A method, primer pair and kit for assisting in breeding chickens with high hydroxymethylfurfural content

By detecting the SNP site rs739034217 in the chicken GADL1 gene and using specific primer pairs and kits for genotyping, the problems of long breeding cycles and low efficiency in chicken flavor breeding were solved, enabling early selection and efficient breeding, and improving chicken quality.

CN121204216BActive Publication Date: 2026-04-28JIANGSU INST OF POULTRY SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JIANGSU INST OF POULTRY SCI
Filing Date
2025-12-01
Publication Date
2026-04-28

AI Technical Summary

Technical Problem

Existing chicken flavor breeding methods are characterized by long cycles, low efficiency, and a lack of effective molecular markers, making it difficult to quickly and accurately select chickens with high octanal content.

Method used

The genotype of the SNP site rs739034217 in the chicken GADL1 gene was detected using specific primer pairs. Specific primer pairs and kits are provided for rapid screening of chickens with high octanal content and early selection through genotyping.

Benefits of technology

It enables early and accurate selection of chicken aroma and flavor traits, significantly shortens the breeding cycle, improves breeding efficiency, reduces costs, and improves chicken quality in a targeted manner.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121204216B_ABST
    Figure CN121204216B_ABST
Patent Text Reader

Abstract

The application discloses a method for assisting in breeding chickens with high octanal content, a primer pair and a kit, and belongs to the technical field of poultry molecular breeding. The molecular marker is an SNP site in a chicken GADL1 gene, the physical position of which is located at chromosome 2:40031463 (SNP ID:rs739034217), and the base mutation is A>G. The different genotypes (GG, AG and AA) of the SNP site are in extremely significant correlation (P<0.01) with the content of octanal, a key aroma substance in chicken meat, and the content of octanal of the individual with the GG genotype is the highest. The application further provides a specific primer pair (SEQ ID NO:1 and 2) for detecting the SNP site and a kit containing the primer. By using the molecular marker, individuals with high flavor quality can be accurately screened in the early stage of chickens through genotyping, so that the breeding efficiency is significantly improved, the breeding cycle is shortened, and directional and efficient genetic improvement of the aroma flavor property of chicken meat is realized.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the fields of molecular genetics and poultry breeding technology, specifically to a method, primer pair, and kit for assisting in the breeding of chickens with high octanal content. Background Technology

[0002] The flavor quality of chicken is one of the important factors influencing consumer choices, and the content of volatile flavor compounds (such as octanal) directly affects the aroma characteristics of the meat. Octal has citrus, fatty, and grassy aromas, which are particularly prominent during roasting or frying, and is an important component of meat flavor.

[0003] Currently, the improvement of chicken flavor mainly relies on traditional breeding methods, using phenotypic selection for genetic improvement. However, this method is time-consuming, inefficient, and highly susceptible to environmental influences. Although some studies have attempted to improve meat quality traits through marker-assisted selection (MAS), molecular markers that are highly effective and significantly correlated with chicken aroma and flavor, especially with octanal content, are still lacking, and their application in practical breeding remains to be developed.

[0004] Therefore, developing molecular markers related to chicken aroma and flavor, and establishing rapid and accurate genotyping methods are of great significance for accelerating the breeding process of high-quality flavored chicken breeds. Summary of the Invention

[0005] (a) Technical problems to be solved

[0006] This invention aims to overcome the shortcomings of existing technologies, such as long breeding cycles, low efficiency, and lack of effective molecular markers in chicken flavor breeding. Specifically, the technical problem this invention aims to solve is to provide a new application, detection method, and dedicated tool for a specific SNP molecular marker (rs739034217) that is significantly correlated with the content of octanal, a key aroma compound in chicken, in order to achieve early, rapid, and accurate selection of chicken aroma and flavor traits, thereby improving breeding efficiency and enhancing chicken quality.

[0007] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0008] This invention provides a method for assisted breeding of chickens with high octanal content, the method comprising the following steps: a) extracting genomic DNA from individual chickens to be tested; b) using the genomic DNA as a template, performing PCR amplification using specific primer pairs, wherein the primer pairs are: forward primer as shown in SEQ ID NO: 1, and reverse primer as shown in SEQ ID NO: 2; c) determining the genotype of the SNP site rs739034217 in the PCR amplification product, wherein the SNP site is located on chicken chromosome 2:40031463; d) selecting individuals with the genotype GG for breeding.

[0009] The present invention further provides a specific primer pair for implementing the above method, which can specifically amplify the DNA fragment containing the SNP site rs739034217 in the chicken GADL1 gene, and its nucleotide sequence is as follows: forward primer: 5'-TCCTTTACCCATGAGGCTGC-3' (SEQ ID NO: 1); reverse primer: 5'-TTCCAGTGTAAGGGGAGGGA-3' (SEQ ID NO: 2).

[0010] Furthermore, this invention provides a kit incorporating the aforementioned method for detecting the SNP site rs739034217 in the chicken GADL1 gene, which is associated with octanal content. The kit may also include PCR reaction buffer, Taq DNA polymerase, dNTPs, and a positive control sample containing known genotypes (GG, AG, AA) to ensure the accuracy and reliability of the detection results.

[0011] This invention provides the use of the SNP site rs739034217 in the preparation of a kit for detecting molecular markers related to octanal content in the chicken GADL1 gene. This kit is used to assist in the breeding of chicken breeds with high chicken flavor and aroma. The SNP site is located on chicken chromosome 2:40031463, and its base mutation is A>G.

[0012] (III) Beneficial Effects

[0013] Compared with the prior art, the technical solution provided by the present invention has the following significant advantages:

[0014] High correlation and accuracy: This invention confirms a highly significant association between different genotypes (AA, AG, GG) at the stated SNP loci and the octanal content in chicken meat (P = 5.74E-08). Individuals with the GG genotype showed the highest octanal content (5.32 ± 0.54), significantly higher than other genotypes. This provides a solid and reliable genetic basis for marker-assisted selection.

[0015] Early selection improves breeding efficiency: Using the primers, kits, and methods provided in this invention, genotyping can be performed in the early growth and development stages of chickens, accurately screening individuals with high aroma and flavor potential. This avoids the lag of relying on post-slaughter phenotyping in traditional breeding, shortening the breeding cycle from several years to several days, significantly improving breeding efficiency and reducing feeding costs.

[0016] Simple to operate and highly applicable: The specific primer pairs provided by this invention have high amplification efficiency and strong specificity, and are suitable for routine PCR amplification and subsequent sequencing or genotyping techniques. The corresponding detection kits are easy to standardize and promote, and can be widely used in molecular breeding practices in breeder farms and breeding companies.

[0017] Targeted improvement of chicken quality: By continuously selecting individuals carrying the GG genotype through the method provided by this invention, the octanal content of the entire flock can be rapidly and targetedly increased, thereby stably improving the aroma and flavor quality of chicken meat and cultivating new varieties (strains) with unique flavor advantages. Attached Figure Description

[0018] Figure 1 Manhattan plot to show molecular markers related to octanal content.

[0019] Figure 2 A molecular marker QQ plot was created to illustrate the association between SNP sites and octanal content. Detailed Implementation

[0020] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be noted that the specific embodiments described herein are for illustrative purposes only and are not intended to limit the invention.

[0021] The present invention aims to provide an SNP molecular marker that is significantly associated with octanaldehyde content in chicken meat. It is located in the GADL1 gene, and its different genotypes (AA, AG, GG) are significantly associated with octanaldehyde content, especially the GG genotype, which corresponds to a higher octanaldehyde content.

[0022] Based on this discovery, the present invention also provides a specific primer pair for detecting the SNP site, a kit containing the primer, and a method for molecular-assisted breeding of chickens using the molecular marker, thereby rapidly breeding chicken breeds with excellent aroma and flavor.

[0023] Octaldehyde has citrus, fatty, and grassy aromas and is an important component of the characteristic flavor of meats (such as beef, pork, and poultry), especially during roasting or frying.

[0024] Primers:

[0025] Forward primer: TCCTTTACCCATGAGGCTGC (SEQ ID NO: 1);

[0026] Reverse primer: TTCCAGTGTAAGGGGAGGGA (SEQ ID NO: 2)

[0027] The nucleotide sequence of the SNP site PCR product is shown below (SEQ ID NO: 3):

[0028] ATTTTCTTCATGGTAGCTACTATGGTACTATATTTTGGATTTGTGATGAAAAACATTGCT

[0029] GAGAAGTCAGTTATGATTTAGTTACTGCTGACCAGTGCTCATACAGCATCAAGGTCTTTT

[0030] CTGTTTTGTCACACCGCCCTGCTTGTGAGCAGGCTGCGGGTGCACAAAGCCTTGGGAAGGG

[0031] ACACAGCCAGGAGAGCTGACCCCAGCTGACCAGAGGGATATTTCACACCATGTGATGCCT

[0032] TGCTCAGCAATACAAGCTGGATGAAAGGAGGAGGGAGCAGGAGGGGGATGTTTGGAGTTACGGCATTTGTCTTCCCAAGTAACTGTTATGCATGAAGAAGCCCTGCTTTTCCTGGAAACA

[0033] GCCAAACATCTGCCTGCTGATAGGGAGTAGTGAATGAATTCTTTATTTTGCTTTTGCTTGC

[0034] ACATGCAGCTTTTCCTTTACCCATGAGGCTGCCTTCACTTAAAACCACAAATGTTTGCAG

[0035] GTTTACCCTCTCAATTCTCCCTCCCCTTACACTGGAAGGAATGAGTGAGTGCCTGTGTGG

[0036] GGCTTCTCTGCATACCAGGATTAAACCATCACAGCCTTTTTTTGGCACCTAATGTGGGGC

[0037] T

[0038] Example 1: Detection of SNP molecular markers.

[0039] 1. Sample collection and genomic DNA extraction

[0040] Select healthy commercial broiler chickens with consistent rearing conditions and collect blood or feather follicle tissue samples. Extract genomic DNA from the chickens using the standard phenol-chloroform method or a commercially available genomic DNA extraction kit (such as the DP304 kit from TIANGEN). Detect the concentration and purity of the extracted DNA using a Nanodrop micro-spectrophotometer and dilute the DNA to a working concentration (e.g., 50 ng / μL) for later use.

[0041] In this embodiment, 247 individuals were randomly selected from a large flock of white-feathered broilers, and blood was collected from their wing veins for genomic DNA extraction. Genomic DNA was extracted using the conventional phenol-chloroform method, and after the concentration and purity were detected by Nanodrop, it was uniformly diluted to 50 ng / μL and stored at -20℃ for later use.

[0042] 2. PCR amplification and sequencing typing

[0043] Using the genomic DNA extracted in step 1 as a template, PCR amplification was performed using the specific primer pair provided by this invention to obtain a DNA fragment containing the target SNP site (rs739034217).

[0044] In the embodiments, the extracted DNA was used as a template and PCR amplification was performed using the specific primer pair (sequences shown in SEQ ID NO: 1 and 2) provided by the present invention to obtain a DNA fragment containing the target SNP site (rs739034217, physical location shown in Table 1).

[0045] Table 1 provides detailed information on the SNP molecular markers that are significantly related to octanal content in chicken meat, as described in this invention.

[0046] ;

[0047] Primer sequences:

[0048] Forward primer: 5'-TCCTTTACCCATGAGGCTGC-3'

[0049] Reverse primer: 5'-TTCCAGTGTAAGGGGAGGGA-3'

[0050] PCR reaction system (25 μL): 12.5 μL of 2× PCR Master Mix, 1.0 μL each of forward and reverse primers (10 μM), 1.0 μL of template DNA, and ddH2O to make up to 25 μL.

[0051]

[0052] PCR reaction procedure:

[0053] Pre-denaturation: 95 ℃, 5 min;

[0054] Cyclic reaction (35 cycles): 95 °C denaturation for 30 s, 60 °C annealing for 30 s, 72 °C extension for 30 s;

[0055] Final extension: 72 ℃, 5 min.

[0056] Primer Design and Validation: The specific primer pairs were designed using Primer Premier 5.0 software, with the chicken reference genome (GRCg6a) GADL1 gene sequence (accession number: NC_052538.1) as a template. The Tm values ​​of the forward and reverse primers were 59.8℃ and 58.5℃, respectively, with GC contents of 55% and 60%, respectively, and the amplified fragment length was 198 bp. Validation using the NCBI Primer-BLAST online tool confirmed that the primer pairs exhibited good specificity. Validation using temperature gradient PCR (55-65℃) determined the optimal annealing temperature to be 60℃.

[0057] 3. Genotyping

[0058] Take 5 μL of PCR amplification product and detect it by 1.5% agarose gel electrophoresis to confirm the amplification of a specific band of approximately 200 bp (see the sequence list in the instruction manual for sequence length). Send the successfully confirmed PCR product to a professional institution such as Sangon Biotech (Shanghai) Co., Ltd. for purification and direct sequencing. Analyze the sequencing peaks using software such as DNASTAR Lasergene or Chromas to determine the base type at chromosome 2:40031463 for each individual and the genotype (AA, AG, or GG) at the rs739034217 locus for each individual. Examples of genotyping results are shown in the three columns on the left of Table 2.

[0059] Table 2 shows the association analysis results between different genotypes (AA, AG, GG) and octanal content:

[0060] ;

[0061] The genotyping results are shown in the three columns on the left of Table 2. In this example, among the 247 individuals, the genotype distribution was: 153 AA type, 84 AG type, and 10 GG type. The minimum allele frequency (G allele) for this locus was 0.211. Detailed information about this SNP locus, including its physical location (2:40031463), ID (rs739034217), associated gene (GADL1), allele type, and association p-value, is summarized in Table 1. This genotyping successfully obtained effective data containing the target SNP locus, laying the foundation for subsequent phenotypic association analysis.

[0062] Example 2: Application of molecular marker-assisted selection breeding.

[0063] 1. Establish a breeding population: Select a large white-feathered broiler chicken base as the breeding population.

[0064] 2. Genotyping testing

[0065] Using a broiler breeding population (n=247) as the subject, the genotyping of the SNP locus rs739034217 was performed on all individuals in the breeding population according to the method described in Example 1.

[0066] 3. Breeding decisions are made based on genotyping results:

[0067] Individuals with the genotype GG were identified as having excellent aroma and flavor, and were selected as core parent candidates for priority retention and inclusion in the core breeding population.

[0068] Individuals with the AG genotype can be used as a reserve population for propagation and to avoid inbreeding.

[0069] Individuals with genotype AA are either eliminated from the core breeding population or treated as commercial offspring.

[0070] In this example, based on the genotype-phenotype association analysis results shown in Table 2, the octanal content of individuals with the GG genotype was significantly higher than that of individuals with the AG and AA genotypes (P<0.01). Therefore, the following breeding program was developed:

[0071] Core breeding population: Individuals with the GG genotype are preferred (expected to have the highest octanal content, see...) Figure 1 (and Table 2) are used as parents for breeding the next generation.

[0072] Common breeding population: Individuals with the AG genotype are selected for breeding to maintain the genetic diversity of the population.

[0073] Elimination group: Individuals with the AA genotype are eliminated from the core breeding group. According to this plan, 15 individuals with the GG genotype are selected to form the core breeding group.

[0074] 4. Effect verification: Ten GG-type individuals and ten AA-type individuals were randomly selected and raised to 42 days of age before slaughter. The breast meat samples were taken and the octaldehyde content was determined by HS-SPME / GC-MS.

[0075] One-way ANOVA was performed using SPSS 22.0 software, and Duncan's method was used for multiple comparisons. Different lowercase letters indicate highly significant differences (P < 0.01).

[0076] Results: The octanal content detection results clearly demonstrated the differences in content among different genotypes. The mean octanal content of the GG genotype group (5.32 ± 0.54 μg / kg) was significantly higher than that of the AG genotype group (4.00 ± 0.13 μg / kg) and the AA genotype group (3.48 ± 0.08 μg / kg). Complete association analysis data are summarized in Table 2, including the number of individuals for each genotype, octanal content (mean ± standard error), and significance markers (P < 0.01). This result is consistent with... Figure 2 The trend of association between SNP loci and traits shown (horizontal axis represents expected value, vertical axis represents observed value) fully confirms that the GG genotype of SNP locus rs739034217 is significantly positively correlated with high octanal content (P=5.74E-08, see Table 1). This indicates that using the molecular markers of this invention for assisted selection can efficiently and accurately breed superior individuals with high octanal content, a flavor compound in chicken.

[0077] 5.4. Verification of the effects of multi-generational selective breeding

[0078] To verify the long-term stability and effectiveness of auxiliary selection based on the SNP locus rs739034217, the core breeding population consisting of 15 individuals with the GG genotype was bred to obtain the F1 generation.

[0079] One hundred individuals were randomly selected from the F1 generation population, and genotyping was performed according to the method described in Example 1. The octanal content in the breast meat of 42-day-old individuals was also measured. Meanwhile, the original basal population (n=100) from the same source that had not been screened for SNP sites served as the control group.

[0080] The results showed changes in genotype distribution: the frequency of the GG genotype significantly increased to 22.0% (22 / 100) in the F1 generation, while the frequency of the GG genotype in the control group was only 2.0% (2 / 100). This indicates that selection of the core parent effectively enriched the dominant allele G.

[0081] Phenotypic gain: The mean octanal content of the F1 generation population was (4.21 ± 0.15) μg / kg, which was significantly higher than (P<0.01) the mean octanal content of the control group (3.52 ± 0.09) μg / kg.

[0082] Stability: In the F1 generation, the octanal content of individuals with the GG genotype was still significantly higher than that of individuals with the AG and AA genotypes, replicating the trend of the parental generation, which proves the stability of the association between this molecular marker and the trait.

[0083] The results clearly demonstrate that using the molecular markers provided by this invention for assisted selection can not only screen out superior individuals within a generation, but also achieve directional and cumulative genetic improvement of chicken flock flavor traits through the enrichment of dominant alleles, significantly shortening the breeding cycle.

[0084] The above examples fully illustrate the application value and feasibility of the molecular markers, primers, and methods provided by this invention in chicken quality breeding. This invention is the first to discover a significant association between the rs739034217 site in the GADL1 gene and the octanal content in chicken meat, and provides a complete detection and application scheme, which is of great significance for improving the efficiency of chicken flavor breeding.

[0085] The above description is merely a specific embodiment of the present invention, but the scope of protection of the present invention is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in the present invention should be included within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the scope of the claims.

Claims

1. A method for assisting in the breeding of chickens with high octaldehyde content, characterized in that, Includes the following steps: a) Extract genomic DNA from the individual chickens to be tested and perform detection using a kit; The kit contains at least one of the following components: PCR reaction buffer, Taq DNA polymerase, dNTPs, and positive control sample; The positive control sample is genomic DNA or plasmid DNA containing a known GG, AG or AA genotype; b) Using the genomic DNA as a template, perform PCR amplification; c) Determine the genotype of the SNP site rs739034217 in the PCR amplification product, wherein the SNP site is located on chicken chromosome 2:40031463; d) Select individuals with the genotype GG for breeding.