancer, ovarian cancer, skin cancer, melanoma, bone cancer and brain cancer, ovarian cancer, epithelial cancer, renal cell carcinoma, pancreatic adenocarcinoma, Hodgkin's lymphoma, cervical cancer, colorectal cancer, glioblastoma, neuroblastoma, Ewing's sarcoma, medulloblastoma, osteosarcoma, synovial sarcoma and / or mesothelioma.

40. A gRNA molecule comprising a targeting domain that targets a target sequence of the CD70 gene.

41. The gRNA molecule of claim 40, wherein the target sequence of the CD70 gene is in exon 2 of CD70.

42. The gRNA molecule of claim 40, wherein... (a) The target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 24-27; and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 28-31.

43. The gRNA as described in claim 40 or 41, wherein (a) The target sequence of the CD70 gene comprises a nucleotide sequence selected from the group consisting of SEQ ID: 26 and SEQ ID NO: 27, and / or (b) The targeting domain comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 30 and SEQ ID NO:

31.

44. The gRNA according to any one of claims 40-43, wherein (a) The target sequence of the CD70 gene comprises the nucleotide sequence shown in SEQ ID NO: 27; and / or (b) The target domain comprises the nucleotide sequence shown in SEQ ID NO: 31.

Images