Antibodies binding to a plurality

By developing multispecific antibodies and antigen-binding fragments, the problem of the difficulty in effectively preventing or treating various sabezier virus infections in existing technologies has been solved. This has achieved broad-spectrum binding and neutralization capabilities against various sabezier viruses, enhancing the therapeutic and preventive effects.

CN121241064APending Publication Date: 2025-12-30VIR BIOTECHNOLOGY INC
View PDF 29 Cites 0 Cited by

Patent Information

Application Number
CN202480028834.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-02-23
Filing Date
2024-04-10
Publication Date
2025-12-30

AI Technical Summary

Technical Problem

Existing antibodies and diagnostic reagents are insufficient to effectively prevent or treat infections with various sabeviruses (such as SARS-CoV and SARS-CoV-2), especially in the face of constantly mutating viral strains.

Method used

Develop multispecific antibodies and antigen-binding fragments that can bind to a variety of sabeviruses (including SARS-CoV and SARS-CoV-2 from different clades) and demonstrate neutralizing effects in vitro and in animal models, providing an administration method that combines antibody-drug conjugates (ADCs) with small molecules.

Benefits of technology

It achieves broad-spectrum binding and neutralization capabilities against multiple sabeviruses, enhances the therapeutic and preventative effects against variant virus strains, and provides a variety of combined antibody and antigen-binding fragment treatment regimens.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121241064A_ABST
    Figure CN121241064A_ABST
Patent Text Reader

Abstract

The present disclosure provides antibodies and antigen-binding fragments thereof that can bind to the S protein of Sabebe viruses (in some embodiments, including a plurality of Sabebe viruses) and, in certain embodiments, are capable of neutralizing infection by a plurality of Sabebe viruses.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Reference to the electronic sequence list The contents of the electronic sequence list (450WO_SeqListing.xml; size: 312,781 bytes; and creation date: April 8, 2024) are incorporated herein by reference in their entirety. Background Technology

[0002] Sarbecoviruses are classified into four clades: 1a, 1b, 2, and 3. SARS-CoV is a member of clade 1a, while SARS-CoV-2 is a member of clade 1b. Therapies for the prevention or treatment of sarbecovirus infection and diagnostic reagents for its diagnosis are needed. Attached Figure Description

[0003] Figure 1 The phylogenetic tree of sabevirus is shown, divided into clade 1a (also known as clade 1, which includes the SARS-CoV lineage), clade 1b (also known as clade 1 / 2, which includes the SARS-CoV-2 lineage), clade 2 (also known as BatSE Asia), and clade 3 (also known as Bat non-Asian). GenBank or NCBI accession numbers are indicated.

[0004] Figure 2 Examples of SARS-CoV-2 RBD antigen binding sites for comparative antibodies S2H97 (site V), S309 (sotrovimab, site IV), S2X324 (site I / IIa), S2K146 (site Ia), and S2X259 (site IIa) are shown.

[0005] Figure 3 The results of ELISA binding of S2V29-v1.1 with various sabeviruses representing different viral clades are shown.

[0006] Figure 4 The neutralization of the SARS-CoV-2 variant lineage by S2V29-v1.1 is shown.

[0007] Figure 5 The neutralizing activities of S2V29-v1.1 and comparative antibodies S2K146, S2X259, S2X259v50, sotopevir (which has the same RBD binding site as S309), S2X324, S3L17, S3I2 and S3O13 against the SARS-CoV-2 Omicron variant lineage are shown.

[0008] Figure 6AThe inhibition of ACE2 and SARS-CoV-2 (clade 1b) RBD by S2V29-v1.1 and comparative antibody binding is shown.

[0009] Figure 6B The inhibition of ACE2 and SARS-CoV (clade 1a) RBD by S2V29-v1.1 and comparative antibody binding was demonstrated.

[0010] Figure 7A The results of the evolutionary width binding assay for the comparative antibody S2V29-v1.2 are shown.

[0011] Figure 7B The results of the evolutionary width binding test for S2V29-v37.2 are shown.

[0012] Figure 8 The possible SARS-CoV-2 RBD epitopes of S2V29-v1.1 and the comparative antibody S3L17 are shown, as well as the binding of the two antibodies to the SARS-CoV-2 RBD.

[0013] Figure 9 The binding of S2V29-v1.2 and S2V29-v37.2 is shown compared to the binding of ACE2 to the SARS-CoV-2 BQ.1.1 variant lineage RBD, and key RBD ACE-2 contact residues are highlighted; the resolution is 1.67 Å.

[0014] Figure 10 SARS-CoV-2 neutralization data for S2V29 variant antibodies are shown, including S2V29-v37.2, the comparative antibody S2V29-v1.2, and other S2V29 comparative variant antibodies with VL.2, as indicated by the labels above each figure.

[0015] Figure 11 shows further SARS-CoV-2 and SARS-CoV-V neutralization data for the S2V29 variant antibodies, including S2V29-v37.2, the comparative antibody S2V29-v1.2, and other comparative variant antibodies containing VL.2. Neutralization data include IC50 (… Figure 11A ), such as the multiple change (FC) compared to S2V29-v1.2 ( Figure 11B ), and the neutralized FC of the SARS-CoV-2 BQ.1.1 variant lineage and the SARS-CoV-2 BQ.1.1-F456L variant lineage ( Figure 11C ). Figure 11C The legend shown also applies to Figure 11A and Figure 11B .

[0016] Figure 12Neutralization data for S2V29 variant antibodies were summarized, including S2V29-v37.2 and comparative antibody S2V29-v1.2 against specific SARS-CoV-2 BQ.1.1 variant lineage mutations.

[0017] Figure 13 It shows Figure 12 The data is summarized in the figure. The specific SARS-CoV-2 BQ1.1 variant lineage is identified at the top of each figure.

[0018] Figure 14 Additional SARS-CoV-2 variant lineages for S2V29-v37.2 are shown (as shown at the top of each figure) and SARS-CoV neutralization data are presented.

[0019] Figure 15 The effect of changes at amino acid 50 and amino acid 57 of VH in S2V29-v1.2 on SARS-CoV-2 RBD binding is shown.

[0020] Figure 16 The results show the neutralization of S2V29-v.37.2 and the neutralization of the comparative antibody S2V29-v1.2 for partial escape variant lineages of SARS-CoV (SARS1) and SARS-CoV-2 (SARS2) as determined by pseudovirus assay.

[0021] Figure 17 The results show the neutralization of multiple SARS-CoV-2 variant lineages as determined by pseudovirus assays, including S2V29-v37.2 and the comparative antibodies REGEN-COV (casirivimab / imdevimab, marketed by Regeneron, NY, US) and EVUSHIELD (AZD7442, tixagevimab / cilgavimab, Astra Zeneca, Cambridge, UK).

[0022] Figure 18 The results show a comparison between pseudovirus neutralization assays and real virus neutralization assays for various SARS-CoV-2 variant lineages of S2V29-v37.2 and the comparative antibody S2V29-v1.2.

[0023] Figure 19 summarizes the results of S2V29-v37.2 and the comparative antibody S2V29-v1.2 as determined by surface plasmon resonance (SPR) with clades 1a, 1b, 2, and 3 representing the SARS-CoV-2 BQ.1.1 variant lineage. Figure 19A) and RBD escape mutation ( Figure 19B The binding affinity results of various sabeviruses.

[0024] Figure 20 Pharmacokinetic data for S2V29-v37.2 and the comparative antibody S2V29-v1.2 in Tg32 mice are shown. Time refers to the number of days after injection.

[0025] Figure 21A The results of pseudovirus neutralization assays mediated by S2V29-v37.2 in the SARS-CoV-2 variant lineage are shown.

[0026] Figure 21B The neutralization of the lineage of live SARS-CoV-2 variants mediated by S2V29-v37.2 is shown. The wild-type virus isolates have the same S haplotype as Wuhan-Hu-1.

[0027] Figure 22 The binding affinity of S2V29-v37.2 Fab, measured by SPR, is shown. Shaded bars represent clades of the SARS-CoV-2 variant. Specifically, the SARS-CoV-2 variant lineages Wuhan-Hu-1, BA.1, BA.2, BA.2.75.2, BA.5, BQ.1.1, XBB.1.5, CH.1.1, EG.5, HK.3, BA.2.68, and JN.1 are all clade 1b SARS-CoV-2 variant lineages; SARS-CoV-1 and WIV-1 are both clade 1a lineages (SARS-CoV-1 RBD is the Urbani strain); BM48-31, BtKY72, and Khosta-2 are all clade 3 lineages; and Anlong-112, SC2018, Shaanxi2011, and YN2013 are all clade 2 lineages.

[0028] Figure 23 The pseudovirus neutralization of S2V29-v37.2, the comparative antibody S2V29-v1.2, and other comparative antibodies is summarized in the figure, shaded by the sabevirus clade. SVB represents sotopirumab (Vir, San Francisco, CA). SA55 represents the antibody developed by Sinovac, Beijing, CN. Omi-42 refers to the antibody developed by Oxford University (Oxford, UK). Data points within the gray shaded bar at the top of the figure indicate IC50 > 10,000 ng / ml.

[0029] Figure 24The results of pseudovirus neutralization assays of S2V29-v37.2 and the comparative antibody S2V29-v1.2 against Wuhan-Hu-1 and SARS-CoV-1 (SARS-CoV-1, clade 1a) are shown.

[0030] Figure 25 The results of biofilm layer interferometry (BLI) show the competitive binding of the S2V29-v37.2 Fab fragment or the comparative antibody Fab fragment (both of which bind to the SARS-CoV-2 RBD) to the monomeric ACE2 against the Wuhan-Hu-1 RBD.

[0031] Figure 26 Results of the S2V29-v37.2 assay using S1 shedding assays performed on the surface of Expi-CHO cells with either the Wuhan-Hu-1 or SARS-CoV-2 XBB.1.5 variant lineage S1 protein transiently expressed on the surface of Expi-CHO cells. The control antibody S2M28 is an anti-SARS-CoV-2 S protein N-terminal domain (NTD) control mAb.

[0032] Figure 27 The activation of human FcγRIIa by the indicated antibody is shown. Target cells were CHO cells stably expressing the Wuhan-Hu-1 SARS-CoV-2 S protein. Effector cells were Jurkat cells expressing the indicated FcγR and engineered with an NFAT-mediated luciferase reporter gene to reflect human FcγR activation. Data points are shown as replicates, mean ± SD. Results for the S2M28 anti-NTD control antibody and the anti-SARS-CoV-2 RBD comparative antibody VIR-8000 (VIR) are also presented.

[0033] Figure 28 Results from a human FcγRIIIa(D) activation assay using the indicated antibody are presented. Target cells were CHO cells stably expressing the SARS-CoV-2 spike protein. Effector cells were Jurkat cells expressing the indicated FcγR and engineered with an NFAT-mediated luciferase reporter gene to reflect human FcγR activation. Data points are shown as replicates, mean ± SD. Results for the S2M28 anti-NTD control antibody and the anti-SARS-CoV-2 RBD antibody VIR-8000 (VIR) are also presented.

[0034] Figure 29 shows the results of an NK cell-mediated antibody-dependent cytotoxicity (ADCC) study using the indicated donor antibody and donor cells expressing the following FcγRIIIa- genotype: heterozygous (F / V158); Figure 29A High affinity for homozygous (V / V158); Figure 29BThe results of the S2M28 anti-NTD control antibody and the anti-SARS-CoV-2 RBD antibody VIR-8000 (VIR) were also presented.

[0035] Figure 30 The S2V29-v37.2-mediated pseudovirus neutralization of the SARS-CoV-2 XBB.1.5 variant lineage with the indicated RBD epitope mutation is shown. Mutations with a frequency >0.005% in the Global Initiative on Sharing All Influenza Data (GISAID) database up to June 2023 were tested.

[0036] Figure 31 Results of successive passages of the SARS-CoV-2 Wuhan-Hu-1 and XBB.1.5 variant lineages rVSV in the presence of S2V29-v.37.2 and comparative antibodies SA55 and Omi-42 are presented. Variant lineages and S protein mutations, alone or in addition to F456, were also tested, and were observed to have deep mutational scan (DMS) binding escape mutations. Each experiment was performed in two independent replicates.

[0037] Figure 32 The pseudovirus neutralization of the S2V29-v37.2-mediated SARS-CoV-2 variant lineages is shown, which also have S protein mutations indicated on the x-axis. ND indicates undetermined.

[0038] Figure 33 The pseudovirus neutralization of the S2V29-v37.2-mediated SARS-CoV-2 variant lineage is shown, which also carry S protein mutations indicated on the x-axis.

[0039] Figure 34 The study demonstrates S2V29-v37.2-mediated pseudovirus neutralization of SARS-CoV-2 variant lineages BQ.1.1 or XBB.1.5 carrying the indicated S protein mutation. As of June 2023, these mutations had a frequency of less than 0.005% in the GISAID database, but could be obtained through a single nucleotide change in the wild-type sequence.

[0040] Figure 35Results indicating the effect of the SARS-CoV-2 RBD position 455 mutation on S2V29-v37.2Fab fragment binding affinity (top) and S2V29-v37.2-mediated pseudovirus neutralization (bottom) as measured by SPR are shown. The S protein, including the F456L or L455S mutations, is also indicated by bars. EG.5+L455F also carries the non-RBD Q52H S mutation (i.e., the HK3 strain haplotype).

[0041] Figure 36 Results indicating the effect of the SARS-CoV-2 RBD position 455 mutation on ACE2 affinity, as measured by SPR, are shown. The S protein, including the F456L or L455S mutations, is also indicated by bars. EG.5+L455F also carries the non-RBD Q52H S mutation (i.e., the HK3 strain haplotype).

[0042] Figure 37 The results of a cell-cell fusion assay between VeroE6 / TMPRSS2 cells, which were normalized to SARS-CoV-2 S expression lineages of XBB.1.5 and EG.5 variants, and cells expressing SARS-CoV-2 S are shown. Detailed Implementation

[0043] This document provides antibody and antigen-binding fragments capable of binding to sabeviruses (e.g., SARS-CoV-2). In some embodiments, the antibody and antigen-binding fragments are capable of binding to multiple sabeviruses (e.g., binding to surface glycoproteins of one or more (e.g., one, two, three, four, five, six or more) different sabeviruses as described herein, which optionally are contained on the virion and / or expressed on the surface of cells infected with two or more sabeviruses). In some embodiments, the multiple sabeviruses comprise one or more clade 1b sabeviruses. In some embodiments, the multiple sabeviruses comprise one or more clade 1a sabeviruses. In some embodiments, the multiple sabeviruses comprise one or more clade 1a viruses and one or more clade 1b viruses. In yet other embodiments, the multiple sabeviruses comprise one or more sabeviruses from each of clades 1a, 1b, 2, and 3. The antibody-antigen-binding fragments can be monospecific or multispecific, such as bispecific. In some embodiments, the currently disclosed antibody and antigen-binding fragments can neutralize infection with one or more sabevirins (e.g., one, two, three, four, or more sabevirins) in in vitro infection models and / or animal models and / or human subjects. In the case of multispecific antibody or antigen-binding fragments, in some embodiments, a single first antigen-binding domain formed by a single VH / VL combination among multiple antigen-binding domains in the multispecific antibody or antigen-binding fragment can exhibit binding to and / or neutralization of one or more viruses representing these different evolutionary branches. Other antigen-binding domains can bind to viruses, viral lineages, or epitopes that are the same as the first antigen-binding domain, or bind to viruses, viral lineages, or epitopes that are different from the first antigen-binding domain. Combinations of two or more different antibody or antigen-binding fragments, for example, for virus neutralization, treatment, and / or prevention, are also provided. In addition, antibody-pharmaceutical conjugates (ADCs) comprising the antibody or antigen-binding fragments of this disclosure are provided, as well as conjugated small molecules in some embodiments, or administration of the antibody or antigen-binding fragments of this disclosure together with small molecules.

[0044] Also provided are polynucleotides, vectors, DNA therapeutics, RNA therapeutics, and host cells capable of generating antibodies or antigen-binding fragments of this disclosure, as well as related compositions.

[0045] This disclosure further provides methods for treating (e.g., reducing, delaying, eliminating, or preventing) two or more sabezier virus infections in a subject using antibodies, antigen-binding fragments, polynucleotides, vectors, DNA therapeutics, RNA therapeutics, host cells, and related compositions, and / or methods for using them in the manufacture of medicaments for treating one or more sabezier virus infections (e.g., one, two, three, four, or more sabezier viruses) in a subject. This disclosure also provides antibodies, antigen-binding fragments, polynucleotides, vectors, DNA therapeutics, RNA therapeutics, host cells, and related compositions for treating (e.g., reducing, delaying, eliminating, or preventing) two or more sabezier virus infections in a subject, and / or in the manufacture of medicaments for treating one or more sabezier virus infections (e.g., one, two, three, four, or more sabezier viruses) in a subject.

[0046] Before elaborating on this disclosure in more detail, it may be helpful to understand the definitions of certain terms used herein. Additional definitions are set forth throughout this disclosure.

[0047] In this specification, any concentration range, percentage range, ratio range, or integer range shall be understood to include any integer value within the stated range, and, where appropriate, its fraction (such as one-tenth and one-hundredth of an integer), unless otherwise specified. Additionally, any quantity range stated herein relating to any physical characteristic such as polymer subunits, size, or thickness shall be understood to include any integer within the stated range, unless otherwise specified. As used herein, the term “about” means ±20% of the indicated range, value, or structure, unless otherwise specified. It should be understood that the terms “an” and “a” as used herein refer to “one or more” of the listed components; however, the condition is that “amino acid sequence” or “peptide sequence” should not be construed as referring only to a portion of the sequence (e.g., one or two amino acids or a polypeptide). The use of alternatives (e.g., “or”) shall be understood to mean one, two, or any combination of the alternatives. As used herein, the terms “comprising,” “having,” and “including” are used synonymously, and these terms and variations thereof are intended to be construed as non-limiting.

[0048] "Optional" or "optionally" means that the element, component, event, or situation described below may or may not occur, and the description includes both cases in which the element, component, event, or situation occurs and cases in which the element, component, event, or situation does not occur.

[0049] Furthermore, it should be understood that this application discloses individual constructs or groups of constructs derived from various combinations of the structures and subunits described herein, with the same degree of disclosure as each construct or group of constructs is individually described. Therefore, the choice of a particular structure or a particular subunit is within the scope of this disclosure.

[0050] The term “substantially constitutes” is not equivalent to “comprising” and refers to the material or step specified in the claim, or to a material or step that does not substantially affect the essential characteristics of the claimed subject matter. For example, when the amino acid sequence of a domain, region, module, or protein includes extensions, deletions, mutations, or combinations thereof (e.g., amino acids at the amino or carboxyl terminus or between domains), the protein domain, region, or module (e.g., a binding domain) or protein is “substantially constitutes” a specific amino acid sequence in which these extensions, deletions, mutations, or combinations thereof collectively constitute at most 20% (e.g., at most 15%, 10%, 8%, 6%, 5%, 4%, 3%, 2%, or 1%) of the length of the domain, region, module, or protein and substantially does not affect (i.e., does not reduce activity by more than 50%, such as no more than 40%, 30%, 25%, 20%, 15%, 10%, 5%, or 1%) the activity of the domain, region, module, or protein (e.g., the target-binding affinity of the binding protein).

[0051] As used herein, an "anti-sabevirus antibody or antigen-binding fragment" specifically binds to one or more sabeviruses, and in some embodiments, may bind to two or more, three or more, four or more, or five or more sabeviruses. These sabeviruses may originate from the same or different clades. In some embodiments, variant lineages of a particular sabevirus are not considered distinct sabeviruses (e.g., SARS-CoV-2 BA.5 may not be a different virus from SARS-CoV-2XBB.1).

[0052] As used in this article, “sabevirus” refers to any β-coronavirus within lineage B, including lineage B viruses in clades 1a, 1b, 2 and 3.

[0053] Examples of clade 1a sabeviruses are SARS-CoV and Bat SARS-like coronavirus WIV1 (WIV1).

[0054] Examples of clade 1b sabeviruses are SARS-CoV-2, RatG13, Pangolin-Guanxi-2017 (PANG / GX), and Pangolin-Guangdon-2019 (PANG / GD).

[0055] Examples of clade 1b also include SARS-CoV-2 variant lineages, such as variant lineages with any of the following mutations: A67V, Δ69-70, T95I, G142D, 137-145de, 143-145de, Y145H, N211I, Δ212, V213G, ins214TDR, ins215EPE, A222V, G339D, R346K, R346S, V 367F, S371L, S373P, S375F, T376A, P384L, N394S, D405N, R408S, Q414K, K417N, K417V, K417T, N439K, N440K, G446S, Y449H, Y449N, L452R, L452Q, L452X (where X is any amino acid), Y453F, S477N, T478K V483A, E484A, E484Q, E484K, E484X (where X is any amino acid), F490R, F486V, F490S, R493Q, Q493R, S494P, G496S, Q498R, N501Y, N501T, Y505H, E516Q, T547K, Q613H, D614G, A653V, H655Y, G669S, Q67 7H, N679K, ins679GIAL, P681H, P681R, A701V, N764K, D796Y, N856K, Q954H, N969K, L981F, or variants in the B.1.1.7 and Q lineages and their descendant lineages (α); B.1.351 and their descendant lineages (β); B.1.429 and B.1.427 and their descendant lineages (ε); P.1 and their descendant lineages (γ); B.1.1.222; C.37; B.1.617.2; AY.1, AY.2, other AY lineages and descendant lineages (δ); B.1.525 and descendant lineages (η); B.1.526 and descendant lineages (ι); B.1.617.1 and descendant lineages (κ); 1.617.3; B.1.621 and B.1.621.1 and descendant lineages (μ); P.2 (ζ); and B.1.1.529.1, BA.1, B A.2, BA.2.12, BA.2.75.2, BA.2.86, BA.3, BA.4, BA.5 and their descendant lineages (ο); and BQ.1.1, XBB.1, XBB.1.5, CH.1.1, XBB.2.3, EG.5, EG.5.1, XBB.1.16.1, XBB.1.16.6, FL.1.5.1, HK.3, HV.1, JD.1.1 and JN.1 and their descendant lineages.

[0056] Examples of clade 2 sabeviruses are Bat ZC45 (ZC45), Bat ZXC21 (ZXC21), YN2013, RmYN02, Anlong112, SC2018, and SX2011.

[0057] Examples of clade 3 sabeviruses are BtkY72 and BGR2008.

[0058] As of June 2023, the sabecovirus clade also... Figure 1 As illustrated in the example, as the sabevirus continues to evolve, it can be identified... Figure 1 The further clades or members of the clades indicated in the text.

[0059] In some implementations, the antibody or antigen-binding fragment is capable of binding to sabeviruses of clade 1b, such as SARS-CoV-2 (including all variant lineages described herein), RatG13, Pangolin-Guanxi-2017 (PANG / GX), Pangolin-Guangdon-209, or any combination thereof. Such an antibody or antigen-binding fragment may be referred to as “anti-clade 1b” or “anti-sabevirus clade 1b”.

[0060] In some further embodiments, the antibody or antigen-binding fragment can bind to SARS-CoV-2 variant lineages; examples, such as clade 1b, also include SARS-CoV-2 variant lineages, such as variant lineages having any of the following mutations: A67V, Δ69-70, T95I, G142D, 137-145de, 143-145de, Y145H, N211I, Δ212, V213G, ins214TDR, ins215EPE, A222V, G339D, R346K, R346S, V367F, S371L, S373P, S375F, T376A, P384L, N394. S, D405N, R408S, Q414K, K417N, K417V, K417T, N439K, N440K, G446S, Y449H, Y449N, L452R, L452Q, L452X (where X is any amino acid other than L), Y453F, S477N, T478K, V483A, E484A, E484Q, E484K, E484X (where X is any amino acid other than E), F490R, F486V, F490S, R493Q, Q493R, S494P, G496S, Q498R, N501Y, N501T, Y505H, E516Q, T547K, Q613H D614G, A653V, H655Y, G669S, Q677H, N679K, ins679GIAL, P681H, P681R, A701V, N764K, D796Y, N856K, Q954H, N969K, L981F, D614, E340A, or variants in the B.1.1.7 and Q lineages and their descendant lineages (α); B.1.351 and their descendant lineages (β); B.1.429 and B.1.427 and their descendant lineages (ε); P.1 and their descendant lineages (γ); B.1.1.222; C.37; B.1.617.2; AY.1, AY.2, other AY lineages and their descendant lineages (δ); B.1.525 and their descendant lineages (δ). Lineage (η); B.1.526 and descendant lineage (ι); B.1.617.1 and descendant lineage (κ); 1.617.3; B.1.621 and B.1.621.1 and descendant lineage (μ); P.2 (ζ); and B.1.1.529.1, BA.1, BA.2, BA.2.12, BA.2.75.2, BA.2.86, BA.3, BA.4, BA.5 and descendant lineage (ο); and BQ.1.1, XBB.1, XBB.1.5, CH.1.1, XBB.2.3, EG.5, EG.5.1, XBB.1.16.1, XBB.1.16.6, FL.1.5.1, HK.3, HV.1, JD.1.1 and JN.1, as well as their progeny lineages, or any combination thereof. Such antibodies or antigen-binding fragments may be referred to as "anti-SARS-CoV-2". Such antibodies may also be referred to as "anti-[SARS-CoV-2 lineage]", or, if applicable, "anti-[SARS-CoV-2 lineage] variant".

[0061] Generally, any antibody or antigen-binding fragment disclosed herein may be referred to as “anti” to a viral type, clade, specific virus, or lineage or variant lineage, any of which may carry the specified mutation to which the antibody or antigen-binding fragment binds. Thus, a single antibody or antigen-binding fragment may be referred to as “anti” to several other terms. For example, S2V29 antibodies or their antigen-binding fragments may be appropriately referred to as "anti-sabevirus," "anti-clade 1," "anti-clade 1 / 2," "anti-clade 1 and 1 / 2," "anti-sabevirus clade 1," "anti-sabevirus clade 1 / 2," "anti-sabevirus clade 1 and 1 / 2," "anti-SARS-CoV," "anti-SARS-CoV-1," "anti-SARS-CoV-2," "anti-SARS-CoV and SARS-CoV-2," "anti-BQ.1.1," "anti-BQ.1.1 variant," "anti-BQ.1.1 and BQ.1.1 variant," "anti-SARS-CoV-2 BQ.1.1," "anti-SARS-CoV-2 BQ.1.1 variant," and "anti-SARS-CoV-2 BQ.1.1 and BQ.1.1 variant." The foregoing list is for illustrative purposes only, and S2V29 and its antigen-binding fragments may also be appropriately referred to as "anti-" many other viruses, lineages, etc., to which they bind.

[0062] As used herein, “S2V29” includes any VH and VL variants disclosed herein, each of which may be referred to as an “S2V29 antibody”. S2V29 variant antibodies are labeled with a combination of VH and VL. For example, an S2V29 antibody having VH.22 and VL.2 is designated S2V29-v22.2. The S2V29-v.1.1 specifically discussed herein has VH.1 and VL.1 (also known as VL11a). The S2V29-v1.2 specifically discussed herein has VH.1 and VL.2. The S2V29-v37.2 specifically discussed herein has VH.37 and VL.2. The S2V29-v37.2 variant antibody specifically discussed herein has variations of VH.37 and / or VL.2. In some embodiments, the antibody is an S2V29 antibody (or an antigen-binding fragment derived from an S2V29 antibody), or the antibody or antigen-binding fragment contains (e.g., six) CDRs and optionally one or more frame regions or all or part of the VH and VL of an S2V29 antibody, particularly S2V29-v37.2 or a variant antibody or its antigen-binding fragment. In some embodiments, the antibody or fragment contains sufficient CDR, VH, and / or VL identity with the S2V29 antibody disclosed herein, particularly S2V39-v37.2, to confer specific binding to the same sabevirus as the S2V29 antibody and to inhibit the binding interaction between human ACE2 and the receptor-binding domain (RBD) of sabevirus (e.g., SARS-CoV-2), with an IC50 of about 0.5 ng / mL to about 100 ng / mL, about 1 ng / mL to about 100 ng / mL, about 2.0 ng / mL to about 100 ng / mL, and about 2.5 ng / mL to about 100 ng / mL. 0.0 ng / mL, about 5.0 ng / mL to about 100 ng / mL, about 7.5 ng / mL to about 100 ng / mL, about 8.0 ng / mL to about 100 ng / mL, about 9.0 ng / mL to about 100 ng / mL, about 10.0 ng / mL to about 100 ng / mL, about 12.5 ng / mL to about 100 ng / mL, about 15.0 ng / mL to about 100 ng / mL, about 17.5 ng / mL to about 100 ng / mL, about 20 ng / mL to about 100 ng / mL, about 25.0 ng / mL to about 100 ng / mL, about 27.5 ng / mL to about 100 ng / mL, about 30 ng / mL to about 100 ng / mL, about 0.5 ng / mL to about 50 ng / mL, about 1 ng / mL to about 50 ng / mL, about 2.0 ng / mL to about 50 ng / mL, about 2.5 ng / mL to about 50 ng / mL, about 5.0 ng / mL to about 50 ng / mL, about 7.5 ng / mL to about 50 ng / mL, about 8.0 ng / mL to about 50 ng / mL, about 9.0 ng / mL to about 50 ng / mL, about 10.0 ng / mL to about 50 ng / mL, about 12.5 ng / mL to about 50 ng / mL g / mL, about 15.0 ng / mL to about 50 ng / mL, about 17.5 ng / mL to about 50 ng / mL, about 20 ng / mL to about 50 ng / mL, about 25.0 ng / mL to about 50 ng / mL, about 27.5 ng / mL to 50 ng / mL, or between about 30 ng / mL and about 50 ng / mL, about 0.5 ng / mL, about 0.9 ng / mL, about 1.0 ng / mL, about 1.25 ng / mL, about 1.5 ng / mL, about 1.75 ng / mL, about 2.0 ng / mL, about 2.25 ng / mL, about 2.5 ng / mL, about 3.0 ng / mL, approximately 4.0 ng / mL, approximately 5.0 ng / mL, approximately 7.5 ng / mL, approximately 8.0 ng / mL, approximately 9.0 ng / mL, approximately 10.0 ng / mL, approximately 12.5 ng / mL, approximately 15.0 ng / mL, approximately 17.5 ng / mL, approximately 20.0 ng / mL, approximately 22.5 ng / mL, approximately 25.0 ng / mL, approximately 27.5 ng / mL, or approximately 30 ng / mL, or at least approximately 30 ng / mL to approximately 50 ng / mL, approximately 0.5 ng / mL, approximately 0.9 ng / mL, approximately 1.0 ng / mL, approximately 1.25 ng / mL The concentrations are within the range of approximately 1.5 ng / mL, 1.75 ng / mL, 2.0 ng / mL, 2.25 ng / mL, 2.5 ng / mL, 3.0 ng / mL, 4.0 ng / mL, 5.0 ng / mL, 7.5 ng / mL, 8.0 ng / mL, 9.0 ng / mL, 10.0 ng / mL, 12.5 ng / mL, 15.0 ng / mL, 17.5 ng / mL, 20.0 ng / mL, 22.5 ng / mL, 25.0 ng / mL, 27.5 ng / mL, or 30 ng / mL.

[0063] In a particular embodiment, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof antibody or antigen-binding fragment, or comprises a CDR of an S2V29-v37.2 or a variant thereof antibody and optionally one or more frame regions or all or part of VH and VL, the antibody or antigen-binding fragment is capable of inhibiting the binding interaction between human ACE2 and the receptor-binding domain (RBD) of sabevirus (e.g., SARS-CoV-2), with an IC50 of about 10. 0 ng / ml to 10 3 ng / ml, approximately 1 × 10 1 ng / ml to 2 × 10 2 ng / ml or approximately 1 × 10 1 ng / ml to 10 2 Within the range of ng / ml.

[0064] In some implementations, S2V29 antibodies, particularly S2V29-v37.2 or variant antibodies or antigen-binding fragments thereof, are capable of binding to two or more (e.g., two, three, four, etc.) sabeviruses, such as sabeviruses from different clades or subclades, or both SARS-CoV and SARS-CoV-2, wherein the IC50 of each virus is within the range shown above.

[0065] As used in this article, “SARS-CoV-2,” originally also referred to as “novel CoV,” “nCoV,” or “2019 nCoV,” or its variant lineage, is a B-lineage beta coronavirus (sabevirus). SARS CoV-2 infection can lead to a disease called COVID-19; symptoms of COVID-19 include fever or chills, dry cough, difficulty breathing, fatigue, body aches, headache, new loss of taste or smell, sore throat, congestion or runny nose, nausea or vomiting, diarrhea, persistent chest tightness or chest pain, new confusion, inability to wake up or remain awake, and cyanosis of the lips or face.

[0066] The genome sequence of the SARS-CoV-2 isolate Wuhan-Hu-1 is provided in GenBank MN908947.3, January 23, 2020, and the amino acid translation of the genome is provided in GenBank QHD43416.1, January 23, 2020. These GenBank sequences and GenBank sequences of all SARS-CoV-2 variant lineages are incorporated herein by reference as descriptions of the specific binding of the sabevirus or SARS-CoV-2 to antibody or antigen-binding fragments according to this disclosure.

[0067] Genome sequences of variant lineages and other sabezi viruses (such as SARS-CoV) and their variant lineages are also available in GenBank and other publicly available sources, and should be referenced to their presence as of April 10, 2023. The S protein and RBD of these other sabezi viruses have also been identified in GenBank.

[0068] Like other sabeviruses, particularly coronaviruses such as SARS-CoV, SARS-CoV-2 contains a surface (“S”) type I transmembrane glycoprotein (also known as the “surface glycoprotein,” “S protein,” “spike,” or “spike protein”) containing a receptor-binding domain (RBD). The RBD is thought to mediate the entry of clade 1b SARS coronavirus into respiratory epithelial cells by binding to the cell surface receptor angiotensin-converting enzyme 2 (ACE2). Specifically, the receptor-binding motif (RBM) in the viral RBD is believed to interact with ACE2. Other sabeviruses possess an S protein containing an RBD, which further contains an RBM that interacts with a target protein required for sabevirus infection of mammalian cells.

[0069] The amino acid sequence of the Wuhan-Hu-1 surface glycoprotein is provided in SEQ ID NO:1. The amino acid sequence of the Wuhan-Hu-1 RBD is provided in SEQ ID NO:2. The Wuhan-Hu-1 S protein shares approximately 73% amino acid sequence identity with SARS-CoV. The amino acid sequence of the Wuhan-Hu-1 RBM is provided in SEQ ID NO:3.

[0070] Many emerging SARS-CoV-2 variant lineages have emerged, which may differ in their genome and amino acid sequences, particularly in surface glycoproteins or RBDs. Variant lineages are also referred to as different strains or lineages, or as those with mutations compared to a reference variant or strain. Some SARS-CoV-2 variant lineages possess mutations that increase affinity for the ACE receptor and / or viral infectivity.Significant variant lineages of SARS-CoV-2 include, for example, variants with any of the following mutations: A67V, Δ69-70, T95I, G142D, 137-145de, 143-145de, Y145H, N211I, Δ212, V213G, ins214TDR, ins215EPE, A222V, G339D, R346K, R346S, V367F, S371L, S 373P, S375F, T376A, P384L, N394S, D405N, R408S, Q414K, K417N, K417V, K417T, N439K, N440K, G446S, Y449H, Y449N, L452R, L452Q, L452X (where X is any amino acid other than L), Y453F, S477N, T478K, V483A, E48 4A, E484Q, E484K, E484X (where X is any amino acid other than E), F490R, F486V, F490S, R493Q, Q493R, S494P, G496S, Q498R, N501Y, N501T, Y505H, E516Q, T547K, Q613H, D614G, A653V, H655Y, G669S, Q677H, N679K Variants in the lineages B.1.1.7 and Q, and their descendant lineages (α); B.1.351 and their descendant lineages (β); B.1.429 and B.1.427 and their descendant lineages (ε); P.1 and their descendant lineages (γ); B.1.1.222; C.37; B.1.617.2; AY.1, AY.2, other AY lineages and descendant lineages (δ); B.1.525 and descendant lineages (η); B.1.526 and descendant lineages (ι); B.1.617.1 and descendant lineages (κ); 1.617.3; B.1.621 and B.1.621.1 and descendant lineages (μ); P.2 (ζ); B.1.1.529.1, BA.1, BA.2, B A.2.12, BA.2.75.2, BA.2.86, BA.3, BA.4, BA.5 and their descendant lineages (ο); and BQ.1.1, XBB.1, XBB.1.5, CH.1.1, XBB.2.3, EG.5, EG.5.1, XBB.1.16.1, XBB.1.16.6, FL.1.5.1, HK.3, HV.1, JD.1.1 and JN.1 and their descendant lineages, or any combination thereof.The SARS-CoV-2 variant lineage circulating in the United States has been classified as variants of concern by the U.S. Centers for Disease Control and Prevention (see cdc.gov / coronavirus / 2019-ncov / variants / variant-info).

[0071] In some embodiments, antibodies or antigen-binding fragments for treating sabevirus infection are provided. In some embodiments, sabevirus infection includes SARS-CoV-2 infection. Treatment of SARS-CoV-2 infection according to this disclosure includes treatment of infection with any or more of the aforementioned SARS-CoV-2 viruses. In some embodiments, treatment of SARS-CoV-2 infection includes treatment of infection with any or more of SARS-CoV-2 Wuhan-Hu-1, the variant lineages identified above, or other variant lineages identified herein (optionally having additional mutations identified herein). Treatment may further include treatment of infection with novel variant lineages and mutations.

[0072] As used herein, “amino acid” refers to naturally occurring or synthetic amino acids, as well as amino acid analogs and amino acid mimics that function in a manner similar to that of naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those that have been modified, such as hydroxyproline, γ-carboxyglutamic acid, and O-phosphoserine. Amino acid analogs are compounds having the same basic chemical structure as naturally occurring amino acids (i.e., the α-carbon bound to hydrogen, carboxyl, amino, and R groups), such as homoserine, ortholeucine, methionine sulfoxide, and methionine methylsulfonium. These analogs have modified R groups (e.g., ortholeucine) or modified peptide backbones, but retain the same basic chemical structure as naturally occurring amino acids. Amino acid mimics are chemical compounds having a structure different from the general chemical formula of amino acids, but functioning in a manner similar to that of naturally occurring amino acids.

[0073] As used in this article, "mutation" refers to a change in the sequence of a nucleic acid or polypeptide molecule compared to a reference or wild-type nucleic acid or polypeptide molecule. Mutations can cause several different types of sequence changes, including substitutions, insertions, or deletions of nucleotides or amino acids.

[0074] "Conservative substitution" refers to amino acid substitutions that do not significantly affect or alter the binding properties of a specific protein. Generally speaking, a conservative substitution is a substitution in which the substituted amino acid residue is replaced with an amino acid residue with a similar side chain. Conservative substitutions include substitutions found in one of the following groups: Group 1: alanine (Ala or A), glycine (Gly or G), serine (Ser or S), threonine (Thr or T); Group 2: aspartic acid (Asp or D), glutamic acid (Glu or Z); Group 3: asparagine (Asn or N), glutamine (Gln or Q); Group 4: arginine (Arg or R), lysine (Lys or K), histidine (His or H); Group 5: isoleucine (Ile or I), leucine (Leu or L), methionine (Met or M), valine (Val or V); and Group 6: phenylalanine (Phe or F), tyrosine (Tyr or Y), tryptophan (Trp or W). Additionally or alternatively, amino acids may be grouped into conserved substitution groups based on similar function, chemical structure, or composition (e.g., acidic, basic, aliphatic, aromatic, or sulfur-containing). For example, aliphatic groupings may include Gly, Ala, Val, Leu, and Ile for substitution purposes. Other conserved substitution groups include: sulfur-containing: Met and cysteine ​​(Cys or C); acidic: Asp, Glu, Asn, and Gln; small aliphatic, nonpolar, or slightly polar residues: Ala, Ser, Thr, Pro, and Gly; polar, negatively charged residues and their amides: Asp, Asn, Glu, and Gln; polar, positively charged residues: His, Arg, and Lys; large aliphatic, nonpolar residues: Met, Leu, Ile, Val, and Cys; and large aromatic residues: Phe, Tyr, and Trp. Additional information can be found in Creighton (1984) Proteins, WHFreeman and Company.

[0075] As used herein, "protein" or "peptide" refers to a polymer of amino acid residues. The term "protein" encompasses naturally occurring amino acid polymers, as well as amino acid polymers in which one or more amino acid residues are artificial chemical mimics of corresponding naturally occurring amino acids, and non-naturally occurring amino acid polymers. Variants of the proteins, peptides, and polypeptides of this disclosure are also contemplated. In some embodiments, the variant proteins, peptides, and polypeptides comprise or consist of at least 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.9% of an amino acid sequence as defined or referenced herein.

[0076] Any polypeptide disclosed herein (e.g., VH, VL, Fab, Fd, antibody heavy chain, antibody light chain) may contain a “signal peptide” (also referred to as a leader sequence, leader peptide, or transport peptide), if encoded by a polynucleotide sequence. The signal peptide targets the newly synthesized polypeptide to its appropriate location inside or outside the cell. The signal peptide may be removed, wholly or partially, from the polypeptide during or after localization or secretion is complete. A polypeptide having (e.g., full-length) a signal peptide may be referred to as a “preprotein,” and a polypeptide whose signal peptide has been removed (at least a portion) may be referred to as a “mature” protein or polypeptide. In some embodiments, the antibody or antigen-binding fragment is a mature protein or a preprotein.

[0077] In some embodiments, the antibody or antigen-binding fragment may include a signal peptide that causes the antibody or antigen-binding fragment to be secreted from a host cell. This disclosure contemplates the addition of the signal peptide to any protein having the sequence specifically set forth herein, or any variation thereof having the same amount as set forth herein.

[0078] A “nucleic acid molecule,” or “polynucleotide,” or “polynucleic acid” refers to a polymeric compound containing covalently linked nucleotides, which may consist of native subunits (e.g., purine or pyrimidine bases) or non-native subunits (e.g., a morpholine ring). Purine bases include adenine, guanine, hypoxanthine, and xanthine, and pyrimidine bases include uracil, thymine, and cytosine. Nucleic acid molecules include: polyribonucleic acid (RNA), including mRNA, microRNA, siRNA, self-assembled RNA, self-amplified RNA (saRNA), trans-amplified RNA (taRNA), viral genomic RNA, circular RNA (circRNA), and synthetic RNA; and polydeoxyribonucleic acid (DNA), including cDNA, genomic DNA, and synthetic DNA, any of which may be single-stranded or double-stranded. If single-stranded, the nucleic acid molecule may be a coding strand or a non-coding (antisense) strand. Nucleic acid molecules encoding amino acid sequences include all nucleotide sequences encoding the same amino acid sequence. Some types of nucleotide sequences may also contain introns, to such an extent that the introns will be removed through co-transcription or post-transcriptional mechanisms. In other words, different nucleotide sequences can encode the same amino acid sequence due to redundancy or degeneracy of the genetic code, or through splicing.

[0079] Variants of the nucleic acid molecules disclosed herein are also considered. The variant nucleic acid molecules are at least 70%, 75%, 80%, 85%, 90%, preferably 95%, 96%, 97%, 98%, 99%, or 99.9% identical to the nucleic acid molecules of the polynucleotides defined or referenced herein, or hybridize with the polynucleotides under stringent hybridization conditions of 0.015 M sodium chloride, 0.0015 M sodium citrate at about 65 to 68 °C, or 0.015 M sodium chloride, 0.0015 M sodium citrate, and 50% formamide at about 42 °C. The nucleic acid molecule variants retain the ability to encode their binding domains, which have the functions described herein, such as binding target molecules.

[0080] “mRNA” refers to any form of messenger RNA that has a protein-coding region capable of being translated in a host cell to produce the encoded protein, particularly an antibody or antigen-binding fragment.

[0081] In some embodiments, each distinct mRNA may encode only one protein molecule, such as a heavy chain (HC), a fragment containing a heavy chain variable domain (VH), a fragment containing CDRH1-H3, or a light chain (LC), a fragment containing a light chain variable domain (VL), or a fragment containing CDRL1-L3. In such embodiments, an RNA therapeutic agent containing such mRNA may comprise at least two distinct mRNAs, one encoding HC or its VH-containing fragment, and the other encoding LC or its VL-containing fragment, such that when the mRNA is expressed in a cell, the resulting VH and VL domains can combine to form an antigen-binding domain.

[0082] In other embodiments, an antibody or antigen-binding fragment, or multiple protein subunits comprising at least a VH protein and a VL protein, may be encoded in a single mRNA. In some such embodiments, VH and VL may be expressed as separate proteins due to regulatory or self-cleaving elements positioned between the sequences of VH or VL, such as signal peptides, spacers, and protein regulatory sequences, such as internal ribosome entry site (IRES) sequences. In some embodiments, the order in which VH and VL and / or other expressed proteins appear in the mRNA may be optimized. Specifically, in some embodiments, RNA therapeutics containing saRNA or circRNA may be optimized in this manner by placing the VH coding sequence at the 5' of the VL coding sequence.

[0083] In some implementations, the antibody or antigen-binding fragment may include a signal peptide that causes the antibody or antigen-binding fragment to be secreted from the host cell that expresses it.

[0084] The mRNAs disclosed herein, particularly circRNA, taRNA, or saRNA, may further contain one or more modified nucleosides. In certain embodiments, the modified nucleosides can stabilize and reduce in vitro mRNA degradation, such as during the production, storage, or after reconstruction and prior to administration of the mRNA, a vector containing or composed of mRNA, an mRNA therapeutic construct, or a composition containing the aforementioned substances. In certain embodiments, the modified nucleosides can stabilize and reduce in vivo mRNA degradation after administration of the mRNA, a vector or construct containing mRNA, an mRNA therapeutic construct, or a composition containing the aforementioned substances, such as in skin, muscle, blood, interstitial fluid, other extracellular environments, or intracellular environments. In certain embodiments, the modified nucleosides can reduce or prevent cellular immune responses to mRNA. In certain embodiments, the modified nucleosides can enhance the amplification of mRNA within host cells (particularly in the case of taRNA or saRNA) and / or the expression of proteins or peptides encoded by the mRNA. The modified nucleosides may include pseudouridines, such as N... 1 -Methylpseudouridine, 5-methylcytidine, 2-thiouridine, N6-methyladenosine. Nucleoside modifications applicable to RNA are further described in Zhang et al., Front. Immunol., DOI: 10.3389 / fimmu.2019.00594 (2019); Eyler et al., PNAS 116(46): 23068-23071; DOI: 10.1073 / pnas.1821754116 (2019); Nance and Meier, ACS Cent. Sci. 2021, 7, 5, 748–756; doi. org / 10.1021 / acscentsci.1c00197 (2021), and van Hoecke and Roose, J. Translational Med 17:54 (2019); doi. org / 10.1186 / The modified nucleosides and mRNA characteristics of s12967-019-1804-8 are incorporated herein by reference. mRNA may include more than two or more types of modified nucleosides.

[0085] In some embodiments, methylation of naturally occurring (unmodified) nucleotides may be used alone or in combination with modified nucleotides to achieve any of the aforementioned effects achievable with modified nucleotides. In some embodiments, the proportion of nucleotides with methylation of a specific base or located in a specific sequence may be used to achieve such effects. For example, methylation may be used to reduce the recognition of mRNA (or DNA in the case of DNA therapeutics) as foreign material in mammalian host cells. The types of RNA methylation and their effects are further described in Yujia Z., et al., “Principles of RNAmethylation and their implications for biology and medicine,” Biomedicine & Pharmacotherapy (131) 110731 (2020), which is incorporated herein by reference in its entirety.

[0086] In some embodiments, mRNA, particularly aRNA or taRNA, may include a cap or cap analogue, more specifically, a 7-methylguanosine moiety linked to a terminal nucleotide via a phosphate group, particularly a triphosphate group. The inclusion of a cap or cap analogue may help prevent exonuclease cleavage of the mRNA (particularly saRNA or taRNA) and / or initiate the translation of the mRNA (particularly saRNA or taRNA) within mammalian host cells. In specific embodiments, the cap or cap analogue may initiate the translation of a replicating protein or peptide. circRNA may lack a suitable location for a cap or cap analogue because a normally unbound 5' end is absent. However, linear mRNA may contain a cap or cap analogue prior to circulation to form circRNA, for example, to increase the stability and / or amplification of the linear mRNA before circulation.

[0087] In some embodiments, the mRNA may include one or more untranslated region (UTR) sequences that regulate the expression of the encoded protein or peptide. In some embodiments, the UTR may be endogenous to the host cell. In some embodiments, the UTR may be exogenous to the host cell or may be artificially designed. In some embodiments, the mRNA may contain two UTRs, a 5' of a nucleic acid sequence encoding a protein or peptide and a 3' of a nucleic acid sequence encoding a protein or peptide. For mRNA encoding more than one protein or peptide, the UTR may be the 5' and 3' of sequences encoding one or more, typically each protein or peptide, or the 5' and 3' of sequences encoding at least two proteins or peptides, all proteins or peptides that function together once expressed (e.g., sequences containing VH and VL), or all proteins and peptides encoded by the mRNA.

[0088] In some embodiments, the mRNA, particularly saRNA or taRNA, may include a polyA tail or a sequence in which a polyA tail is generated in mRNA produced within mammalian host cells by saRNA or taRNA (e.g., via reverse transcription). In some embodiments, prior to the initial translation of the polyA-tailed mRNA, particularly saRNA or taRNA, especially the taRNA sequence encoding the amplified protein, the length of the polyA tail may be at least or about 250, 200, 100, 50, 20, or 10 nucleotides, or within the range of 10 to 250, 10 to 200, 10 to 100, 10 to 50, 10 to 20, 20 to 250, 20 to 200, 20 to 100, 20 to 50, 50 to 250, 50 to 200, 50 to 100, 100 to 250, 100 to 200, or 200 to 250 nucleotides. The length of the polyA tail can vary to affect the lifespan of mRNA in the host cell, with a longer polyA tail resulting in a longer lifespan and often also leading to more expression of the mRNA before degradation. circRNAs may lack a suitable location for a polyA tail due to the absence of unbound ends. However, linear mRNAs may contain a polyA tail before circularization to form circRNAs, for example, to increase the stability and / or amplification of the linear mRNA before circularization.

[0089] In some embodiments, the mRNA, including circRNA, taRNA, or saRNA, can be produced within a host cell, which is a host cell. In other embodiments, the mRNA, including circRNA, taRNA, or saRNA, can be produced in a cell-free system, such as a system using a DNA template and enzymes.

[0090] A "circular RNA" ("circRNA") is a single-stranded mRNA that forms a covalently closed continuous circular loop. In some embodiments, the 3' and 5' ends of the corresponding linear protein-coding mRNA are covalently bound to the circRNA. In some embodiments, the circRNA is resistant to exonuclease degradation compared to the corresponding linear mRNA. In a specific embodiment, the circRNA comprises one or more nucleotide sequences encoding one or more antibody or antigen-binding fragments that are expressed when the circRNA is present in a host cell. In a specific embodiment of this disclosure, the circRNA may comprise one or more nucleotide sequences encoding one or more antibody or antigen-binding fragments according to this disclosure, which are expressed in vivo in human host cells to produce the antibody or antigen-binding fragments.

[0091] In some embodiments, circRNA can be formed from mature linear mRNA, particularly through self-splicing. In some embodiments, circRNA can self-splice via backsplicing, where the 3' end following the protein-coding region binds to the 5' end preceding the protein-coding region. In some embodiments, circRNA can self-splice via intron-pairing-driven circularization, where introns in the protein-coding region bind to each other, for example using Alu repeat sequences. In some embodiments, circRNA can form a debranching-resistant lariat within the introns of the protein-coding region. In some embodiments, circRNA can be used for exon skipping within the protein-coding region.

[0092] In all these embodiments, the circRNA or the linear mRNA that forms the circRNA may contain a circularization sequence that promotes the circularization of the linear mRNA. In some embodiments, the circRNA may be formed from linear mRNA via the in vitro production of spliceosomes in host cells.

[0093] In some implementations, circRNA can be introduced into human host cells via a circRNA therapeutic construct. This introduction can occur in vivo in human subjects, particularly in human host cells. Once in the cytosol, the circRNA is translated, thereby expressing the encoded protein.

[0094] "Self-assembling RNA" ("saRNA") is sometimes also called "self-replicating RNA" or "replicon." saRNA is an mRNA containing one or more nucleotide sequences that, when present in a host cell, cause the saRNA to replicate. The saRNA also contains one or more nucleotide sequences encoding one or more antibody or antigen-binding fragments that are expressed when the saRNA is present in a host cell. In one specific embodiment of this disclosure, the saRNA may comprise: i) one or more nucleotide sequences encoding an antibody or antigen-binding fragment according to this disclosure, which are expressed in vivo in a human host cell to produce the antibody or antigen-binding fragment; and ii) one or more nucleotide sequences that cause the saRNA to replicate in a human host cell. In some embodiments, the one or more nucleotide sequences that cause the saRNA to replicate in a host cell may encode one or more replication proteins or peptides.

[0095] In some embodiments, the saRNA further comprises one or more promoters that induce the expression of a replicating protein or peptide and an antibody or antigen-binding fragment in a host cell. In a specific embodiment, the promoter has a sequence comprising, substantially comprising, or consisting of the following sequence: UAACCUGAAUGGACUACGACAUAGUCUAGUCCGCCAAGUCUAGCAUAUGGCCACCAUG (SEQ ID NO: 205). In embodiments in which the saRNA is amplified using DNA or otherwise constructed, the U in this promoter sequence is replaced by T.

[0096] In a specific embodiment, one or more nucleotide sequences that induce saRNA replication in human host cells include sequences encoding one or more replication proteins or peptides that encode the replicating saRNA. In a more specific embodiment, the replication protein or peptide may be an RNA polymerase, such as RNA-dependent RNA polymerase (RDRP). In some embodiments, RDRP may be alphavirus RDRP or a variant thereof, more particularly Venezuelan Equine Encephalitis Virus (VEEV), especially VEE TC-83 virus, Semliki Forest Virus (SFV), or Sindbis Virus RDRP or variants thereof. In a more specific embodiment, the replication protein may comprise, consist of, or be composed of non-structural proteins 1-4 (nsP1-4), wherein nsP1 is the protein that induces mRNA capping, nsP2 is an NTPase / helicase / protease, nsP3 is a metadomain mediating the interaction between the virus and the host protein, and nsP4 is RDRP.

[0097] (SEQ ID NO: 206).

[0098] In some embodiments, the saRNA encodes one or more replication proteins having a sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to SEQ ID NO: 206.

[0099] In some implementations, the above-described methods for modifying and generating saRNA may be present or used in conjunction with other types of mRNA.

[0100] In some embodiments, saRNA can be introduced into human host cells via a saRNA therapeutic construct. This introduction can occur in vivo in a human subject, particularly in human host cells. Once in the cytosol, ribosomes can translate the saRNA to express one or more replication proteins. The replication protein or peptide can then generate a negative saRNA chain (a chain complementary to the saRNA delivered to the host cell), which is then used as a template by the replication protein or peptide to generate a replicating positive saRNA chain. In some embodiments, the replicating positive saRNA chain may be sequence-identical to the saRNA delivered to the host cell, or may additionally contain both a sequence encoding a replication protein or peptide and a sequence encoding an antibody or antigen-binding fragment, and may be referred to as “fully replicated saRNA.” In other embodiments, the replicating positive saRNA chain may contain a sequence encoding an antibody or antigen-binding fragment but lacks a sequence encoding a replication protein or peptide, and may be referred to as “antibody-restricted replicating saRNA.” In some embodiments, both fully replicated saRNA and antibody-restricted replicating saRNA are generated in human host cells.

[0101] Then, the fully replicated saRNA or the antibody-restricted replicated saRNA, or both, can be translated by cellular ribosomes to express the antibody or antigen-binding fragment.

[0102] "Trans-amplified RNA" or "taRNA" refers to a collection of mRNAs in a taRNA therapeutic construct that can function similarly to a saRNA therapeutic construct. Such a taRNA therapeutic construct may contain multiple distinct mRNA molecules that collectively encode a replication protein or peptide, as well as an antibody or antigen-binding fragment, which can be found in the saRNA therapeutic construct. For example, a taRNA therapeutic construct may contain a first mRNA encoding an antibody or antigen-binding fragment and a second or additional mRNA encoding one or more replication proteins or peptides. Alternatively, a taRNA therapeutic construct may contain different mRNAs for each antibody or antigen-binding fragment and replication protein or peptide, which may otherwise be found in the saRNA therapeutic construct.

[0103] In some embodiments, one or more taRNAs in the taRNA therapeutic construct encode one or more replicating proteins having a sequence that is at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to SEQ ID NO: 206.

[0104] In a further specific implementation, saRNA or taRNA may not be able to be inserted into the genome within host cells, particularly in human host cells.

[0105] In some implementations, saRNA or taRNA may also be circRNA.

[0106] "Sequence identity percentage" refers to the relationship between two or more sequences as determined by sequence comparison. Preferred methods for determining sequence identity are designed to achieve optimal matching between the compared sequences. For example, sequences are aligned for optimal comparison purposes (e.g., vacancies may be introduced in one or both of the first amino acid or nucleic acid sequence and the second amino acid or nucleic acid sequence to achieve optimal alignment). Furthermore, non-homologous sequences may be ignored for comparison purposes. Unless otherwise specified, the sequence identity percentage mentioned herein is calculated over the length of a reference sequence. Methods for determining sequence identity and similarity are available in publicly available computer programs. Sequence alignment and identity percentage calculation can be performed using BLAST programs (e.g., BLAST2.0, BLASTP, BLASTN, or BLASTX). The mathematical algorithms used in BLAST programs are available from Altschul et al. Nucleic Acids Res. 25:3389-3402, 1997. In the context of this disclosure, it should be understood that when analysis is performed using sequence analysis software, the results of the analysis are based on the “default values” of the referenced program. “Default values” means any set of values ​​or parameters initially loaded when the software is first initialized.

[0107] Other examples include Clustal W, MAFFT, Clustal Omega, AlignMe, Praline, GAP, BESTFIT, Needle (EMBOSS), Stretcher (EMBOSS), GGEARCH2SEQ, Water (EMBOSS), Matcher (EMBOSS), LALIGN, and SSEARCH2SEQ. Global alignment algorithms (such as Needleman and Wunsch algorithms) can be used to align two sequences over their entire length, maximizing the number of matches and minimizing the number of gaps. Default values ​​can be used.

[0108] To generate similarity scores between two amino acid sequences, a scoring matrix can be used, which assigns positive scores to some dissimilar amino acids (e.g., conserved amino acid substitutions, amino acids with similar physicochemical properties, and / or amino acids exhibiting frequent substitutions in orthologs, homologs, or paralogs). Non-limiting examples of scoring matrices include PAM30, PAM70, PAM250, BLOSUM45, BLOSUM50, BLOUM62, BLOSUM80, and BLOSUM90.

[0109] The term "isolated" means the removal of material from its original environment (e.g., the natural environment if the material is naturally occurring). For example, naturally occurring nucleic acids or peptides present in living organisms are not isolated, but the same nucleic acids or peptides isolated from some or all of the coexisting material in the natural system are isolated. Such nucleic acids may be part of a carrier, DNA therapeutic agent, RNA therapeutic agent, and / or such nucleic acids or peptides may be part of a composition (e.g., cell lysate) and are still isolated because such a carrier, DNA therapeutic agent, RNA therapeutic agent, or composition is not part of the natural environment of the nucleic acid or peptide.

[0110] The term “gene” refers to a segment of DNA or RNA that is involved in producing a polypeptide chain; in some contexts, a gene contains regions before and after the coding region (e.g., the 5' untranslated region (UTR) and the 3' UTR) as well as interspersed sequences (introns) between individual coding segments (exons).

[0111] "Functional variant" refers to a polypeptide or polynucleotide that is structurally similar to or substantially structurally similar to the parent or reference compound of this disclosure but differs slightly in composition (e.g., a different base, atom, or functional group, or has been added or removed), such that the polypeptide or encoded polypeptide can perform one or more functions of the parent polypeptide at an efficiency of at least 50%, preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% of the parent polypeptide activity level. In other words, when the polypeptide or encoded polypeptide of this disclosure is used in a selected assay (such as an assay for measuring binding affinity (e.g., measuring association (Ka) or dissociation (K)), the functional variant is considered to have function. D Biacore of constant ® When a functional variant shows a performance reduction of no more than 50% compared to the parent or reference peptide in tetramer staining, it is considered to have “similar binding,” “similar affinity,” or “similar activity.”

[0112] As used herein, a “functional moiety” or “functional fragment” refers to a polypeptide or polynucleotide that contains only a domain, portion, or fragment of a parent or reference compound, and the polypeptide or encoded polypeptide retains at least 50% of the activity associated with the domain, portion, or fragment of the parent or reference compound, preferably at least 55%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 99.9%, or 100% of the parent polypeptide activity level, or provides a biological benefit (e.g., effector function). A “functional moiety” or “functional fragment” of a polypeptide or encoded polypeptide of this disclosure exhibits a performance reduction of no more than 50% (preferably no more than 20% or 10%, or no more than a logarithmic difference in affinity) compared to a parent or reference polypeptide in a selected assay, and is therefore considered to have “similar binding” or “similar activity”.

[0113] As used herein, the terms “engineered,” “recombinant,” or “non-natural” refer to an organism, microorganism, cell, nucleic acid molecule, vector, DNA therapeutic, or RNA therapeutic that contains one or more genetic alterations or has been modified by introducing exogenous or heterologous nucleic acid molecules, wherein such alterations or modifications are introduced through genetic engineering (i.e., human intervention). Genetic alterations include, for example, modifications to expressible nucleic acid molecules that encode functional RNA, proteins, fusion proteins, or enzymes, or other additions, deletions, substitutions, or other functional disruptions of the cell’s genetic material. Additional modifications include, for example, non-coding regulatory regions, wherein modifications alter the expression of polynucleotides, genes, or operons.

[0114] As used herein, "heterologous," "non-endogenous," or "exogenous" means any gene, protein, compound, nucleic acid molecule, or activity that is not natural to the host cell or subject, or any gene, protein, compound, nucleic acid molecule, or activity that is natural to the host cell or subject but has been altered. Heterologous, non-endogenous, or exogenous includes genes, proteins, compounds, or nucleic acid molecules that have been mutated or otherwise altered to differ in structure, activity, or both from the natural and altered gene, protein, compound, or nucleic acid molecule. In some embodiments, heterologous, non-endogenous, or exogenous genes, proteins, or nucleic acid molecules (e.g., receptors, ligands, etc.) may not be endogenous to the host cell or subject, and the nucleic acid encoding such genes, proteins, or nucleic acid molecules may have been added to the host cell through conjugation, transformation, transfection, electroporation, etc., wherein the added nucleic acid molecule may be integrated into the host cell genome or may exist as extrachromosomal genetic material (e.g., as a plasmid or other self-replicating vector). The term "homologous" or "homogeneous" refers to a gene, protein, compound, nucleic acid molecule, or activity found in or derived from a host cell, species, or strain. For example, a heterologous or exogenous polynucleotide or gene encoding a polypeptide may be homologous to a natural polynucleotide or gene and encode a homologous polypeptide or activity, but the polynucleotide or polypeptide may have altered structure, sequence, expression level, or any combination thereof. Non-endogenous polynucleotides or genes, as well as the polypeptides or activities they encode, may originate from the same species, different species, or combinations thereof.

[0115] In some implementations, a nucleic acid molecule native to the host cell, or a portion thereof, is considered heterologous to the host cell if it has been altered or mutated, or if it has been altered with a heterologous expression control sequence or with an endogenous expression control sequence not typically associated with the host cell's native nucleic acid molecule. Furthermore, the term "heterologous" can refer to biological activity that is different, altered, or not endogenous to the host cell. As described herein, more than one heterologous nucleic acid molecule may be introduced into the host cell as a single nucleic acid molecule, as multiple individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a fusion protein, or any combination thereof.

[0116] As used herein, the terms “endogenous” or “natural” refer to polynucleotides, genes, proteins, compounds, molecules, or activities that are normally present in host cells or subjects.

[0117] As used herein, the term "expression" refers to the process by which a polypeptide is produced based on the coding sequence of a nucleic acid molecule, such as a gene. This process may include transcription, post-transcriptional control, post-transcriptional modification, translation, post-translational control, post-translational modification, or any combination thereof. The expressed nucleic acid molecule is typically operatively linked to an expression control sequence (e.g., a promoter).

[0118] The term "operably linked" refers to the association of two or more nucleic acid molecules on a single nucleic acid fragment, such that the function of one is affected by the function of the other. For example, a promoter is operably linked to a coding sequence when it can influence the expression of that sequence (i.e., the coding sequence is under the transcriptional control of the promoter). "Unlinked" means that the related genetic elements are not closely related to each other and the function of one does not affect the function of the other.

[0119] As described herein, more than one heterologous nucleic acid molecule may be introduced into a host cell as a single nucleic acid molecule, as multiple individually controlled genes, as a polycistronic nucleic acid molecule, as a single nucleic acid molecule encoding a protein (e.g., the heavy chain of an antibody), or any combination thereof. When two or more heterologous nucleic acid molecules are introduced into a host cell, it should be understood that the two or more heterologous nucleic acid molecules may be introduced as a single nucleic acid molecule (e.g., on a single vector), introduced on a separate vector, integrated into the host chromosome at a single site or multiple sites, or any combination thereof. The number of heterologous nucleic acid molecules or protein activities cited refers to the number of nucleic acid molecules encoding the protein or the number of protein activities, not the number of individual nucleic acid molecules introduced into the host cell.

[0120] The term "construction" refers to any polynucleotide (or, when the context clearly indicates, the fusion protein of this disclosure) that contains a recombinant nucleic acid molecule. (Polynucleotide) constructs may be present in vectors (e.g., bacterial vectors, viral vectors) or may be integrated into the genome.

[0121] A "vector" is a nucleic acid molecule capable of transporting another nucleic acid molecule. Vectors can be, for example, plasmids, granules, viruses, RNA vectors, or linear or circular DNA or RNA molecules that may include chromosomal, non-chromosomal, semi-synthetic, or synthetic nucleic acid molecules. Vectors disclosed herein also include transposon systems (e.g., Sleeping Beauty, see example...). Geurts et al. Mol.Ther.8 :108, 2003: Mátés et al. , Nat. Genet.41 Exemplary vectors are vectors capable of autonomous replication (free vectors), vectors capable of delivering polynucleotides to the cell genome (e.g., viral vectors), or vectors capable of expressing the nucleic acid molecules they are linked to (expression vectors).

[0122] As used herein, “expression vector” or “vector” refers to a DNA or RNA construct containing a nucleic acid molecule operatively linked to a suitable control sequence that enables the expression of that nucleic acid molecule in a suitable host. Such control sequences include a promoter that enables transcription, an optional operon sequence that controls such transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence that controls the termination of transcription and translation. A vector can be a plasmid, a phage particle, a virus, or simply a potential genomic insert. Once transformed into a suitable host, the vector can replicate and function independently of the host genome, or in some cases, integrate into the genome itself or deliver the polynucleotides contained in the vector into the genome without the vector sequence. In this specification, “plasmid,” “expression plasmid,” “virus,” and “vector” are generally used interchangeably.

[0123] In some implementations, the "vector" may contain or be composed of mRNA, such as saRNA, taRNA, or circRNA.

[0124] In the context of inserting nucleic acid molecules into cells, the term “introduction” means “transfection,” “conversion,” or “transduction” and includes references to incorporating nucleic acid molecules into eukaryotic or prokaryotic cells, wherein the nucleic acid molecules may be incorporated into the cell’s genome (e.g., chromosome, plasmid, plastid, or mitochondrial DNA), transformed into autonomous replicons (e.g., replicons formed by saRNA), or transiently expressed (e.g., transfected mRNA, such as circRNA, taRNA, or saRNA).

[0125] In some embodiments, the polynucleotides of this disclosure are operatively linked to certain elements of a vector. For example, the polynucleotide sequence required to achieve expression and processing of the coding sequence linked by the polynucleotide sequence is operatively linked. Expression control sequences may include appropriate transcription initiation, termination, promoter, and enhancer sequences; effective RNA processing signals, such as splicing and polyadenylation signals; sequences stabilizing cytoplasmic mRNA; sequences enhancing translation efficiency (i.e., Kozak concordant sequences); sequences enhancing protein stability; and, possibly, sequences enhancing protein secretion. Expression control sequences are operatively linked if they are adjacent to the gene of interest and expression control sequences that act trans- or at a distance to control the gene of interest.

[0126] In some embodiments, the vector includes plasmid vectors or viral vectors (e.g., lentiviral vectors or gamma-retroviral vectors). Viral vectors include retroviruses; adenoviruses; parvoviruses (e.g., adeno-associated virus); coronaviruses; negative-strand RNA viruses, such as orthomyxoviruses (e.g., influenza virus), rhabdoviruses (e.g., rabies and vesicular stomatitis virus), paramyxoviruses (e.g., measles and Sendai virus); positive-strand RNA viruses, such as picornaviruses and alphaviruses; and double-stranded DNA viruses, including adenoviruses, herpesviruses (e.g., herpes simplex virus types 1 and 2, Epstein-Barr virus, cytomegalovirus), and poxviruses (e.g., cowpox, fowlpox, and canarypox). Other viruses include, for example, norovirus, capsular virus, flavivirus, reovirus, papillomavirus, hepatotropic DNA virus, and hepatitis virus. Examples of retroviruses include avian leukosis-sarcoma, mammalian C-virus, B-virus, D-virus, HTLV-BLV swarm, lentivirus, and foam virus (Coffin, JM, Retroviridae: The viruses and their replication, Fundamental Virology, 3rd edition, edited by BN Fields et al., Lippincott-Raven Publishers, Philadelphia, 1996).

[0127] Retroviruses are viruses with an RNA genome that is reverse transcribed into DNA using reverse transcriptase. The transcribed DNA is then incorporated into the host cell's genome. Gamma retroviruses refer to a genus within the family Retroviridae. Examples of gamma retroviruses include mouse stem cell virus, murine leukemia virus, feline leukemia virus, feline sarcoma virus, and avian reticuloendothelial proliferative virus.

[0128] Lentiviral vectors include HIV-based lentiviral vectors used for gene delivery. These can be integrated or non-integrated, have a relatively large packaging capacity, and can transduce a range of different cell types. Lentiviral vectors are typically generated after transiently transfecting three or more plasmids (packaging, envelope, and transfer) into production cells. Similar to HIV, lentiviral vectors enter target cells through the interaction of viral surface glycoproteins with receptors on the cell surface. Upon entry, viral RNA undergoes reverse transcription, mediated by the viral reverse transcriptase complex. The product of reverse transcription is double-stranded linear viral DNA, which serves as the substrate for viral integration into the DNA of the infected cell.

[0129] In some embodiments, the viral vector may be a gamma retrovirus, such as a Moloney murine leukemia virus (MLV)-derived vector. In other embodiments, the viral vector may be a more complex retrovirus-derived vector, such as a lentivirus-derived vector. HIV-1-derived vectors fall into this category. Other examples include lentivirus vectors derived from HIV-2, FIV, equine infectious anemia virus, SIV, and Medi-Visna virus (sheep lentivirus). Methods of transducing mammalian host cells with transgenic viral particles using retroviruses and lentivirus vectors and packaging cells are known in the art and have previously been described, for example, in the following documents: U.S. Patent 8,119,772; Walchli et al., PLoS One 6 :327930, 2011; Zhao et al. J. Immunol. 174 :4415, 2005; Engels et al. , Hum.Gene Ther.14 :1155, 2003; Frecha et al. , Mol.Ther.18 :1748, 2010; and Verhoeyen et al. , Methods Mol.Biol.506 :97, 2009. Retroviral and lentiviral vector constructs and expression systems are also commercially available. Other viral vectors can also be used for polynucleotide delivery, including DNA viral vectors, such as adenovirus-based vectors and adeno-associated virus (AAV)-based vectors; vectors derived from herpes simplex virus (HSV), including amplicon vectors, replication-defective HSV, and attenuated HSV (Krisky et al.). Gene Ther.5 :1517, 1998).

[0130] Other vectors that can be used with the compositions and methods of this disclosure include vectors derived from baculoviruses and alpha viruses (Jolly, DJ. 1999. Emerging Viral Vectors. pp. 209-40, in Friedmann T. (ed.), The Development of Human Gene Therapy. New York: Cold Spring Harbor Lab), or plasmid vectors (such as Sleeping Beauty or other transposon vectors).

[0131] When a viral vector genome contains multiple polynucleotides to be expressed as individual transcripts in a host cell, the viral vector may also contain additional sequences between two (or more) transcripts, thereby allowing bicistronic or polycistronic expression. Examples of such sequences used in viral vectors include internal ribosome entry sites (IRES), furin cleavage sites, viral 2A peptides, or any combination thereof.

[0132] This article further describes plasmid vectors, including DNA-based antibody or antigen-binding fragment-encoded plasmid vectors for direct administration to subjects.

[0133] As used herein, a “carrier” or “medium” includes a molecule capable of introducing a polynucleotide into a host cell. In specific embodiments, a carrier may include lipids, lipid-derived delivery mediators such as liposomes, solid lipid nanoparticles, oily suspensions, submicron lipid emulsions, lipid microvesicles, reverse lipid micelles, cochlear liposomes, lipid microtubules, lipid micropillars, lipid nanoparticles (LNPs), lipid complexes (liopolyplexes, LPPs), cationic peptides, polymer nanoparticles, or nanoscale platforms such as nanoemulsions. (See, for example, Li et al.) Wilery Interdiscip Rev. Nanomed Nanobiotechnol.11 (2):e1530 (2019), whose description of the carriers and mediators, as well as the methods for preparing such carriers and mediators and the methods for forming therapeutic agents using such carriers and mediators, is incorporated herein by reference.

[0134] The principles, reagents, and techniques for designing appropriate mRNAs and formulating and delivering mRNA-LNPs are described, for example, by Pardi et al. J Control Release 217345-351 (2015)); Thess et al. ( Mol Ther 23: 1456-1464 (2015)); Thran et al. ( EMBO Mol Med 9 (10):1434-1448 (2017)); Kose et al. Sci.Immunol.4 eaaw6647 (2019)); and Sabnis et al. ( Mol.Ther.26 The techniques described in 1509-1519 (2018) include end-capping, codon optimization, nucleoside modification, mRNA purification, incorporation of mRNA into stable lipid nanoparticles (e.g., ionizable cationic lipids / phosphatidylcholine / cholesterol / PEG-lipids; ionizable lipids: distearate PC:cholesterol:polyethylene glycol lipids) and their subcutaneous, intramuscular, intradermal, intravenous, intraperitoneal and intratracheal administration, which are incorporated herein by reference.

[0135] In some embodiments, the LNP may be formed from cationic lipids, particularly ionizable lipids. In other embodiments, the LNP may be formed from lipid-like molecules derived from ionizable lipids and dendrites. In some embodiments, the LNP may further comprise structural lipids, such as phospholipids, cholesterol, or both. In some embodiments, the LNP may comprise i) ionizable lipids having a positive charge capable of binding a negatively charged RNA backbone, ii) polyethylene glycol-modified lipids, iii) cholesterol, and iv) phospholipids.

[0136] As used in this article, “RNA therapeutic agent” is an RNA therapeutic construct or naked RNA, including naked circRNA, taRNA, or saRNA. An “RNA therapeutic construct” comprises an RNA molecule and a carrier.

[0137] In some implementations, RNA therapeutic constructs can “self-assemble” from a mixture containing RNA and a carrier or carrier precursor (such as small lipid vesicles). Self-assembly can occur, in particular, with an LNP carrier.

[0138] A “circRNA therapeutic construct” comprises a circRNA and a carrier. The circRNA may exhibit different behavior in the formation and function of the circRNA therapeutic construct compared to that observed with respect to the corresponding linear mRNA in the presence of the same carrier. For example, due to the circular nature of the circRNA, the copy number that can be contained in the carrier may differ from the possible copy number using the corresponding linear mRNA. As another example, the conditions that result in the encapsulation of the circRNA in the carrier or its release from the carrier in vivo may also differ from the conditions applicable to the corresponding linear mRNA.

[0139] The “taRNA therapeutic construct” comprises at least two distinct taRNAs: a first taRNA encoding a replication protein and a second taRNA encoding a protein or peptide of interest, typically an antibody or antigen-binding fragment. In some embodiments, the second taRNA may encode a peptide containing VH, and the taRNA therapeutic construct may further comprise a third taRNA encoding a peptide containing VL.

[0140] “saRNA therapeutic constructs” consist of saRNA and a carrier. Because they contain sequences encoding replicating proteins or peptides, saRNAs are typically larger than mRNAs that only encode the protein or peptide of interest, and therefore saRNA therapeutic constructs can benefit from using carriers that work in conjunction with longer RNA molecules, such as carriers containing polyethyleneimine (PEI), particularly LNPs.

[0141] In some implementations, the saRNA therapeutic construct may contain at least 10, 50, or 100, or between 10 and 50, between 10 and 100, or between 50 and 100 saRNA copies per load.

[0142] As used in this article, "DNA therapeutic agent" refers to a DNA therapeutic construct or naked DNA, including naked DNA vectors. A "DNA therapeutic construct" comprises a DNA molecule and a carrier.

[0143] As used herein, the term “host” refers to a target cell or microorganism that has been genetically modified with heterologous nucleic acid molecules to produce a polypeptide of interest (e.g., an antibody of this disclosure).

[0144] Host cells can include any single cell or cell culture that can accept a vector or incorporate nucleic acids or express proteins. The term also encompasses the offspring of the host cell, whether genetically or phenotypically identical or different. Suitable host cells can depend on the vector and can include mammalian cells, animal cells, human cells, monkey cells, insect cells, yeast cells, and bacterial cells. These cells can be induced to incorporate a vector or other material using viral vectors, transformation via calcium phosphate precipitation, DEAE-glucan, electroporation, microinjection, or other methods. See, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual , 2nd edition (Cold Spring Harbor Laboratory, 1989).

[0145] In embodiments involving RNA therapeutics (including circRNA, taRNA, or saRNA therapeutics) and DNA therapeutics, the host cell may be a human cell. In some more specific embodiments, the host cell may be a cell capable of producing antibodies prior to the introduction of RNA or DNA, such as a B cell. In other more specific embodiments, the host cell may be a cell that cannot otherwise produce antibodies prior to the introduction of RNA or DNA, such as a muscle cell.

[0146] In embodiments involving RNA or DNA therapeutic agents produced without the use of cell-free systems, at least two types of host cells may be present: “production host cells” for producing RNA or DNA for the DNA therapeutic agent, and “in vivo human host cells” in which RNA or DNA is introduced.

[0147] As used herein, "antigen" or "Ag" refers to an immunogenic molecule that elicits an immune response. This immune response may involve antibody production, activation of specific immune-active cells, complement activation, antibody-dependent cytotoxicity, or any combination thereof. An antigen (immunogenic molecule) can be, for example, a peptide, glycopeptide, polypeptide, glycopeptide, polynucleotide, polysaccharide, lipid, etc. It is evident that antigens can be synthesized, recombinantly generated, or derived from biological samples. Exemplary biological samples that may contain one or more antigens include tissue samples, fecal samples, cells, biological fluids, or combinations thereof. Antigens can be produced by cells that have been modified or genetically engineered to express antigens. Antigens may also be present in sabeviruses (e.g., surface glycoproteins or portions thereof), such as in virions, or expressed or presented on the surface of cells infected with sabeviruses. An antibody or an antigen-binding fragment thereof may be referred to as "anti-" the antigen it binds to.

[0148] The term "epitope" or "antigenic epitope" includes any molecule, structure, amino acid sequence, or protein determinant that is recognized and specifically bound by homologous binding molecules (such as immunoglobulins) or other binding molecules, domains, or proteins. Epitope determinants typically comprise chemically active surface groups of molecules such as amino acids or sugar side chains and may have specific three-dimensional structural characteristics and specific charge properties. Where the antigen is or comprises a peptide or protein, the epitope may consist of continuous amino acids (e.g., a linear epitope), or it may consist of amino acids from different parts or regions of a protein that are close together due to protein folding (e.g., a discontinuous or conformational epitope), or it may consist of non-continuous amino acids that are closely adjacent regardless of protein folding.

[0149] Antibodies, antigen-binding fragments and compositions In one aspect, this disclosure provides an isolated antibody or antigen-binding fragment comprising an S2V29 antibody, particularly an S2V29-v37.2 or variant thereof, capable of binding to the surface glycoprotein of a sabevirus (e.g., SARS-CoV-2). In some embodiments, the antibody or antigen-binding fragment is capable of binding to the surface glycoproteins of two or more sabeviruses, three or more sabeviruses, four or more sabeviruses, or five or more sabeviruses. In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain variable domain (VH) containing CDRH1, CDRH2, and CDRH3 and a light chain variable domain (VL) containing CDRL1, CDRL2, and CDRL3. In some embodiments, the antibody or antigen-binding fragment comprises a heavy chain (HC) containing VH (and in some embodiments, a heavy chain constant domain (CH)) and a light chain (LC) containing VL (and in some embodiments, a light chain constant domain (CL)).

[0150] In some embodiments, two or more, three or more, four or more, or five or more sabeviruses comprise one or more (or selected from) clade 1b sabeviruses or their naturally occurring variant lineages, and any combination thereof. In some embodiments, the antibody or antigen-binding fragment is capable of binding to two or more, three or more, four or more, or five or more sabevirus surface glycoproteins; for example, when the sabevirus surface glycoprotein is expressed on the cell surface of a host cell and / or on the sabevirus virion. In some embodiments, two or more, three or more, four or more, or five or more sabeviruses are selected from SARS-CoV-2, PANG / GD, PANG / GX, RatG13, and their naturally occurring variant lineages. In some embodiments, two or more, three or more, four or more, or five or more sabeviruses comprise one or more of the SARS-CoV-2 variant lineages. In some further embodiments, the antibody or antigen-binding fragment is capable of binding to one or more SARS-CoV-2 variant lineages.Examples of clade 1b also include SARS-CoV-2 variant lineages, such as variant lineages with any of the following mutations: A67V, Δ69-70, T95I, G142D, 137-145de, 143-145de, Y145H, N211I, Δ212, V213G, ins214TDR, ins215EPE, A222V, G339D, R346K, R346S, V367F. S371L, S373P, S375F, T376A, P384L, N394S, D405N, R408S, Q414K, K417N, K417V, K417T, N439K, N440K, G446S, Y449H, Y449N, L452R, L452Q, L452X (where X is any amino acid other than L), Y453F, S477N, T478K, V4 83A, E484A, E484Q, E484K, E484X (where X is any amino acid other than E), F490R, F486V, F490S, R493Q, Q493R, S494P, G496S, Q498R, N501Y, N501T, Y505H, E516Q, T547K, Q613H, D614G, A653V, H655Y, G669S, Q677H N679K, ins679GIAL, P681H, P681R, A701V, N764K, D796Y, N856K, Q954H, N969K, L981F, D614, E340A, or B.1.1.7 and Q lineages and their progeny lineages (α); B.1.351 and their progeny lineages (β); B.1.429 and B.1.427 and their progeny lineages (ε); P.1 and their progeny lineages (γ); B.1.1.222; C.37; B.1.617.2; AY.1, AY.2, other AY lineages and descendant lineages (δ); B.1.525 and descendant lineages (η); B.1.526 and descendant lineages (ι); B.1.617.1 and descendant lineages (κ); 1.617.3; B.1.621 and B.1.621.1 and descendant lineages (μ); P.2 (ζ); B.1.1.529.1, BA.1, BA .2, BA.2.12, BA.2.75.2, BA.2.86, BA.3, BA.4, BA.5 and their descendant lineages (ο); and BQ.1.1, XBB.1, XBB.1.5, CH.1.1, XBB.2.3, EG.5, EG.5.1, XBB.1.16.1, XBB.1.16.6, FL.1.5.1, HK.3, HV.1, JD.1.1 and JN.1 and their descendant lineages.

[0151] In some embodiments, two or more, three or more, four or more, or five or more sabeviruses comprise one or more SARS-CoV-2 variant lineages having an S protein mutation D614G, Q493R, G496S, Q498R, N501Y, Y453F, N439K, K417V, E484K, or any combination thereof, or mutations found in the BQ.1.1 or XBB.1 variant lineages and their progeny lineages. In some embodiments, two or more sabeviruses comprise one or more SARS-CoV-2 variant lineages having an S protein mutation K417N, Q493K, G496S, or any combination thereof.

[0152] In some embodiments, the antibody or antigen-binding fragment of this disclosure associates or binds to a sabizontal surface glycoprotein epitope or an antigen containing that epitope, without significantly associating or binding to any other molecule or component in the sample. In some embodiments, the epitope is contained in the S1 subunit of the S protein. In further embodiments, the epitope is contained in the RBD of the S protein. In some embodiments, the epitope is a conformational epitope or a linear epitope.

[0153] In some embodiments, the antibody or antigen-binding fragment of this disclosure associates or binds (e.g., binds) to a first sabevirus surface glycoprotein epitope, and may also associate or bind to an epitope from another sabevirus present in the sample, but not significantly associates or binds to any other molecule or component in the sample. In other words, in some embodiments, the antibody or antigen-binding fragment of this disclosure is cross-reactive against two or more sabeviruses (e.g., against SARS-CoV-2 Wuhan-Hu-1 and one or more variant lineages, or against SARS-CoV and SARS-CoV-2) and binds specifically to them.

[0154] In some embodiments, the antibody or antigen-binding fragment of this disclosure specifically binds to the surface glycoprotein of the sabevirus. As used herein, "specific binding" means the association or conjugation of an antibody or antigen-binding fragment with an antigen, wherein the affinity or K... a (That is, the equilibrium association constant of a specific binding interaction, in units of 1 / M) equal to or greater than 10 5 M -1 (It is equal to the association rate of the association reaction [K]) on ] and dissociation rate [K off The affinity (ratio) does not significantly associate or bind with any other molecule or component in the sample. Alternatively, affinity can be defined as the equilibrium dissociation constant (K0) of a particular binding interaction. d ), the unit is M (e.g., 10 -5 M to 10-13 Antibodies can be classified as "high-affinity" antibodies or "low-affinity" antibodies. "High-affinity" antibodies refer to those with K... a For at least 10 7 M -1 At least 10 8 M -1 At least 10 9 M -1 At least 10 10 M -1 At least 10 11 M -1 At least 10 12 M -1 Or at least 10 13 M -1 Antibodies. "Low affinity" antibodies refer to those that contain K... a For a maximum of 10 7 M -1 At most 10 6 M -1 At most 10 5 M -1 Antibodies. Alternatively, affinity can be defined as the equilibrium dissociation constant (K0) of a particular binding interaction. d ), the unit is M (e.g., 10 - 5 M to 10 -13 M).

[0155] Various assays are known for identifying the antibodies of this disclosure that bind to specific targets and for determining the affinity of binding domains or binding proteins, such as Western blotting, ELISA (e.g., direct, indirect, or sandwich), analytical ultracentrifugation, biolayer interferometry, isothermal titration calorimetry, spectroscopy, and surface plasmon resonance (Biacore) assays. ® ) analysis (see, for example, Scatchard et al., Ann.NYAcad.Sci.51 :660, 1949; Wilson, Science 295 :2103, 2002; Wolff et al. Cancer Res. 53 U.S. Patent Nos. 2560, 1993; and U.S. Patent Nos. 5,283,173, 5,468,614 or equivalents. Methods for assessing affinity or apparent affinity or relative affinity are also known.

[0156] In some embodiments, the antibody or antigen-binding fragment of this disclosure binds to one or more, or two or more, sabeviruses of clade 1b or SARS-CoV and SARS-CoV-2, and optionally one or more additional sabeviruses, with EC50 values ​​of about 0.5 ng / mL to about 100 ng / mL, about 1 ng / mL to about 100 ng / mL, about 2.0 ng / mL to about 100 ng / mL, about 2.5 ng / mL to about 100 ng / mL, about 5.0 ng / mL to about 100 ng / mL, about 7.5 ng / mL to about 100 ng / mL, about 8.0 ng / mL to about 100 ng / mL, and about 9.0 ng / mL to about 100 ng / mL. Approximately 10.0 ng / mL to approximately 100 ng / mL, approximately 12.5 ng / mL to approximately 100 ng / mL, approximately 15.0 ng / mL to approximately 100 ng / mL, approximately 17.5 ng / mL to approximately 100 ng / mL, approximately 20 ng / mL to approximately 100 ng / mL, approximately 25.0 ng / mL to approximately 100 ng / mL, approximately 27.5 ng / mL to approximately 100 ng / mL, approximately 30 ng / mL to approximately 100 ng / mL, approximately 0.5 ng / mL to approximately 50 ng / mL, approximately 1 ng / mL to approximately 50 ng / mL, approximately 2.0 ng / mL to approximately 50 ng / mL, approximately 2.5 ng / mL to approximately 50 ng / mL, approximately 5.0 ng / mL to approximately 50 ng / mL, about 7.5 ng / mL to about 50 ng / mL, about 8.0 ng / mL to about 50 ng / mL, about 9.0 ng / mL to about 50 ng / mL, about 10.0 ng / mL to about 50 ng / mL, about 12.5 ng / mL to about 50 ng / mL, about 15.0 ng / mL to about 50 ng / mL, about 17.5 ng / mL to about 50 ng / mL, about 20 ng / mL to about 50 ng / mL, about 25.0 ng / mL to about 50 ng / mL, about 27.5 ng / mL to 50 ng / mL, or between about 30 ng / mL and about 50 ng / mL, about 0.5 ng / mL, about 0.9 ng / mL, about 1.0 ng / mL mL, approximately 1.25 ng / mL, approximately 1.5 ng / mL, approximately 1.75 ng / mL, approximately 2.0 ng / mL, approximately 2.25 ng / mL, approximately 2.5 ng / mL, approximately 3.0 ng / mL, approximately 4.0 ng / mL, approximately 5.0 ng / mL, approximately 7.5 ng / mL, approximately 8.0 ng / mL, approximately 9.0 ng / mL, approximately 10.0 ng / mL, approximately 12.5 ng / mL, approximately 15.0 ng / mL, approximately 17.5 ng / mL, approximately 20.0 ng / mL, approximately 22.5 ng / mL, approximately 25.0 ng / mL, approximately 27.5 ng / mL, or approximately 30 ng / mL, or at least approximately 0.5 ng / mL, approximately 0.9 ng / mL, approximately 1.The concentrations are within the range of approximately 0 ng / mL, approximately 1.25 ng / mL, approximately 1.5 ng / mL, approximately 1.75 ng / mL, approximately 2.0 ng / mL, approximately 2.25 ng / mL, approximately 2.5 ng / mL, approximately 3.0 ng / mL, approximately 4.0 ng / mL, approximately 5.0 ng / mL, approximately 7.5 ng / mL, approximately 8.0 ng / mL, approximately 9.0 ng / mL, approximately 10.0 ng / mL, approximately 12.5 ng / mL, approximately 15.0 ng / mL, approximately 17.5 ng / mL, approximately 20.0 ng / mL, approximately 22.5 ng / mL, approximately 25.0 ng / mL, approximately 27.5 ng / mL, or approximately 30 ng / mL, and can be determined by ELISA. In some embodiments, the antibody or antigen-binding fragment binds to the spike (S) protein RBD of one, two, three, four, or five sabeviruses, and in specific embodiments, SARS-CoV and SARS-CoV-2.

[0157] In some embodiments, the antibody or antigen-binding fragment is capable of binding to a first and a second sabevirus, each independently selected from clade 1b or SARS-CoV and SARS-CoV-2, wherein the antibody or antigen-binding fragment is capable of binding at concentrations of approximately 0.5 ng / mL, approximately 0.9 ng / mL, approximately 1.0 ng / mL, approximately 1.25 ng / mL, approximately 1.5 ng / mL, approximately 1.75 ng / mL, approximately 2.0 ng / mL, approximately 2.25 ng / mL, approximately 2.5 ng / mL, approximately 3.0 ng / mL, approximately 4.0 ng / mL, approximately 5.0 ng / mL, approximately 7.5 ng / mL, approximately 8.0 ng / mL, approximately 9.0 ng / mL, and approximately 10.0 ng / mL. It can bind to the first sabevirus at EC50 levels of approximately 12.5 ng / mL, approximately 15.0 ng / mL, approximately 17.5 ng / mL, approximately 20.0 ng / mL, approximately 22.5 ng / mL, approximately 25.0 ng / mL, approximately 27.5 ng / mL, or approximately 30 ng / mL, and can bind to the second sabevirus at EC50 levels of approximately 7.5 ng / mL, approximately 8.0 ng / mL, approximately 9.0 ng / mL, approximately 10.0 ng / mL, approximately 12.5 ng / mL, approximately 15.0 ng / mL, approximately 17.5 ng / mL, approximately 20.0 ng / mL, approximately 22.5 ng / mL, approximately 25.0 ng / mL, approximately 27.5 ng / mL, or approximately 30 ng / mL.

[0158] In some examples, the host cells can be immunostained with antibodies (e.g., fixed or fixed and permeabilized) by recombinant expression of the sabevirus antigen in the host cells (e.g., by transfection) and then subjected to flow cytometry (e.g., using a ZE5 cell analyzer (BioRad)). ®Binding is determined by combining analysis with FlowJo software (TreeStar). In some implementations, positive binding can be defined by differential antibody staining between cells expressing sabevirus and control (e.g., simulated) cells.

[0159] In some embodiments, the antibody or antigen-binding fragment of this disclosure binds to sabevirus spike proteins (i.e., from two or more, three or more, four or more, or five or more sabeviruses) expressed on the surface of host cells (e.g., Expi-CHO cells), as determined by flow cytometry.

[0160] In some embodiments, such as those measured using biolayer interferometry, the antibody or antigen-binding fragment of this disclosure binds to the sabevirus S protein.

[0161] In some embodiments, the antibodies of this disclosure are capable of neutralizing infection with one or more sabezi viruses. As used herein, a “neutralizing antibody” is an antibody capable of neutralizing, i.e., preventing, inhibiting, attenuating, hindering, or interfering with the ability of a pathogen to initiate and / or maintain infection in a host. The terms “neutralizing antibody” or “neutralizing antibody” are used interchangeably herein. In any embodiment of the currently disclosed embodiments, the antibody or antigen-binding fragment is capable of preventing and / or neutralizing infection with one or more sabezi viruses in in vitro infection models and / or in vivo infection animal models and / or in humans.

[0162] In some embodiments, the antibody is (or the antigen-binding fragment is derived from) S2V29-v37.2 or a variant thereof, and contains at least a portion of the CDR of the S2V29-v37.2 or a variant thereof disclosed herein, as well as optionally at least a portion of VH and VL. In some embodiments, the S2V29 antibody or antigen-binding fragment contains sufficient CDRH1-H3, CDRL1-L3, VH, and / or VL identity with S2V29-v.37.2, including, in some embodiments, precise identity to confer similar specificity binding to SARS-CoV-2, ranging from about 0.5 ng / mL to about 100 ng / mL. Similar specificity binding to another sabevirus, such as SARS-CoV, may also be present. In some embodiments, the antibody or antigen-binding fragment contains sufficient CDRH1-H3, CDRL1-L3, VH, and / or VL identity with S2V29-v.37.2, including, in some embodiments, precise identity to the extent that it can neutralize SARS-CoV-2 infection in pseudovirus systems (e.g., MLV-pp-based or VSV-pp-based) or in live virus assays, ranging from about 0.5 ng / mL to about 500 ng / mL, 0.5 ng / mL to about 100 ng / mL, about 50 ng / mL to about 500 ng / mL, or about 50 ng / mL to about 100 ng / mL. Similar specific binding to another sabevirus, such as SARS-CoV, may also be present.

[0163] In some embodiments, the antibody or antigen-binding fragment (i) recognizes an epitope in the spike protein of two or more sabeviruses; (ii) is capable of blocking the interaction between the spike protein of one or more sabeviruses and a cell surface receptor; (iii) recognizes a conserved epitope in the spike protein of two or more sabeviruses; (iv) is cross-reactive to two or more sabeviruses; or (v) any combination of (i)-(iv).

[0164] Unless explicitly defined differently herein, terms as understood by those skilled in the art of antibody technology are each given their established meaning in the art. For example, the term "antibody" refers to a complete antibody comprising at least two heavy (H) chains and two light (L) chains interconnected by disulfide bonds, and any antigen-binding portion or fragment of the complete antibody that has or retains the ability to bind to an antigen target molecule recognized by the complete antibody, such as scFv, Fab, or Fab'2 fragments. Thus, the term "antibody" is used herein in the broadest sense and includes polyclonal and monoclonal antibodies, including complete antibodies and their functional (antigen-binding) antibody fragments, including fragment antigen-binding (Fab) fragments, F(ab')2 fragments, Fab' fragments, Fv fragments, recombinant IgG (rIgG) fragments, single-chain antibody fragments, including single-chain variable fragments (scFv) and single-domain antibody fragments (e.g., sdAb, sdFv, nanobody). This term encompasses genetically engineered and / or otherwise modified forms of immunoglobulins, such as intracellular antibodies, peptide bodies, chimeric antibodies, fully human antibodies, humanized antibodies and heteroconjugated antibodies, multispecific (e.g., bispecific) antibodies, biantibodies, triantibodies, tetraantibodies, tandem biscFvs, and tandem triscFvs. Unless otherwise stated, the term "antibody" should be understood to encompass the functional antibody fragment. This term also encompasses complete or full-length antibodies, including antibodies of any class or subclass, including IgG and its subclasses (IgG1, IgG2, IgG3, IgG4), IgM, IgE, IgA, and IgD.

[0165] The term "V" L "or "VL" and "V" H"VL" or "VH" refers to the variable binding region (also called the variable domain) originating from the antibody light chain and antibody heavy chain, respectively. In some embodiments, VL is kappa (κ) class (also referred to herein as "VK"). In some embodiments, VL is lambda (λ) class. In some embodiments, the VL of the S2V29 antibody, particularly S2V29-v37.2, is lambda (λ) class. The variable binding region comprises discrete, well-defined subregions referred to as "complementarity-determining regions" (CDRs) and "frame regions" (FRs). The terms "complementarity-determining region" and "CDR" are synonymous with "hypervariate region" or "HVR" and refer to the amino acid sequence within the antibody variable region that, generally, collectively confers antigen specificity and / or binding affinity to the antibody, wherein consecutive CDRs (That is, CDR1 and CDR2, CDR2 and CDR3) are separated from each other by a frame in the primary structure. Each variable region has three CDRs (HCDR1, HCDR2, HCDR3; LCDR1, LCDR2, LCDR3; also referred to as CDRH and CDRL, or CDRH1-3 and CDRL1-3, respectively). In some embodiments, antibody VH contains four FRs and three CDRs as follows: FR1-HCDR1-FR2-HCDR2-FR3-HCDR3-FR4, and antibody VL contains four FRs and three CDRs as follows: FR1-LCDR1-FR2-LCDR2-FR3-LCDR3-FR4. Generally, VH and VL form antigen-binding sites together through their respective CDRs.

[0166] As used herein, a “variant” of a CDR refers to a functional variant of the CDR sequence having at most one to three amino acid substitutions (e.g., conserved or non-conserved substitutions), deletions, or combinations thereof.

[0167] The CDR and frame region numbering can be based on any known method, system, or scheme, such as the Kabat, Chothia, EU, IMGT, and AHo numbering schemes (see, for example, Kabat et al., “Sequences of Proteins of Immunological Interest,” US Dept. Health and Human Services, Public Health Service, National Institutes of Health, 1991, 5th edition; Chothia and Lesk, J. Mol.Biol.196 :901-917 (1987)); Lefranc et al., Dev.Comp.Immunol.27 :55, 2003; Honegger and Plückthun, J. Mol.Bio.309(657-670 (2001)). Equivalent residue positions can be annotated and compared between different molecules using the Antigen Receptor Numbering and Receptor Classification (ANARCI) software tool (2016, Bioinformatics 15:298-300). Therefore, identifying a CDR of an exemplary variable domain (VH or VL) sequence as provided herein according to one numbering scheme does not exclude antibodies containing CDRs of the same variable domain as identified using different numbering schemes.

[0168] In any of the currently disclosed embodiments, the antibody or antigen-binding fragment is capable of preventing and / or neutralizing infection with one or more, or two or more, sabeviruses in in vitro infection models and / or in vivo infection animal models and / or in humans.

[0169] In some embodiments, the antibody or antigen-binding fragment comprises S2V29 VH.22, VH.24, VH.25, VH.30, VH.31, VH.32, VH.37 or VH.37 and any S2V29 VL disclosed herein, such as the S2V29 parental VL (also known as VL.1) or VL.2.

[0170] In some embodiments, the antibody or antigen-binding fragment comprises a VH, which comprises, is substantially composed of, or is composed of an amino acid sequence according to any one of SEQ ID NO: 166, 170, 174, 179, 182, or 184.

[0171] In some embodiments, the antibody or antigen-binding fragment comprises a VH, which contains, is substantially composed of, or is composed of the amino acid sequence according to any one of SEQ ID NO: 184 and 187 to 202. In a more specific embodiment, the substitutions in SEQ ID NO: 188 and 193 are conserved substitutions. In a further embodiment, the antibody or antigen-binding fragment may comprise a VL, which contains, is substantially composed of, or is composed of the amino acid sequence according to SEQ ID NO: 113.

[0172] In some embodiments, an antibody or antigen-binding fragment comprising VH and VL is provided, wherein the VH comprises, substantially constitutes, or is composed of, any one of the amino acid sequences according to SEQ ID NO: 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, and 184, and the VL comprises, substantially constitutes, or is composed of, any one of the amino acid sequences according to SEQ ID NO: 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163. In some embodiments, the antibody may not comprise both the VH consisting of the amino acid sequence according to SEQ ID NO: 67 and the VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0173] In some embodiments, an antibody or antigen-binding fragment comprising VH and VL is provided, wherein the VH comprises, is substantially composed of, or is composed of, any one of SEQ ID NO: 166, 170, 174, 179, 182, and 184, and the VL comprises, is substantially composed of, or is composed of, any one of SEQ ID NO: 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163, or is composed of, any one of SEQ ID NO: 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163.

[0174] In some embodiments, an antibody or antigen-binding fragment comprising VH and VL is provided, wherein VH and VL comprise, substantially comprise, or consist of the amino acid sequences according to SEQ ID NO: 1) 166 and 113, 2) 170 and 113, 3) 174 and 113, 4) 177 and 113, 5) 179 and 113, 6) 182 and 113 or 7) 184 and 113.

[0175] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH contains the amino acid sequence according to SEQ ID NO: 184, and VL contains the amino acid sequence according to SEQ ID NO: 113.

[0176] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH contains the amino acid sequence according to SEQ ID NO: 184, and VL consists essentially of the amino acid sequence according to SEQ ID NO: 113.

[0177] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH comprises the amino acid sequence according to SEQ ID NO: 184, and VL consists of the amino acid sequence according to SEQ ID NO: 113.

[0178] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH consists essentially of the amino acid sequence according to SEQ ID NO: 184, and VL contains the amino acid sequence according to SEQ ID NO: 113.

[0179] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH consists essentially of the amino acid sequence according to SEQ ID NO: 184, and VL consists essentially of the amino acid sequence according to SEQ ID NO: 113.

[0180] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH consists essentially of the amino acid sequence according to SEQ ID NO: 184, and VL consists of the amino acid sequence according to SEQ ID NO: 113.

[0181] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH consists of the amino acid sequence according to SEQ ID NO: 184, and VL contains the amino acid sequence according to SEQ ID NO: 113.

[0182] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH consists of the amino acid sequence according to SEQ ID NO: 184, and VL consists essentially of the amino acid sequence according to SEQ ID NO: 113.

[0183] In some embodiments, the antibody or antigen-binding fragment is the S2V29-v37.2 antibody or antigen-binding fragment, and VH consists of the amino acid sequence according to SEQ ID NO: 184, and VL consists of the amino acid sequence according to SEQ ID NO: 113.

[0184] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and VH comprises, is substantially composed of, or is composed of an amino acid sequence according to one of SEQ ID NO: 187 to 202, and VL comprises, is substantially composed of, or is composed of an amino acid sequence according to SEQ ID NO: 113.

[0185] In some embodiments, an antibody or antigen-binding fragment comprising a CDR identified in a VH sequence according to any one of SEQ ID NO: 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, and 184 and in a VL sequence according to any one of SEQ ID NO: 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163 is provided, as determined using any known CDR numbering method, including Kabat, Chothia, EU, IMGT, Martin (enhanced Chothia), Contact, and AHo numbering methods, or combinations of two or more of these. In some embodiments, the CDR is based on an antibody numbering method developed by the Chemical Computing Group (CCG); for example, using the Molecular Operational Environment (MOE) software (www.chemcomp.com). In some embodiments, the CDR is based on the IMGT numbering method.

[0186] In some embodiments, an antibody or antigen-binding fragment of the CDR, identified in the VH sequence of any one of SEQ ID NOs: 166, 170, 174, 179, 182, and 184 and in the VL sequence of any one of SEQ ID NOs: 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163, is provided, as determined using any known CDR numbering method, including Kabat, Chothia, EU, IMGT, Martin (enhanced Chothia), Contact, and AHo numbering methods, or combinations of two or more of these. In some embodiments, the CDR is based on an antibody numbering method developed by the Chemical Computing Group (CCG); for example, using Molecular Operational Environment (MOE) software (www.chemcomp.com). In some embodiments, the CDR is based on the IMGT numbering method. In some embodiments, the antibody may not contain either VH, which consists of the amino acid sequence according to SEQ ID NO: 67, or VL, which consists of the amino acid sequence according to SEQ ID NO: 71.

[0187] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises, for example, three CDRs identified in the VH sequence according to SEQ ID NO: 184 and, for example, three CDRs identified in the VL sequence according to SEQ ID NO: 113, as determined using any known CDR numbering method, including Kabat, Chothia, EU, IMGT, Martin (enhanced Chothia), Contact, and AHo numbering methods, or combinations of two or more of these. In some embodiments, the CDRs are based on antibody numbering methods developed by the Chemical Computing Group (CCG); for example, using Molecular Operational Environment (MOE) software (www.chemcomp.com). In some embodiments, the CDRs are based on the IMGT numbering method. In some embodiments, the antibody is capable of not comprising both the VH consisting of the amino acid sequence according to SEQ ID NO: 67 and the VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0188] In some embodiments, an antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) containing CDRH1, CDRH2, and CDRH3 and a light chain variable domain (VL) containing CDRL1, CDRL2, and CDRL3 is provided, wherein: (i) CDRH1 comprises or consists of an amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof comprising one, two, or three acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions for germline-encoded amino acids; (ii) CDRH2 comprises or consists of an amino acid sequence according to any one of SEQ ID NO: 69, 82, 85, 88, 91, 94, 98, 102, 106, 110, 140, 167, 171, 175, and 180 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions for germline-encoded amino acids; (iii) CDRH3 comprises or consists of an amino acid sequence according to SEQ ID NO: 69, 82, 85, 88, 91, 94, 98, 102, 106, 110, 140, 167, 171, 175, and 180 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions for germline-encoded amino acids; and (iii) CDRH3 comprises or consists of an amino acid sequence according to SEQ ID NO: 69, 82, 85, 88, 91, 94, 98, 102, 106, 110, 140, 167, 171, 175, and 180. (iv) CDRL1 comprises or consists of an amino acid sequence according to SEQ ID NO: 70, 95, 99, 103, 111, 168, and 172, or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; (v) CDRL2 comprises or consists of an amino acid sequence according to SEQ ID NO: 73, 147, and 160, or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; and / or (vi) CDRL3 comprises or consists of an amino acid sequence according to SEQ ID NO: 73, 147, and 160, or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; and / or CDRL3 comprises or consists of an amino acid sequence according to SEQ ID NO: 73, 147, and 160. The amino acid sequence of any one of NO: 74, 78, 114, 117, 120, 123, 126, 148, 153, 157, 161, and 164, or a sequence variant thereof comprising or consisting of one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more, or two or more, surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody is capable of not comprising both VH consisting of the amino acid sequence according to SEQ ID NO: 67 and VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0189] In some embodiments, an antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) containing CDRH1, CDRH2, and CDRH3 and a light chain variable domain (VL) containing CDRL1, CDRL2, and CDRL3 is provided, wherein: (i) CDRH1 comprises or consists of an amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof comprising one, two, or three acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions for germline-encoded amino acids; (ii) CDRH2 comprises or consists of an amino acid sequence according to any one of SEQ ID NO: 167, 171, 175, and 180 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions for germline-encoded amino acids; (iii) CDRH3 comprises or consists of an amino acid sequence according to SEQ ID NO: (iv) CDRL1 comprises or consists of an amino acid sequence according to SEQ ID NO: 70, 168, and 172, or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; (v) CDRL2 comprises or consists of an amino acid sequence according to SEQ ID NO: 73, 147, and 160, or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; and / or (vi) CDRL3 comprises or consists of an amino acid sequence according to SEQ ID NO: The antibody or antigen-binding fragment may contain or be composed of any of the amino acid sequences of 74, 78, 114, 117, 120, 123, 126, 148, 153, 157, 161, and 164, or a sequence variant thereof comprising or consisting of one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more, or two or more, surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody may not contain either VH, which consists of the amino acid sequence according to SEQ ID NO: 67, or VL, which consists of the amino acid sequence according to SEQ ID NO: 71.

[0190] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises an antibody or antigen-binding fragment containing heavy chain variable domains (VH) of CDRH1, CDRH2, and CDRH3 and light chain variable domains (VL) of CDRL1, CDRL2, and CDRL3, wherein: (i) CDRH1 comprises, substantially comprises, or consists of the amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof containing one, two, or three acid substitutions, and one or more of these substitutions are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (ii) CDRH2 comprises, substantially comprises, or consists of the amino acid sequence according to SEQ ID NO: 171 or a sequence variant thereof containing one, two, or three amino acid substitutions, and one or more of these substitutions are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (iii) CDRH3 comprises, substantially comprises, or consists of the amino acid sequence according to SEQ ID NO: 171. (iv) CDRL1 comprises the amino acid sequence according to SEQ ID NO: 72 or a sequence variant thereof containing one, two, or three amino acid substitutions, substantially composed of or consisting of, one or more of these substitutions optionally being conserved substitutions and / or substitutions for germline-encoded amino acids; (v) CDRL2 comprises the amino acid sequence according to SEQ ID NO: 73 or a sequence variant thereof containing one, two, or three amino acid substitutions, substantially composed of or consisting of, one or more of these substitutions optionally being conserved substitutions and / or substitutions for germline-encoded amino acids; and / or (vi) CDRL3 comprises the amino acid sequence according to SEQ ID NO: The amino acid sequence of SEQ ID NO: 67 or a sequence variant thereof comprising, substantially comprising, or comprising the amino acid sequence of SEQ ID NO: 71, wherein one or more of these substitutions are optionally conserved substitutions and / or substitutions for germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody is capable of omitting both VH, which consists of the amino acid sequence according to SEQ ID NO: 67, and VL, which consists of the amino acid sequence according to SEQ ID NO: 71.

[0191] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises an antibody or antigen-binding fragment containing heavy chain variable domains (VH) of CDRH1, CDRH2, and CDRH3 and light chain variable domains (VL) of CDRL1, CDRL2, and CDRL3, wherein: (i) CDRH1 comprises or consists of an amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof containing one, two, or three acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions of germline-encoded amino acids; (ii) CDRH2 comprises or consists of an amino acid sequence according to SEQ ID NO: 171 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions of germline-encoded amino acids; (iii) CDRH3 comprises or consists of an amino acid sequence according to SEQ ID NO: 171. (iv) CDRL1 comprises or consists of the amino acid sequence according to SEQ ID NO: 72 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; (v) CDRL2 comprises or consists of the amino acid sequence according to SEQ ID NO: 73 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; and / or (vi) CDRL3 comprises or consists of the amino acid sequence according to SEQ ID NO: 114 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody may not contain either VH, which consists of the amino acid sequence according to SEQ ID NO: 67, or VL, which consists of the amino acid sequence according to SEQ ID NO: 71.

[0192] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises an antibody or antigen-binding fragment containing heavy chain variable domains (VH) of CDRH1, CDRH2, and CDRH3 and light chain variable domains (VL) of CDRL1, CDRL2, and CDRL3, wherein: (i) CDRH1 comprises the amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof comprising one, two, or three acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (ii) CDRH2 comprises the amino acid sequence according to SEQ ID NO: 171 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (iii) CDRH3 comprises the amino acid sequence according to SEQ ID NO: 70 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (iv) CDRL1 comprises the amino acid sequence according to SEQ ID NO: 72 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; (v) CDRL2 comprises the amino acid sequence according to SEQ ID NO: 73 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; and / or (vi) CDRL3 comprises the amino acid sequence according to SEQ ID NO: 114 or a sequence variant thereof comprising one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more, or two or more, surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody is capable of not comprising both VH, consisting of the amino acid sequence according to SEQ ID NO: 67, and VL, consisting of the amino acid sequence according to SEQ ID NO: 71.

[0193] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises an antibody or antigen-binding fragment containing heavy chain variable domains (VH) of CDRH1, CDRH2, and CDRH3 and light chain variable domains (VL) of CDRL1, CDRL2, and CDRL3, wherein: (i) CDRH1 consists essentially of the amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof containing one, two, or three acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (ii) CDRH2 consists essentially of the amino acid sequence according to SEQ ID NO: 171 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (iii) CDRH3 consists essentially of the amino acid sequence according to SEQ ID NO: (iv) CDRL1 is essentially composed of the amino acid sequence according to SEQ ID NO: 72 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; (v) CDRL2 is essentially composed of the amino acid sequence according to SEQ ID NO: 73 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids; and / or (vi) CDRL3 is essentially composed of the amino acid sequence according to SEQ ID NO: 114 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions for germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody may not contain either VH, which consists of the amino acid sequence according to SEQ ID NO: 67, or VL, which consists of the amino acid sequence according to SEQ ID NO: 71.

[0194] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises an antibody or antigen-binding fragment containing heavy chain variable domains (VH) of CDRH1, CDRH2, and CDRH3 and light chain variable domains (VL) of CDRL1, CDRL2, and CDRL3, wherein: (i) CDRH1 consists of the amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof containing one, two, or three acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (ii) CDRH2 consists of the amino acid sequence according to SEQ ID NO: 171 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (iii) CDRH3 consists of the amino acid sequence according to SEQ ID NO: 171. (iv) CDRL1 consists of the amino acid sequence of SEQ ID NO: 72 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (v) CDRL2 consists of the amino acid sequence of SEQ ID NO: 73 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; and / or (vi) CDRL3 consists of the amino acid sequence of SEQ ID NO: 114 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody may not contain either a VH consisting of the amino acid sequence according to SEQ ID NO: 67 or a VL consisting of the amino acid sequence according to SEQ ID NO: 71. In some embodiments, the antibody or antigen-binding fragment VH may contain one or more amino acid sequences according to SEQ ID NO: 207 to 210 and 215 to 221. In some embodiments, the antibody or antigen-binding fragment VL may contain one or more amino acid sequences according to SEQ ID NO: 211 to 214 and 222 to 224.

[0195] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises an antibody or antigen-binding fragment containing a heavy chain variable domain (VH) of CDRH1, CDRH2 and CDRH3 and a light chain variable domain (VL) of CDRL1, CDRL2 and CDRL3, wherein: (i) CDRH1 consists of the amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof containing one, two or three acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (ii) CDRH2 consists of the amino acid sequence according to SEQ ID NO: 215 or a sequence variant thereof containing one, two or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (iii) CDRH3 consists of the amino acid sequence according to SEQ ID NO: 215. (iv) CDRL1 consists of the amino acid sequence of SEQ ID NO: 72 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (v) CDRL2 consists of the amino acid sequence of SEQ ID NO: 73 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; and / or (vi) CDRL3 consists of the amino acid sequence of SEQ ID NO: 114 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody may not contain either a VH consisting of the amino acid sequence according to SEQ ID NO: 67 or a VL consisting of the amino acid sequence according to SEQ ID NO: 71. In some embodiments, the antibody or antigen-binding fragment VH may contain one or more amino acid sequences according to SEQ ID NO: 207 to 210 and 216 to 221. In some embodiments, the antibody or antigen-binding fragment VL may contain one or more amino acid sequences according to SEQ ID NO: 211 to 214 and 222 to 224.

[0196] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises an antibody or antigen-binding fragment containing a heavy chain variable domain (VH) of CDRH1, CDRH2 and CDRH3 and a light chain variable domain (VL) of CDRL1, CDRL2 and CDRL3, wherein: (i) CDRH1 consists of the amino acid sequence according to SEQ ID NO: 68 or a sequence variant thereof containing one, two or three acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions of germline-encoded amino acids; (ii) CDRH2 consists of the amino acid sequence according to SEQ ID NO: 216 or a sequence variant thereof containing one, two or three amino acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions of germline-encoded amino acids; (iii) CDRH3 consists of the amino acid sequence according to SEQ ID NO: 216 or a sequence variant thereof containing one, two or three amino acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions of germline-encoded amino acids; and (iii) CDRH3 consists of the amino acid sequence according to SEQ ID NO: 216 or a sequence variant thereof containing one, two or three amino acid substitutions, one or more of these substitutions optionally being conserved substitutions and / or substitutions of germline-encoded amino acids. (iv) CDRL1 consists of the amino acid sequence of SEQ ID NO: 72 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; (v) CDRL2 consists of the amino acid sequence of SEQ ID NO: 73 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids; and / or (vi) CDRL3 consists of the amino acid sequence of SEQ ID NO: 114 or a sequence variant thereof containing one, two, or three amino acid substitutions, one or more of which are optionally conserved substitutions and / or substitutions of germline-encoded amino acids, wherein the antibody or antigen-binding fragment is capable of binding to one or more surface glycoproteins of sabevir expressed on the cell surface of a host cell. In some embodiments, the antibody may not contain either a VH consisting of the amino acid sequence according to SEQ ID NO: 67 or a VL consisting of the amino acid sequence according to SEQ ID NO: 71. In some embodiments, the antibody or antigen-binding fragment VH may contain one or more amino acid sequences according to SEQ ID NO: 207 to 210 and 217 to 221. In some embodiments, the antibody or antigen-binding fragment VL may contain one or more amino acid sequences according to SEQ ID NO: 211 to 214 and 222 to 224.

[0197] In some embodiments, the antibody or antigen-binding fragment comprises amino acid sequences according to the following: CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3, respectively: SEQ ID NO: 1) 68, 167, 168, 72, 73, and 114; 2) 68, 171, 172, 72, 73, and 114; 3) 68, 175, 172, 72, 73, and 114; 4) 68, 180, 172, 72, 73, and 114; 5) 68, 180, 70, 72, 73, and 114; or 6) 68, 171, 70, 72, 73, and 114.

[0198] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises the amino acid sequences CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 according to SEQ ID NO: 68, 171, 70, 72, 73, and 114, respectively. In some embodiments, the antibody or antigen-binding fragment VH may comprise the amino acid sequences according to one or more of SEQ ID NO: 207 to 210 and 215 to 221. In some embodiments, the antibody or antigen-binding fragment VL may comprise the amino acid sequences according to one or more of SEQ ID NO: 211 to 214 and 222 to 224.

[0199] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises a VH or VL containing SEQ ID NO: 184 and 113, respectively, or a VH or VL having at least 85%, 90%, or 95% identity with these sequences. In some embodiments, a VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, a VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may consist substantially of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, a VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may consist of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221, and further comprises an amino acid sequence of SEQ ID NO: 207 to 210, wherein the VH may comprise SEQ ID NO: 215 to 221 in some embodiments. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221.In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise amino acid sequences of one or more of SEQ ID NO: 222 to 224, and further comprise amino acid sequences of SEQ ID NO: 211 to 214, wherein the VH may comprise SEQ ID NO: 222 to 224 in some embodiments. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences of SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences of one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214, and further still comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224.In some embodiments, the antibody may not contain either VH, which consists of the amino acid sequence according to SEQ ID NO: 67, or VL, which consists of the amino acid sequence according to SEQ ID NO: 71.

[0200] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises a VH or VL consisting substantially of SEQ ID NO: 184 and 113, respectively, or a VH or VL having at least 85%, 90%, or 95% identity with these sequences. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may consist substantially of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may consist of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221, and further comprises an amino acid sequence of SEQ ID NO: 207 to 210, wherein the VH may comprise SEQ ID NO: 215 to 221 in some embodiments. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221.In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise amino acid sequences of one or more of SEQ ID NO: 222 to 224, and further comprise amino acid sequences of SEQ ID NO: 211 to 214, wherein the VH may comprise SEQ ID NO: 222 to 224 in some embodiments. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences of SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences of one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214, and further still comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224.In some embodiments, the antibody may not contain either VH, which consists of the amino acid sequence according to SEQ ID NO: 67, or VL, which consists of the amino acid sequence according to SEQ ID NO: 71.

[0201] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises a VH or VL consisting of SEQ ID NO: 184 and 113, respectively, or a VH or VL having at least 85%, 90%, or 95% identity with these sequences. In some embodiments, a VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, a VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may consist substantially of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, a VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may consist of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221, and further comprises an amino acid sequence of SEQ ID NO: 207 to 210, wherein the VH may comprise SEQ ID NO: 215 to 221 in some embodiments. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221.In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise amino acid sequences of one or more of SEQ ID NO: 222 to 224, and further comprise amino acid sequences of SEQ ID NO: 211 to 214, wherein the VH may comprise SEQ ID NO: 222 to 224 in some embodiments. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences of SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences of one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214, and further still comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224.In some embodiments, the antibody may not contain either VH, which consists of the amino acid sequence according to SEQ ID NO: 67, or VL, which consists of the amino acid sequence according to SEQ ID NO: 71.

[0202] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 according to SEQ ID NO: 68, 171, 70, 72, 73, and 114, respectively, and a VH comprising, substantially comprising, or composed of the amino acid sequences according to any one of SEQ ID NO: 184 to 202. The antibody or antigen-binding fragment may further comprise a VL, which may comprise, substantially comprise, or consist of the amino acid sequence according to SEQ ID NO: 113, or have at least 85%, 90%, or 95% identity with SEQ ID NO: 113. In some embodiments, a VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the amino acid sequences according to one or more of SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise an amino acid sequence according to one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise an amino acid sequence according to one or more of SEQ ID NO: 222 to 224, and further comprises an amino acid sequence according to SEQ ID NO: 211 to 214, wherein the VH may comprise SEQ ID NO: 222 to 224 in some embodiments. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprises an amino acid sequence according to one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224.In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise one or more amino acid sequences according to SEQ ID NO: 211 to 214, and further comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the antibody is capable of not comprising both the VH consisting of the amino acid sequence according to SEQ ID NO: 67 and the VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0203] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises the amino acid sequences of CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 according to SEQ ID NO: 68, 171, 70, 72, 73, and 114, respectively, and a VH comprising the amino acid sequence according to any one of SEQ ID NO: 214 to 221. The VH may further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and in some embodiments may comprise SEQ ID NO: 222 to 224. The antibody or antigen-binding fragment may further comprise a VL, which may comprise, consist substantially of, or be composed of the amino acid sequence according to SEQ ID NO: 113, or have at least 85%, 90%, or 95% identity with SEQ ID NO: 113. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise an amino acid sequence of one or more of SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise an amino acid sequence of one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise an amino acid sequence of one or more of SEQ ID NO: 222 to 224, and further comprises an amino acid sequence of SEQ ID NO: 211 to 214, wherein the VH may comprise SEQ ID NO: 222 to 224 in some embodiments. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224.In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise one or more amino acid sequences according to SEQ ID NO: 211 to 214, and further comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the antibody is capable of not comprising both the VH consisting of the amino acid sequence according to SEQ ID NO: 67 and the VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0204] It should be understood, for example, that production in mammalian cell lines can remove one or more C-terminal lysine residues from the antibody heavy chain (see, for example, Liu et al.) mAbs 6 (5): 1145-1154 (2014)). Therefore, the antibody or antigen-binding fragments of this disclosure may comprise heavy chains, CH1-CH3, CH3, or Fc polypeptides, wherein a C-terminal lysine residue may or may not be present; in other words, embodiments comprising heavy chains, CH1-CH3, or Fc polypeptides where the C-terminal residue is not lysine, and embodiments where lysine is a C-terminal residue. In some embodiments, the composition comprises a variety of antibody and / or antigen-binding fragments of this disclosure, wherein one or more antibody or antigen-binding fragments do not contain a lysine residue at the C-terminus of the heavy chain, CH1-CH3, or Fc polypeptide, and wherein one or more antibody or antigen-binding fragments contain a lysine residue at the C-terminus of the heavy chain, CH1-CH3, or Fc polypeptide.

[0205] A “Fab” (antigen-binding fragment) is the part of an antibody that binds to an antigen and contains a variable region of a heavy chain linked to a light chain via interchain disulfide bonds and a CH1 region. Each Fab fragment is monovalent with respect to antigen binding, i.e., it has a single antigen-binding site. Pepsin treatment of an antibody produces a single large F(ab')2 fragment, which roughly corresponds to two disulfide-linked Fab fragments with bivalent antigen-binding activity and is still capable of crosslinking the antigen. Both Fab and F(ab')2 are examples of “antigen-binding fragments.” A Fab' fragment differs from a Fab fragment in that it has several additional residues at the carboxyl terminus of the CH1 domain, including one or more cysteine ​​residues from the antibody hinge region. Fab'-SH is the name of a Fab' with cysteine ​​residues in the constant domain having a free thiol group. The F(ab')2 antibody fragment was originally produced as a pair of Fab' fragments with a hinge cysteine ​​residue in between. Other chemical conjugations of antibody fragments are also known.

[0206] Fab fragments can be linked, for example, via peptide linkers to form single-chain Fabs, also referred to herein as “scFabs”. In these embodiments, the interchain disulfide bonds present in native Fabs may be absent, and the linker is used entirely or partially to link or connect Fab fragments within a single polypeptide chain. Heavy-chain derived Fab fragments (e.g., comprising, consisting of, or substantially comprising VH+CH1 or “Fd”) and light-chain derived Fab fragments (e.g., comprising, consisting of, or substantially comprising VL+CL) can be linked in any arrangement to form scFabs. For example, scFabs can be arranged in the N-terminal to C-terminal direction according to (heavy-chain Fab fragment – ​​linker – light-chain Fab fragment) or (light-chain Fab fragment – ​​linker – heavy-chain Fab fragment). Peptide linkers and exemplary linker sequences for scFabs are discussed in further detail herein.

[0207] "Fv" is a small antibody fragment containing both an intact antigen recognition and binding site. This fragment typically consists of a dimer of a tightly non-covalently associated heavy chain variable region domain and a light chain variable region domain. However, even a single variable domain (or half of an Fv containing only three CDRs specific to the antigen) can recognize and bind to an antigen, but typically with lower affinity than the intact binding site.

[0208] "Single-chain Fv", also abbreviated as "sFv" or "scFv", is a type of Fv containing V chains linked together to form a single polypeptide chain. H and V L Antibody fragments containing antibody domains. In some embodiments, the scFv peptide contains an antibody domain set in V. H With V LThe peptide linker between and connecting these domains enables the scFv to retain or form the desired antigen-binding structure. This peptide linker can be incorporated into the fusion peptide using standard techniques well-known in the art. For a review of scFv, see Pluckthun, *The Pharmacology of Monoclonal Antibodies*, Vol. 113, edited by Rosenburg and Moore, Springer-Verlag, New York, pp. 269–315 (1994); Borrebaeck 1995, see below. In some embodiments, the antibody or antigen-binding fragment includes an scFv comprising a VH domain, a VL domain, and a peptide linker connecting the VH domain to the VL domain. In a particular embodiment, the scFv comprises a VH domain linked to the VL domain via a peptide linker, which may be in a VH-linker-VL orientation or a VL-linker-VH orientation. Any scFv disclosed herein can be engineered such that the C-terminus of the VL domain is linked to the N-terminus of the VH domain via a short peptide sequence, or vice versa (i.e., (N)VL(C)-linker-(N)VH(C) or (N)VH(C)-linker-(N)VL(C)). Alternatively, in some embodiments, the linker may be linked to the N-terminal portion or N-terminus of the VH domain, the VL domain, or both.

[0209] Peptide linker sequences may be selected, for example, based on: (1) their ability to take a flexible, extended conformation; (2) their inability or inability to take a secondary structure that can interact with functional epitopes on the first and second peptides and / or the target molecule; and / or (3) their lack or relative lack of hydrophobic or charged residues that may react with the peptide and / or the target molecule. Other considerations regarding linker design (e.g., length) may include the conformation or conformational range of VH and VL that can form functional antigen-binding sites. In some embodiments, the peptide linker sequence contains, for example, Gly, Asn, and Ser residues. Other near-neutral amino acids, such as Thr and Ala, may also be included in the linker sequence. Other amino acid sequences that can be effectively used as linkers include those disclosed in the following literature: Maratea et al., Gene 40:39 46 (1985); Murphy et al., Proc. Natl. Acad. Sci. USA 83:8258 8262 (1986); U.S. Patent Nos. 4,935,233 and 4,751,180. Other exemplary and non-limiting examples of the connector, when present in a single iteration or repeated 1 to 5 times or more, may include, for example, Glu-Gly-Lys-Ser-Ser-Gly-Ser-Gly-Ser-Glu-Ser-Lys-Val-Asp (SEQ ID NO: 19) (Chaudhary et al., Proc.Natl.Acad.Sci.USA 87:1066-1070 (1990)) and Lys-Glu-Ser-Gly-Ser-Val-Ser-Ser-Glu-Gln-Leu-Ala-Gln-Phe-Arg-Ser-Leu-Asp (SEQ ID NO: 20) (Bird et al., Science 242:423-426 (1988)) and the pentamer Gly-Gly-Gly-Gly-Ser (SEQ ID NO: 21). Any suitable linker may be used, and generally, its length may be about 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 40, 50, 60, 70, 80, 90, or 100 amino acids, or less than about 200 amino acids. It will preferably have a flexible structure (providing flexibility and space for conformational movement between two regions, domains, motifs, segments, or modules connected by the linker), and will preferably be bioinert and / or have a low risk of immunogenicity in the human body. Exemplary linkers include those comprising or composed of any one or more amino acid sequences according to SEQ ID NO: 4 to 13 and 251 to 252.In some embodiments, the adapter comprises or consists of an amino acid sequence having at least 75% (e.g., 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or higher) identity with an amino acid sequence according to any one of SEQ ID NO: 4 to 13 and 251 to 252.

[0210] scFv can be constructed using any combination of the VH and VL sequences disclosed herein or any combination of the CDRH1, CDRH2 or CDRH2 regions, CDRH3, CDRL1, CDRL2 and CDRL3 sequences.

[0211] In some implementations, a linker sequence is not required; for example, when the first and second polypeptides have non-essential N-terminal (or C-terminal) amino acid regions that can be used to separate functional domains and prevent stereointerference.

[0212] During antibody development, DNA in the germline variable region (V), linker region (J), and diversity region (D) loci can be rearranged, and insertions and / or deletions of nucleotides in the coding sequences can occur. Somatic mutations can be encoded by the resulting sequences and can be identified by referring to corresponding known germline sequences. In some contexts, somatic mutations that are not important to the desired properties of the antibody (e.g., binding to the SARS-CoV-2 antigen) or that confer undesirable properties to the antibody (e.g., an increased risk of immunogenicity in subjects administered the antibody), or both, can be replaced by corresponding germline-coded amino acids or different amino acids, such that the desired properties of the antibody are improved or maintained, and the undesirable properties of the antibody are reduced or eliminated. Therefore, in some embodiments, the antibody or antigen-binding fragment of this disclosure contains one or more germline-coded amino acids in the variable region compared to the parent antibody or antigen-binding fragment, provided that the parent antibody or antigen-binding fragment contains one or more somatic mutations. Exemplary anti-sabine virus antibodies of this disclosure have variable region and CDR amino acid sequences in Tables 2, 3, and 4 herein.

[0213] In some implementations, the antibody or antigen-binding fragment contains amino acid modifications (e.g., substitution mutations) to eliminate unwanted risks of oxidation, deamidation, and / or isomerization.

[0214] This article provides variant antibodies and antigen-binding fragments that contain one or more amino acid alterations in the variable region (e.g., VH, VL, frame, or CDR) compared to currently disclosed S2V29 antibodies (especially S2V29-v37.2 antibodies), wherein the variant antibody or antigen-binding fragment is capable of binding to the SARS-CoV-2 antigen.

[0215] In some embodiments, (i) VH comprises, is substantially composed of, or is composed of an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 97%, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, or 184) identity with, the amino acid sequence according to SEQ ID NO: 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, or 184, wherein the variation is optionally limited to one or more frame regions and / or the variation comprises one or more substitutions for germline-encoded amino acids; and / or (ii) VL comprises an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with, the amino acid sequence according to SEQ ID NO: 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, or 184, wherein the amino acid sequence according to SEQ ID NO: 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, The amino acid sequences 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, or 163 have at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid identity, are substantially composed of, or are composed of, these sequences, wherein the variation is optionally limited to one or more frame regions and / or the variation comprises one or more substitutions for germline-encoded amino acids. In some embodiments, the antibody is capable of not containing either a VH consisting of the amino acid sequence according to SEQ ID NO: 67 or a VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0216] In some embodiments, (i) VH comprises, is substantially composed of, or is composed of an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 166, 170, 174, 179, 182, or 184, wherein the variation is optionally limited to one or more frame regions and / or the variation comprises one or more substitutions for germline-encoded amino acids; and / or (ii) VL comprises an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 166, 170, 174, 179, 182, or 184, wherein the variation is substantially composed of ... The amino acid sequences 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, or 163 have at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid identity, are substantially composed of, or are composed of, these sequences, wherein the variation is optionally limited to one or more frame regions and / or the variation comprises one or more substitutions for germline-encoded amino acids. In some embodiments, the antibody is capable of not containing either a VH consisting of the amino acid sequence according to SEQ ID NO: 67 or a VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0217] In some embodiments, (i) VH comprises, is substantially composed of, or is composed of an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 166, 170, 174, 179, 182, or 184, wherein the variation is optionally limited to one or more frame regions and / or the variation comprises one or more substitutions for germline-encoded amino acids; and / or (ii) VL comprises an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 166, 170, 174, 179, 182, or 184, wherein the variation is substantially composed of ... The amino acid sequence of 113 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity, is substantially composed of, or is composed of, it, wherein the variation is optionally limited to one or more frame regions and / or the variation comprises one or more substitutions for germline-encoded amino acids. In some embodiments, the antibody is capable of not containing either VH, which is composed of the amino acid sequence according to SEQ ID NO: 67, or VL, which is composed of the amino acid sequence according to SEQ ID NO: 71.

[0218] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and (i) VH comprises, is substantially composed of, or is composed of an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 184, wherein the variation is optionally limited to one or more frame regions and / or the variation comprises one or more substitutions for germline-encoded amino acids; and / or (ii) VL comprises, is substantially composed of, an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 184, wherein the variation is substantially composed of, or is composed of, an ... The amino acid sequence of 113 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity, is substantially composed of, or is composed of, it, wherein the variation is optionally limited to one or more frame regions and / or the variation comprises one or more substitutions for germline-encoded amino acids. In some embodiments, the antibody is capable of not containing either VH, which is composed of the amino acid sequence according to SEQ ID NO: 67, or VL, which is composed of the amino acid sequence according to SEQ ID NO: 71.

[0219] In some embodiments, VH comprises the amino acid sequence according to any one of SEQ ID NO: 187 to 201, particularly SEQ ID NO: 188 or 193. In some embodiments, variations of VH comprise, for example... Figure 15 The N57 substitution exemplified in the diagram maintains the salt bridge at K460 of the SARS-CoV-2 S protein, particularly the acidic amino acid substitution according to SEQ ID NO: 194 or 188. In some embodiments, the VH variation comprises an N57D substitution and a V50 substitution according to any one of SEQ ID NO: 199 to 202. In some embodiments, the VH variation comprises as follows: Figure 15 The V50 substitutions exemplified herein are responsible for maintaining the ability of amino acids 455 and 456 of the S protein to support the contact, particularly the aromatic amino acid substitutions according to SEQ ID NO: 189 or 200. In some embodiments, variations of VH include V50Y substitutions and N57 substitutions according to any one of SEQ ID NO: 196 to 198.

[0220] The term "CL" refers to the "immunoglobulin light chain constant region," "light chain constant region," or "light chain constant domain," i.e., the constant region derived from the antibody light chain. The term "CH" refers to the "immunoglobulin heavy chain constant region," "heavy chain constant region," or "heavy chain constant domain," which, depending on the antibody isotype, can be further divided into CH1, CH2, and CH3 (IgA, IgD, IgG) or CH1, CH2, CH3, and CH4 domains (IgE, IgM). The Fc portion of the antibody heavy chain is further described herein. In any embodiment of the currently disclosed embodiments, the antibody or antigen-binding fragment of this disclosure comprises any one or more of CL, CH1, CH2, and CH3.

[0221] In some embodiments, the antibody or antigen-binding fragment comprises (e.g., human) IgG (e.g., IgG1, IgG2, IgG3, or IgG4), IgA, IgD, IgE, or IgM isotypes, or comprises amino acid sequences from two or more of these isotypes. In some embodiments, the antibody or antigen-binding fragment comprises the IgG1 isotype; it should be understood that such an antibody or antigen-binding fragment may contain one or more amino acid substitutions in the heavy chain constant domain and is still considered the "IgG1" isotype. In some embodiments, IgG1 may comprise, or comprise, an amino acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with, or comprise, the amino acid sequence of or composed of the amino acid sequence of SEQ ID NO: 30 to 66.

[0222] Any of these antibody or antigen-binding fragments may include Fc modification as described herein, or may have an unmodified human IgG1 constant region.

[0223] Specifically, the antibody or antigen-binding fragment may be an S2V29-v37.2 or a variant thereof, and has a VH comprising, substantially consisting of, or consisting of, the amino acid sequence according to SEQ ID NO: 184, or having at least 85%, 90%, or 95% identity with SEQ ID NO: 184; a CH comprising, substantially consisting of, or consisting of, the amino acid sequence according to any one of SEQ ID NO: 30 to 66, particularly SEQ ID NO: 49; a VL comprising, substantially consisting of, or consisting of, the amino acid sequence according to SEQ ID NO: 113, or having at least 85%, 90%, or 95% identity with SEQ ID NO: 113; and a CL comprising, substantially consisting of, or consisting of, the amino acid sequence according to SEQ ID NO: 186. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may consist substantially of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may consist of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence according to one or more of SEQ ID NO: 215 to 221. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221, and further comprises an amino acid sequence of SEQ ID NO: 207 to 210, wherein the VH may comprise SEQ ID NO: 215 to 221 in some embodiments.In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the VH having at least 85%, 90%, or 95% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise amino acid sequences of one or more of SEQ ID NO: 222 to 224, and further comprise amino acid sequences of SEQ ID NO: 211 to 214, wherein the VH in some embodiments may comprise SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences of SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences of one or more of SEQ ID NO: 211 to 214.In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85%, 90%, or 95% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise one or more amino acid sequences according to SEQ ID NO: 211 to 214, and further comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the antibody may not comprise either the VH consisting of the amino acid sequence according to SEQ ID NO: 67 or the VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0224] In some embodiments, the S2V29-v37.2 or its variant antibody or antigen-binding fragment may comprise, substantially consist of, or consist of, two identical polypeptides containing VH and CH as described above. In some embodiments, the S2V29-v37.2 or its variant antibody or antigen-binding fragment may comprise, substantially consist of, or consist of, two identical polypeptides containing VH and CH as described above, substantially consist of, or consist of, two identical polypeptides containing VL and CL as described above, substantially consist of, or consist of, two identical polypeptides containing, substantially consist of, or consist of, VH and CH as described above. In some embodiments, the amino acid sequences of VH, CH, CL and / or VL may have at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identity with the amino acid sequences identified above.

[0225] In a more specific embodiment, the antibody or antigen-binding fragment may be an S2V29-v37.2 or a variant thereof, and has a VH comprising the amino acid sequence according to SEQ ID NO: 184, a CH comprising the amino acid sequence according to any one of SEQ ID NO: 44 to 80, particularly SEQ ID NO: 49, a VL comprising the amino acid sequence according to SEQ ID NO: 113, and a CL comprising the amino acid sequence according to SEQ ID NO: 186. In some embodiments, the S2V29-v37.2 or a variant thereof may comprise two identical polypeptides comprising the VH and CH as described above. In some embodiments, the S2V29-v37.2 or a variant thereof may comprise two identical polypeptides comprising the VL and CL as described above. In some embodiments, the SS2V29-v37.2 or its variant antibody or antigen-binding fragment may comprise two identical polypeptides, VH and CH, as described above, and two identical polypeptides, VL and CL, as described above. In some embodiments, the amino acid sequences of VH, CH, CL, and / or VL may have at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with the amino acid sequences identified above, respectively.

[0226] In some embodiments, the antibody or antigen-binding fragment comprises an HC consisting of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without a C-terminal lysine, and an LC consisting of, substantially consisting of, or consisting of, the amino acid sequence of SEQ ID NO: 204.

[0227] In some embodiments, the antibody or antigen-binding fragment comprises an HC and an LC, wherein the HC comprises or substantially consists of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without a C-terminal lysine, and the LC comprises, substantially consists of, or consists of the amino acid sequence of SEQ ID NO: 204. In some embodiments, the antibody or antigen-binding fragment comprises an HC consisting of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without a C-terminal lysine, and an LC consisting of, substantially consists of, or consists of the amino acid sequence of SEQ ID NO: 204. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise the amino acid sequence of any one of SEQ ID NO: 184 to 202. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may consist substantially of the amino acid sequence of any one of SEQ ID NO: 184 to 202. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may consist of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise an amino acid sequence according to one or more of SEQ ID NO: 215 to 221. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise an amino acid sequence according to one or more of SEQ ID NO: 207 to 210. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise an amino acid sequence according to one or more of SEQ ID NO: 215 to 221, and further comprises an amino acid sequence according to SEQ ID NO: 207 to 210, wherein the HC may comprise SEQ ID NO: 215 to 221 in some embodiments. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210.In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224, and further comprises amino acid sequences according to SEQ ID NO: 211 to 214, which in some embodiments may comprise SEQ ID NO: 222 to 224. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprises amino acid sequences according to one or more of SEQ ID NO: 211 to 214. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise the amino acid sequences according to one or more of SEQ ID NO: 222 to 224.In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224. In some embodiments, the antibody may not comprise either the VH consisting of the amino acid sequence according to SEQ ID NO: 67 or the VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0228] In some embodiments, the antibody or antigen-binding fragment comprises an HC containing the amino acid sequence of SEQ ID NO: 203 or without a C-terminal lysine, and an LC containing the amino acid sequence of SEQ ID NO: 204, substantially composed of, or composed of.

[0229] In some embodiments, the antibody or antigen-binding fragment comprises an HC and an LC, wherein the HC consists essentially of the amino acid sequence of SEQ ID NO: 203 or without a C-terminal lysine, and the LC comprises, consists essentially of, or consists of the amino acid sequence of SEQ ID NO: 204.

[0230] In some embodiments, the antibody or antigen-binding fragment comprises an HC consisting of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without a C-terminal lysine, and an LC consisting of, substantially consisting of, or consisting of, the amino acid sequence of SEQ ID NO: 204.

[0231] In some embodiments, the antibody or antigen-binding fragment comprises HC and LC, wherein the HC comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without C-terminal lysine, and the LC comprises the amino acid sequence of SEQ ID NO: 204.

[0232] In some embodiments, the antibody or antigen-binding fragment comprises an HC and an LC, wherein the HC comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without a C-terminal lysine, and the LC is substantially composed of the amino acid sequence of SEQ ID NO: 204.

[0233] In some embodiments, the antibody or antigen-binding fragment comprises an HC and an LC, wherein the HC comprises, is substantially composed of, or is composed of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without a C-terminal lysine, and the LC comprises the amino acid sequence of SEQ ID NO: 204.

[0234] In some embodiments, the antibody or antigen-binding fragment comprises HC and LC, wherein the HC comprises the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without C-terminal lysine, and the LC comprises the amino acid sequence of SEQ ID NO: 204.

[0235] In some embodiments, the antibody or antigen-binding fragment comprises an HC and an LC, wherein the HC consists essentially of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without a C-terminal lysine, and the LC consists essentially of the amino acid sequence of SEQ ID NO: 204.

[0236] In some embodiments, the antibody or antigen-binding fragment comprises HC and LC, wherein the HC consists of the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without C-terminal lysine, and the LC consists of the amino acid sequence of SEQ ID NO: 204.

[0237] In some embodiments, the antibody or antigen-binding fragment comprises an HC and an LC, wherein the HC comprises an amino acid sequence having at least 85%, 90%, 95%, or 99% identity with, substantially constitutes, or is composed of, the amino acid sequence having at least 85%, 90%, 95%, or 99% identity with, SEQ ID NO: 203 or without a C-terminal lysine, and the LC comprises an amino acid sequence having at least 85%, 90%, 95%, or 99% identity with, SEQ ID NO: 204, and the LC comprises, substantially constitutes, or is composed of, the amino acid sequence according to, SEQ ID NO: 203. In some embodiments, the HC having at least 85%, 90%, or 95% identity with, SEQ ID NO: 203 may comprise an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may consist substantially of the amino acid sequences according to any one of SEQ ID NO: 184 to 202. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may consist of the amino acid sequences according to any one of SEQ ID NO: 184 to 202. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise amino acid sequences of one or more of SEQ ID NO: 215 to 221, and further comprise amino acid sequences of SEQ ID NO: 207 to 210, wherein the HC may comprise SEQ ID NO: 215 to 221 in some embodiments. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise CDRH1, CDRH2, and CDRH3 amino acid sequences of SEQ ID NO: 68, 171, and 70, and further comprise amino acid sequences of one or more of SEQ ID NO: 207 to 210.In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the HC having at least 85%, 90%, or 95% identity with SEQ ID NO: 203 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224, and further comprises amino acid sequences according to SEQ ID NO: 211 to 214, which in some embodiments may comprise SEQ ID NO: 222 to 224. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprises amino acid sequences according to one or more of SEQ ID NO: 211 to 214. In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise the amino acid sequences according to one or more of SEQ ID NO: 222 to 224.In some embodiments, the LC having at least 85%, 90%, or 95% identity with SEQ ID NO: 204 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224. In some embodiments, the antibody may not comprise either the VH consisting of the amino acid sequence according to SEQ ID NO: 67 or the VL consisting of the amino acid sequence according to SEQ ID NO: 71.

[0238] In some embodiments, the antibody or antigen-binding fragment comprises two heavy chains and two light chains, each of the two heavy chains comprising the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without C-terminal lysine, and each of the two light chains comprising the amino acid sequence of SEQ ID NO: 204. Further optionally, the antibody or antigen-binding fragment comprises two heavy chains and two light chains, each of the two heavy chains comprising the amino acid sequence of SEQ ID NO: 203 or SEQ ID NO: 203 without C-terminal lysine, and each of the two light chains comprising the amino acid sequence of SEQ ID NO: 204.

[0239] The monospecific or multispecific antibody or antigen-binding fragments constructed according to this disclosure comprise any combination of the VH and VL sequences disclosed herein and / or any combination of the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 sequences. In some embodiments, the bispecific or multispecific antibody or antigen-binding fragment may comprise one, two, or more antigen-binding domains (e.g., VH and VL) of this disclosure. Two or more binding domains may be present that bind to the same or different SARS-CoV-2 epitopes, and in some embodiments, the bispecific or multispecific antibody or antigen-binding fragments provided herein comprise additional SARS-CoV-2 binding domains and / or may comprise binding domains that bind to entirely different antigens or pathogens.

[0240] In any of the currently disclosed embodiments, the antibody or antigen-binding fragment may be multispecific; for example, bispecific, trispecific, etc.

[0241] In some embodiments, the antibody or antigen-binding fragment comprises: (i) a first VH and a first VL; and (ii) a second VH and a second VL, wherein the first VH and the second VH are different.

[0242] In some embodiments, the first VH and VL respectively comprise an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, and 184) identity with the amino acid sequence according to SEQ ID NO: 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, and 184, and an amino acid sequence with at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: The amino acid sequence of any one of 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid identity; and wherein the second VH and VL respectively contain amino acid sequences identical to those specified according to SEQ ID NO: The amino acid sequence of any one of 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, and 184 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity, and is consistent with the amino acid sequence according to SEQ ID NO: The amino acid sequence of any one of 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159 and 163 has an amino acid sequence with at least 85% (e.g. 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity; wherein the first VH and the second VL are different from the second VH and VL, and wherein the first VH and the first VL together form a first antigen binding site, and wherein the second VH and the second VL together form a second antigen binding site.

[0243] In some embodiments, the first VH and VL each comprise an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to any one of SEQ ID NO: 166, 170, 174, 179, 182, and 184, and an amino acid sequence with the amino acid sequence according to SEQ ID NO: 166, 170, 174, 179, 182, and 184. The amino acid sequence of any one of NO: 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity; and wherein the second VH and VL respectively contain amino acid sequences identical to those according to SEQ ID The amino acid sequence of any one of NO: 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, and 184 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity, and is consistent with the amino acid sequence according to SEQ ID NO: The amino acid sequence of any one of 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159 and 163 has an amino acid sequence with at least 85% (e.g. 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) identity; wherein the first VH and the second VL are different from the second VH and VL, and wherein the first VH and the first VL together form a first antigen binding site, and wherein the second VH and the second VL together form a second antigen binding site.

[0244] In some embodiments, the first VH and VL each comprise an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to any one of SEQ ID NO: 166, 170, 174, 179, 182, and 184, and an amino acid sequence with the amino acid sequence according to SEQ ID NO: 166, 170, 174, 179, 182, and 184. The amino acid sequences of any one of NO: 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163 have at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with each other; and wherein the second VH and VL respectively contain amino acid sequences having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with each of SEQ ID NO: 166, 170, 174, 179, 182, and 184, and amino acid sequences having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with each other according to SEQ ID NO: 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159 and 163 have an amino acid sequence with at least 85% (e.g. 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100%) amino acid sequence identity; wherein the first VH and the second VL are different from the second VH and VL, and wherein the first VH and the first VL together form a first antigen binding site, and wherein the second VH and the second VL together form a second antigen binding site.

[0245] In some embodiments, the antibody or antigen-binding fragment comprises an S2V29-v37.2 or a variant thereof antibody or antigen-binding fragment, and the first VH and VL each comprise an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 184, and an amino acid sequence with the amino acid sequence according to SEQ ID NO: 184. The amino acid sequence of SEQ ID NO: 113 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity; and wherein the second VH and VL comprise the amino acid sequence of the second antibody or antigen-binding fragment; wherein the first VH and second VL are different from the second VH and VL, and wherein the first VH and first VL together form a first antigen-binding site, and wherein the second VH and second VL together form a second antigen-binding site. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may comprise the amino acid sequence of any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may consist substantially of the amino acid sequence of any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may consist of an amino acid sequence according to any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may comprise an amino acid sequence according to one or more of SEQ ID NO: 215 to 221. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may comprise an amino acid sequence according to one or more of SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may comprise an amino acid sequence according to one or more of SEQ ID NO: 215 to 221, and further comprises an amino acid sequence according to SEQ ID NO: 207 to 210, wherein the VH may comprise SEQ ID NO: 215 to 221 in some embodiments.In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise amino acid sequences according to one or more of SEQ ID NO: 207 to 210. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise amino acid sequences according to one or more of SEQ ID NO: 215 to 221. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, the VL having at least 85% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 211 to 214. In some embodiments, a VL having at least 85% identity with SEQ ID NO: 113 may comprise amino acid sequences of one or more of SEQ ID NO: 222 to 224, and further comprise amino acid sequences of SEQ ID NO: 211 to 214. In some embodiments, a VL having at least 85% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences of SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences of one or more of SEQ ID NO: 211 to 214. In some embodiments, a VL having at least 85% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences of SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences of one or more of SEQ ID NO: 222 to 224.In some embodiments, the VL having at least 85% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, CDRL3 amino acid sequences according to SEQ ID NO: 72, 73 and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224.

[0246] In some embodiments, the antibody or antigen-binding fragment comprises an S2V29-v37.2 or a variant thereof, and the first VH and VL each comprise an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 184, and an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: 113; and wherein the second VH and VL each comprise an amino acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequence according to SEQ ID NO: The amino acid sequence of any one of 67, 81, 84, 87, 90, 93, 97, 101, 105, 109, 137, 139, 142, 166, 170, 174, 179, 182, and 184 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity, and is consistent with the amino acid sequence according to SEQ ID NO: The amino acid sequence of any one of 71, 77, 113, 116, 119, 122, 125, 128, 131, 133, 145, 150, 152, 155, 159, and 163 has at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) amino acid sequence identity; wherein the first VH and the second VL are different from the second VH and VL, and wherein the first VH and the first VL together form a first antigen binding site, and wherein the second VH and the second VL together form a second antigen binding site. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may comprise the amino acid sequence of any one of SEQ ID NO: 184 to 202. In some embodiments, the VH having at least 85% identity with SEQ ID NO: 184 may consist substantially of an amino acid sequence according to any one of SEQ ID NO: 184 to 202.In some embodiments, a VH having at least 85% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221. In some embodiments, a VH having at least 85% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 207 to 210. In some embodiments, a VH having at least 85% identity with SEQ ID NO: 184 may comprise an amino acid sequence of one or more of SEQ ID NO: 215 to 221, and further comprise an amino acid sequence of SEQ ID NO: 207 to 210, wherein the VH may comprise SEQ ID NO: 215 to 221 in some embodiments. In some embodiments, a VH having at least 85% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences of SEQ ID NO: 68, 171, and 70, and further comprise an amino acid sequence of one or more of SEQ ID NO: 207 to 210. In some embodiments, VH having at least 85% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, VH having at least 85% identity with SEQ ID NO: 184 may comprise the CDRH1, CDRH2, and CDRH3 amino acid sequences according to SEQ ID NO: 68, 171, and 70, and further comprise one or more amino acid sequences according to SEQ ID NO: 207 to 210, and further comprise one or more amino acid sequences according to SEQ ID NO: 215 to 221. In some embodiments, VL having at least 85% identity with SEQ ID NO: 113 may comprise one or more amino acid sequences according to SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85% identity with SEQ ID NO: 113 may comprise an amino acid sequence of one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85% identity with SEQ ID NO: 113 may comprise an amino acid sequence of one or more of SEQ ID NO: 222 to 224, and further comprises an amino acid sequence of SEQ ID NO: 211 to 214, wherein the VL may comprise SEQ ID NO: 222 to 224 in some embodiments.In some embodiments, the VL having at least 85% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214. In some embodiments, the VL having at least 85% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, and CDRL3 amino acid sequences according to SEQ ID NO: 72, 73, and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224. In some embodiments, the VL having at least 85% identity with SEQ ID NO: 113 may comprise the CDRL1, CDRL2, CDRL3 amino acid sequences according to SEQ ID NO: 72, 73 and 114, and further comprise amino acid sequences according to one or more of SEQ ID NO: 211 to 214, and further comprise amino acid sequences according to one or more of SEQ ID NO: 222 to 224.

[0247] In some embodiments, the antibody or antigen-binding fragment is an isotype of IgG (e.g., IgG1, IgG2, IgG3, or IgG4), IgA, IgM, IgE, or IgD, or contains amino acid sequences from two or more of these. In some embodiments, the antibody or antigen-binding fragment is human, humanized, or chimeric.

[0248] Antibody or antigen-binding fragments can be any allotype or combination of allotypes. "Allotype" refers to an allelic variation found in an IgG subclass. For example, allotypes may include G1m1 (or G1m(a)), G1m2 (or G1m(x)), G1m3 (or G1m(f)), G1m17 (or Gm(z))m), G1m27 and / or G1m28 (G1m27 and G1m28 have been described as "alloallotypes").

[0249] The G1m3 and G1m17 allotypes are located at the same position in the CH1 domain (position 214 according to EU numbering). G1m3 contains R214 (EU), while G1m17 contains K214 (EU). The G1m1 allotype is located in the CH3 domain (at positions 356 and 358 (EU)) and refers to the substitution of E356D and M358L. The G1m2 allotype refers to the substitution of alanine at position 431 (EU) with glycine. G1m allotypes, allotypes, and their characteristics are known in the art and described, for example, at www.imgt.org / IMGTrepertoire / Proteins / allotypes / human / IGH / IGHC / G1m_allotypes.html and Lefranc, M.-P. and Lefranc, G. Human Gm, Km and Am allotypes and their molecular characterization: a remarkable demonstration of polymorphism, in: B. Tait, F. Christiansen (eds.), Immunogenetics, Chapter 34, Humana Press, Springer, New York, USA. Methods Mol. Biol. 2012; 882, 635-680. PMID: 22665258, LIGM: 406. The contents of these documents and information on allotypes and allotypes are incorporated herein by reference.

[0250] The G1m1 allotype can be combined, for example, with the G1m3, G1m17, G1m27, G1m2 and / or G1m28 allotypes. In some embodiments, the allotype is G1m3 without G1m1 (G1m3,-1). In some embodiments, the allotype is the G1m17,1 allotype. In some embodiments, the allotype is G1m3,1. In some embodiments, the allotype is G1m17 without G1m1 (G1m17,-1). Optionally, these allotypes can be combined (or not combined) with the G1m2, G1m27 or G1m28 allotypes. For example, the allotype can be G1m17,1,2.

[0251] In some embodiments, the antibody or antigen-binding fragment of this disclosure comprises a G1m3 allotype or a G1m3,1 allotype. In some embodiments, the antibody or antigen-binding fragment of this disclosure comprises a G1m3 allotype and contains M428L and N434S or M428L and N434A mutations or any other mutations that enhance binding to human FcRn, such as those described herein. In some embodiments, the antibody or antigen-binding fragment of this disclosure comprises a G1m3,1 allotype and contains M428L and N434S or M428L and N434A mutations or any other mutations that enhance binding to human FcRn, such as those described herein. In some embodiments, the antibody or antigen-binding fragment of this disclosure comprises a G1m17,1 allotype. In some embodiments, the antibody or antigen-binding fragment of this disclosure comprises the G1m17,1 allotype and contains M428L and N434S or M428L and N434A mutations or any other mutations that enhance binding to human FcRn, as further described herein.

[0252] In some implementations, the antibody or antigen-binding fragment includes human antibody, monoclonal antibody, purified antibody, single-chain antibody, Fab, Fab', F(ab')2, Fv, scFv, or scFab.

[0253] In some embodiments, the antibody or antigen-binding fragments of this disclosure are monospecific (e.g., binding to a single epitope) or multispecific (e.g., binding to multiple epitopes and / or target molecules). Antibody and antigen-binding fragments can be constructed in various formats. Exemplary antibody formats are disclosed in Spiess et al., Mol. Immunol. 67(2):95 (2015) and in Brinkmann and Kontermann, mAbs 9(2):182-212 (2017), the formats and their preparation methods being incorporated herein by reference and including, for example, bispecific T-cell adaptors (BiTE), DART, Knobs-Into-Holes (KIH) assemblies, scFv-CH3-KIH assemblies, KIH common light chain antibodies, TandAb, triantibodies, TriBi microantibodies, Fab-scFv, scFv-CH-CL-scFv, F(ab')2-scFv2, tetravalent HCab, intracellular antibodies, CrossMab, dual-action Fab (DAF) (two-in-one or four-in-one), DutaMab, DT-IgG, charge pairs, Fab arm exchanges (Fab-arms) Exchange), SEEDbodies, Triomab, LUZ-Y assemblies, Fcab, κλ bodies, orthogonal Fab, DVD-Ig (e.g., U.S. Patent No. 8,258,268, the format of which is incorporated herein by reference in its entirety), IgG(H)-scFv, scFv-(H)IgG, IgG(L)-scFv, scFv-(L)IgG, IgG(L,H)-Fv, IgG(H)-V, V(H)-IgG, IgG(L)-V, V(L)-IgG, KIH IgG-scFab, 2scFv-IgG, IgG-2scFv, scFv4-Ig, Zybody and DVI-IgG (quadruple combination) and so-called FIT-Ig (e.g., PCT Publication No. WO 2015 / 103072, the format of which is incorporated herein by reference in its entirety), so-called WuxiBody format (e.g., PCT Publication No. WO 2015 / 103072), and so-called WuxiBody format (e.g., PCT Publication No. WO 2015 / 103072). 2019 / 057122, the format of which is incorporated herein by reference in its entirety) and the so-called In-Elbow-Insert Ig format (IEI-Ig; e.g., PCT Publications WO 2019 / 024979 and WO 2019 / 025391, the format of which is incorporated herein by reference in its entirety).

[0254] In some embodiments, the antibody or antigen-binding fragment comprises two or more VH domains, two or more VL domains, or both (i.e., two or more VH domains and two or more VL domains). In a particular embodiment, the antigen-binding fragment has a format (N-terminal to C-terminal orientation) VH-connector-VL-connector-VH-connector-VL, wherein the two VH sequences may be identical or different and the two VL sequences may be identical or different. Such a linked scFv may comprise any combination of VH and VL domains arranged to bind to a given target, and in formats comprising two or more VH and / or two or more VL, one, two, or more different epitopes or antigens may be bound. It should be understood that formats incorporating multiple antigen-binding domains may contain VH and / or VL sequences in any combination or orientation. For example, antigen-binding fragments may have the format VL-connector-VH-connector-VL-connector-VH, VH-connector-VL-connector-VL-connector-VH, or VL-connector-VH-connector-VH-connector-VL.

[0255] In some embodiments, the antibody or antigen-binding fragment includes an Fc polypeptide or a fragment thereof, which may be present in the “Fc moiety” or a fragment thereof. The “Fc” fragment or Fc polypeptide contains the carboxyl-terminal portions of two antibody H chains held together by disulfide bonds (i.e., the CH2 and CH3 domains of IgG). The Fc may comprise a dimer composed of two Fc polypeptides (i.e., two CH2-CH3 polypeptides).

[0256] In some embodiments, the antibody or antigen-binding fragment or multispecific antibody may further comprise an Fc portion comprising or consisting of a polypeptide or a fragment thereof, the polypeptide or fragment thereof comprising or consisting of an amino acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with, or comprising or consisting of, an amino acid sequence according to any one of SEQ ID NO: 30 to 66.

[0257] In a further embodiment, the antibody or antigen-binding fragment may further comprise an Fc portion comprising or consisting of a polypeptide or a fragment thereof, the polypeptide or fragment thereof comprising or consisting of an amino acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with, or comprising or consisting of, the amino acid sequence according to SEQ ID NO: 49.

[0258] In some embodiments, the antibody or antigen-binding fragment may further comprise an LC containing an amino acid sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with, or comprising, the amino acid sequence according to SEQ ID NO: 186.

[0259] Antibody "effector function" refers to the biological activity attributable to the Fc portion of the antibody (either the native sequence Fc portion or the Fc portion of an amino acid sequence variant), and varies with antibody isotype. Examples of antibody effector functions include: C1q binding and complement-dependent cytotoxicity; Fc receptor binding; antibody-dependent cell-mediated cytotoxicity (ADCC); phagocytosis; downregulation of cell surface receptors (e.g., B cell receptors); and B cell activation. As discussed herein, the Fc domain can be modified (e.g., amino acid substitution) to modify (e.g., alter, reduce, or eliminate) one or more functions of Fc-containing peptides (e.g., the antibodies of this disclosure). These functions include, for example, Fc receptor (FcR) binding, antibody half-life regulation (e.g., by binding to FcRn), ADCC function, protein A binding, protein G binding, and complement binding. Amino acid modifications that modify (e.g., improve, reduce, or eliminate) Fc function include, for example, T250Q / M428L, M252Y / S254T / T256E, H433K / N434F, M428L / N434S, M428L / N434A, E233P / L234V / L235A / G236+, A327G / A330S / P331S, E333A, S239D / A330L / I332E, P257I / Q311, K326W / E333S, S239D / I332E / G236A, N297Q, K322A, S228P, L235E+. The E318A / K320A / K322A, L234A / L235A (also referred to as “LALA” in this paper), and L234A / L235A / P329G mutations, which are summarized and annotated in “Engineered Fcmoietys” published by InvivoGen (2011) and available online at invivogen.com / PDF / review / review-Engineered-Fc-Regions-invivogen.pdf?utm_source=review&utm_medium=pdf&utm_campaign=review&utm_content=Engineered-Fc-Regions, are incorporated herein by reference.

[0260] For example, to activate the complement cascade, the C1q protein complex can bind to at least two IgG1 molecules or one IgM molecule when immunoglobulin molecules attach to an antigen target (Ward, ES and Ghetie, V., Ther. Immunol. 2 (1995) 77-94). Burton, DR (Mol. Immunol. 22 (1985) 161-206) described the heavy chain region containing amino acid residues 318 to 337 as participating in complement fixation. Duncan, AR and Winter, G. (Nature 332 (1988) 738-740) reported using site-directed mutagenesis that Glu318, Lys320, and Lys322 form binding sites for C1q. The role of Glu318, Lys320, and Lys322 residues in C1q binding was demonstrated by the ability of short synthetic peptides containing these residues to inhibit complement-mediated cleavage.

[0261] For example, FcR binding can be mediated by the interaction between the Fc portion of an antibody and the Fc receptor (FcR), a specialized cell surface receptor on cells including hematopoietic cells. Fc receptors belong to the immunoglobulin superfamily and have been shown to mediate both the removal of antibody-coated pathogens via phagocytosis of immune complexes and the lysis of antibody-dependent cell-mediated cytotoxicity (ADCC; Van de Winkel, JG and Anderson, CL, J. Leukoc. Biol. 49 (1991) 511-524) of erythrocytes and various other cellular targets (e.g., tumor cells) coated with their corresponding antibodies. FcRs are defined by their specificity to immunoglobulin classes; the Fc receptor for IgG antibodies is called FcγR, the Fc receptor for IgE antibodies is called FcεR, the Fc receptor for IgA antibodies is called FcαR, and the Fc receptor for newborns is called FcRn. Fc receptor binding is described in, for example, the following literature: Ravetch, JV and Kinet, JP, Annu. Rev. Immunol. 9 (1991) 457-492; Capel, PJ et al., Immunomethods 4 (1994) 25-34; de Haas, M. et al., J Lab. Clin. Med. 126 (1995) 330-341; and Gessner, JE et al., Ann. Hematol. 76 (1998) 231-248.

[0262] Cross-linking of the Fc domain of natural IgG antibodies to their receptors (FcγRs) triggers a variety of effector functions, including phagocytosis, antibody-dependent cytotoxicity, and the release of inflammatory mediators, as well as immune complex clearance and regulation of antibody production. This article considers Fc moieties that provide receptor (e.g., FcγR) cross-linking. In humans, three classes of FcγRs have been characterized to date: (i) FcγRI (CD64), which binds monomeric IgG with high affinity and is expressed on macrophages, monocytes, neutrophils, and eosinophils; (ii) FcγRII (CD32), which binds to complex IgG with medium to low affinity, is widely expressed (especially on leukocytes) and is considered a key player in antibody-mediated immunity. It can be divided into FcγRIIA, FcγRIIB, and FcγRIIC, which play different functions in the immune system but bind to IgG-Fc with similar low affinity, and the extracellular domains of these receptors are highly homologous; and (iii) FcγRIII (CD16), which binds to IgG with medium to low affinity and has been found in two forms: FcγRIIIA, which has been found on NK cells, macrophages, eosinophils, and some monocytes and T cells and is thought to mediate ADCC; and FcγRIIIB, which is highly expressed on neutrophils.

[0263] FcγRIIA is found on many cells involved in killing (e.g., macrophages, monocytes, neutrophils) and appears to activate the killing process. FcγRIIB appears to play a role in the inhibitory process and is found on B cells, macrophages, as well as mast cells and eosinophils. Importantly, it has been shown that 75% of all FcγRIIBs are found in the liver (Ganesan, LP et al., 2012: “FcγRIIb on liver sinusoidal endothelium clears small immune complexes,” Journal of Immunology 189: 4981-4988). FcγRIIB is highly expressed on the hepatic sinusoidal endothelium (called LSEC) and in Kupffer cells in the liver, and the LSEC is the main site of clearance of small immune complexes (Ganesan, LP et al., 2012: FcγRIIb on liver sinusoidal endothelium clears small immune complexes. Journal of Immunology 189: 4981-4988).

[0264] In some embodiments, the antibodies and their antigen-binding fragments disclosed herein comprise an Fc polypeptide or a fragment thereof for binding to FcγRIIb, particularly the Fc moiety, such as, for example, IgG-type antibodies. Furthermore, the Fc moiety can be engineered to enhance FcγRIIb binding by introducing mutations S267E and L328F, as described in Chu, SY et al., 2008: Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies. Molecular Immunology 45, 3926-3933. This can enhance the clearance of immune complexes (Chu, S. et al., 2014: Accelerated Clearance of IgE In Chimpanzees Is Mediated By Xmab7195, An Fc-Engineered Antibody With Enhanced Affinity For Inhibitory Receptor FcγRIIb. Am J Respir Crit, American Thoracic Society International Conference Abstracts). In some embodiments, the antibody or antigen-binding fragment of this disclosure comprises an engineered Fc moiety having mutations S267E and L328F, specifically as described in Chu, SY et al., 2008: Inhibition of B cell receptor-mediated activation of primary human B cells by coengagement of CD19 and FcgammaRIIb with Fc-engineered antibodies. Molecular Immunology 45, 3926-3933.

[0265] On B cells, FcγRIIB may inhibit further immunoglobulin production and isotype conversion, such as to IgE. On macrophages, FcγRIIB is thought to inhibit phagocytosis mediated by FcγRIIA. On eosinophils and mast cells, the B form can help inhibit activation of these cells by binding to IgE and its individual receptor.

[0266] Regarding FcγRI binding, modifications of one or more of E233-G236, P238, D265, N297, A327, and P329 in native IgG reduce binding to FcγRI. IgG2 residues substituted at positions 233-236 in IgG1 and IgG4 reduce the binding of IgG1 and IgG4 to FcγRI by 103-fold and eliminate the human monocyte response to antibody-sensitized erythrocytes (Armour, KL et al., Eur. J. Immunol. 29 (1999) 2613-2624).

[0267] Regarding FcγRII binding, reduced binding to FcγRIIA was found, for example, for IgG mutations of one or more of E233-G236, P238, D265, N297, A327, P329, D270, Q295, A327, R292, and K414.

[0268] The two allele forms of human FcγRIIA are the “H131” variant, which binds to IgG1 Fc with higher affinity, and the “R131” variant, which binds to IgG1 Fc with lower affinity. See, for example, Bruhns et al., Blood 113:3716-3725 (2009).

[0269] Regarding FcγRIII binding, reduced binding to FcγRIIIA was found, for example, for mutations in one or more of E233-G236, P238, D265, N297, A327, P329, D270, Q295, A327, S239, E269, E293, Y296, V303, A327, K338, and D376. Mapping of the binding sites of the Fc receptor on human IgG1, the aforementioned mutation sites, and methods for measuring binding to FcγRI and FcγRIIA are described in Shields, RL et al., J. Biol. Chem. 276 (2001) 6591-6604.

[0270] Human FcγRIIIA has two allelic forms: the “F158” variant, which binds to IgG1 Fc with lower affinity, and the “V158” variant, which binds to IgG1 Fc with higher affinity. See, for example, Bruhns et al., Blood 113:3716-3725 (2009).

[0271] Regarding binding to FcγRII, two regions of native IgG Fc appear to be involved in the interaction between FcγRII and IgG: (i) the lower hinge site of IgG Fc, particularly amino acid residues L,L,G,G (234–237, EU numbers); and (ii) the adjacent region of the CH2 domain of IgG Fc, particularly the loops and chains in the upper CH2 domain adjacent to the lower hinge region, for example in the region of P331 (Wines, BD et al., J. Immunol. 2000; 164: 5313-5318). Furthermore, FcγRI appears to bind to the same site on IgG Fc, while FcRn and protein A bind to different sites on IgG Fc, which appear to be located at the CH2-CH3 interface (Wines, BD et al., J. Immunol. 2000; 164: 5313-5318).

[0272] Mutations that increase the binding affinity of the Fc peptide or fragment thereof of this disclosure to (i.e., one or more) Fcγ receptors (e.g., compared to a reference Fc peptide or fragment thereof or containing a reference Fc peptide or fragment thereof without the mutation) are also considered. See, for example, Delillo and Ravetch, Cell 161(5):1035-1045 (2015) and Ahmed et al., J.Struc.Biol.194(1):78 (2016), whose Fc mutations and techniques are incorporated herein by reference.

[0273] In any of the embodiments disclosed herein, the S2V29 antibody or antigen-binding fragment, particularly the S2V29-v37.2 or a variant thereof, may comprise an Fc polypeptide or a fragment thereof containing a mutation selected from: G236A; S239D; A330L; and I332E; or a combination of any two or more thereof; for example, S239D / I332E, S239D / A330L / I332E; G236A / S239D / I332E; G236A / A330L / I332E (also referred to herein as “GAALIE”); or G236A / S239D / A330L / I332E. In some embodiments, the Fc polypeptide or a fragment thereof does not contain S239D. In some embodiments, the Fc polypeptide or a fragment thereof contains an S at position 239 (EU number). In some embodiments, the Fc polypeptide or a fragment thereof comprises an amino acid sequence according to any one of SEQ ID NO: 38 to 44 and 57 to 66.

[0274] In some embodiments, the Fc peptide or a fragment thereof may comprise or consist of at least a portion of or be composed of an Fc peptide or fragment thereof that participates in FcRn binding. In some embodiments, the Fc peptide or fragment thereof comprises one or more amino acid modifications that increase the binding affinity for FcRn (e.g., enhance binding to FcRn) (e.g., at a pH of about 6.0), and in some embodiments, thereby prolonging the in vivo half-life of the molecule comprising the Fc peptide or fragment thereof (e.g., compared to a reference Fc peptide or fragment thereof or antibody that is otherwise identical but does not contain the modification). In some embodiments, the Fc peptide or fragment thereof comprises or is derived from IgG Fc, and the half-life prolonging mutation includes any one or more of the following: M428L; N434S; N434H; N434A; N434S; M252Y; S254T; T256E; T250Q; P257I; Q311I; D376V; T307A; E380A (EU number). In some embodiments, the half-life extension mutation includes M428L / N434S (also referred to herein as “MLNS”, “LS”, “_LS”, and “-LS”). In some embodiments, the half-life extension mutation is located in an Fc polypeptide or a fragment thereof, which comprises or is composed of an amino acid sequence according to any one of SEQ ID NO: 45 to 50 and 57 to 61. In some embodiments, the half-life extension mutation includes M252Y / S254T / T256E. In some embodiments, the half-life extension mutation includes T250Q / M428L. In some embodiments, the half-life extension mutation includes P257I / Q311I. In some embodiments, the half-life extension mutation includes P257I / N434H. In some embodiments, the half-life extension mutation includes D376V / N434H. In some embodiments, the half-life extension mutation includes T307A / E380A / N434A. In some embodiments, the half-life extension mutation includes M428L / N434A (also referred to herein as “MLNA”, “LA”, “_LA”, and “-LA”). In some embodiments, the half-life extension mutation is located in an Fc polypeptide or a fragment thereof, which comprises or consists of an amino acid sequence according to any one of SEQ ID NO: 51 to 56 and 62 to 66.

[0275] In some implementations, the half-life extension mutation includes M252Y / S254T / T256E (also known as “YTE”). Although YTE is known to reduce effector function, the half-life extension provided by this mutation can be shown to be beneficial more than any reduction in effector function.

[0276] In some embodiments, the S2V29 antibody or antigen-binding fragment, particularly the S2V29-v37.2 or a variant thereof, comprises an Fc portion containing the substitutional mutations M428L / N434S or M428L / N434A. In some embodiments, the antibody or antigen-binding fragment comprises an Fc polypeptide or a fragment thereof containing the substitutional mutations G236A / A330L / I332E. In some embodiments, the antibody or antigen-binding fragment comprises (e.g., IgG) an Fc portion containing the G236A mutation, the A330L mutation, and the I332E mutation (GAALIE), and does not contain the S239D mutation (e.g., containing a native S at position 239). In a particular embodiment, the antibody or antigen-binding fragment comprises an Fc polypeptide or a fragment thereof containing substitutional mutations: M428L / N434S and G236A / A330L / I332E (and may contain or be composed of amino acid sequences according to any one of SEQ ID NO: 57 to 61), and optionally does not contain S239D (e.g., contains the S at position 239). In a particular embodiment, the antibody or antigen-binding fragment comprises an Fc polypeptide or a fragment thereof containing substitutional mutations: M428L / N434A and G236A / A330L / I332E (and may contain or be composed of amino acid sequences according to any one of SEQ ID NO: 62 to 66), and optionally does not contain S239D (e.g., contains the S at position 239). In some embodiments, the antibody or antigen-binding fragment comprises an Fc polypeptide or a fragment thereof containing substitution mutations: M428L / N434S (or M428L / N434A) and G236A / S239D / A330L / I332E. Any such antibody or antigen-binding fragment may further contain a YTE mutation.

[0277] In some embodiments, an S2V29 antibody or antigen-binding fragment, particularly an S2V29-v37.2 or a variant thereof, is provided that contains any of the described amino acid mutations in the (e.g., human) IgG1 heavy chain: (i) G236A, L328V, and Q295E; (ii) G236A, P230A, and Q295E; (iii) G236A, R292P, and I377N; (iv) G236A, K334A, and Q295E; (v) G236S, R292P, and Y300L; (vi) G236A and Y300L; (vii) G236A, R292P, and Y300L; (viii) G236S, G420V, G446E, and L309T; (ix) (x) R292P and Y300L; (xi) G236A and R292P; (xii) Y300L; (xiii) E345K, G236S, L235Y and S267E; (xiv) E272R, L309T, S219Y and S267E; (xv) G236Y; (xvi) G236W; (xvii) F243L, G446E, P396L, S267E; (xviii) G236A, S239D and H268E, and (xix) M252Y / S254T / T256E, wherein the amino acid residues are numbered according to the EU index as described in Kabat. In some embodiments, the antibody or antigen-binding fragment is defucosylated. In some embodiments, the antibody or antigen-binding fragment may also contain one or more mutations that enhance binding to human FcRn, such as the M428L and N434S mutation or the M428L and N434A mutation (EU number) or any other mutation that enhances binding to human FcRn, such as those described herein.

[0278] In some implementations, the S2V29 antibody or antigen-binding fragment, particularly the S2V29-v37.2 or its variant antibody or antigen-binding fragment, is non-fucosylated.In some embodiments, an antibody or antigen-binding fragment comprising VH and VL is provided, wherein VH and VL comprise or consist of the amino acid sequences according to SEQ ID NO: 1) 166 and 113, 2) 170 and 113, 3) 174 and 113, 4) 177 and 113, 5) 179 and 113, 6) 182 and 113 or 7) 184 and 113 (SEQ ID NO: 184 and 113 in a more specific embodiment involving an antibody or antigen-binding fragment of S2V29-v37.2 or a variant thereof), and (A) an Fc portion comprising the following substitution mutations: (i) G236A, L328V, and Q295E; (ii) G236A, P230A, and Q295E; (iii) G236A, R292P, and I377N; (iv) (v) G236A, K334A, and Q295E; (vi) G236S, R292P, and Y300L; (vii) G236A and Y300L; (vii) G236A, R292P, and Y300L; (viii) G236S, G420V, G446E, and L309T; (ix) G236A and R292P; (x) R292P and Y300L; (xi) G236A and R292P; (xii) Y300L; (xiii) E345K, G236S, L235Y, and S267E; (xiv) E272R, L309T, S219Y, and S267E; (xv) G236Y; (xvi) G236W; (xvii) F243L, G446E, P396L and S267E; (xviii) G236A, S239D and H268E; (xix) M428L / N434S; (xx) M428L / N434A; (xxi) G236A / A330L / I332E / M428L / N434S; (xxii) G236A / A330L / I332E / M428L / N434A; (xxiii) M252Y / S254T / T256E, or (xxiv) any two or more of (i)-(xxiii); or (B) comprising an Fc polypeptide or a fragment thereof or an Fc moiety thereof, the Fc polypeptide or fragment thereof comprising the same as SEQ ID NO: Any one of 30 to 66 having an amino acid sequence or being composed of at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity, optionally different from its naturally occurring variants, or containing or being composed of the amino acid sequence according to SEQ ID NO: 49.In some embodiments, the antibody may optionally further comprise a light chain polypeptide having a sequence having at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity with SEQ ID NO: 186.

[0279] In some embodiments, an S2V29 antibody or antigen-binding fragment comprising VH and VL is provided, wherein VH and VL comprise amino acid sequences according to SEQ ID NO: 1) 166 and 113, 2) 170 and 113, 3) 174 and 113, 4) 177 and 113, 5) 179 and 113, 6) 182 and 113 or 7) 184 and 113, a light chain λ constant region (SEQ ID NO: 186), and The heavy chain constant region (SEQ ID NO: 49) or is composed of it.

[0280] In some embodiments, the antibody or antigen-binding fragment is an S2V29-v37.2 or a variant thereof, and comprises VH and VL, which contain amino acid sequences according to SEQ ID NO: 184 and 113, a light chain λ constant region (SEQ ID NO: 186), and... The heavy chain constant region (SEQ ID NO:49) is essentially composed of or consists of the heavy chain constant region.

[0281] In some embodiments, the antibody or antigen-binding fragment contains a mutation that alters glycosylation, wherein the mutation that alters glycosylation includes N297A, N297Q, or N297G, and / or the antibody or antigen-binding fragment is partially or completely deglycosylated and / or partially or completely defucosylated. Host cell lines and methods for preparing partially or completely deglycosylated or partially or completely defucosylated antibodies and antigen-binding fragments are known (see, for example, PCT Publication No. WO 2016 / 181357; Suzuki et al. Clin. Cancer Res. 13(6):1875-82 (2007); North et al. MAbs 6:1-12 (2018)).

[0282] The antibody or antigen-binding fragment disclosed herein may be fucosylated (e.g., containing one or more fucosylated moieties, and typically containing a natural (wild-type) fucosylation pattern or a fucosylation pattern having one or more additional or fewer fucosylated moieties compared to the natural one), or may be defucosylated. Specifically, natural IgG1 antibodies carry a glycan site at N297, and this is typically the only site in the antibody where the core fucosylated moieties can be found, but some glycan sites may be generated during antibody development through mutation (e.g., in variable domains). The fucosylation of Fc peptides or fragments thereof, or the fucosylation of antibodies, can be affected by introducing amino acid mutations to introduce or disrupt fucosylation sites (e.g., mutations at N297, such as N297Q or N297A, to disrupt the formation of glycans that may contain the core fucosylation moiety). However, it is generally preferred to maintain N297 and its glycans, such as by expressing peptides in host cells that have been genetically engineered and lack the ability to fucosylate peptides (or have an inhibited or impaired ability); by expressing peptides under conditions where the ability of host cells to fucosylate peptides is impaired (e.g., in the presence of 2-fluoro-L-fucosylate (2FF)); and so on. Defucosylated peptides may contain no fucosylation moiety, or substantially no fucosylation moiety, and / or may be expressed by genetically engineered host cells lacking the ability to fucosylate peptides (or having an inhibited or impaired ability), and / or may be expressed under conditions where the host cell's ability to fucosylate peptides is impaired (e.g., in the presence of 2-fluoro-L-fucosylation (2FF)). In some embodiments, the peptide does not contain a core fucosylation moiety at Asn297. In some embodiments, the defucosylated peptide has increased binding to FcγRIIIA. In some contexts, the addition of 2FF to a culture medium containing host cells expressing an antibody results in approximately 85% or more of the antibody being free of the fucosylation moiety. Therefore, when multiple antibodies are generated in the presence of 2FF or similar reagents, these multiple antibody or antigen-binding fragments can be described as "defucosylated". In some contexts, multiple peptides or antibodies can be described, for example, as defucosylated, meaning that approximately 85% or more of the individual peptide or antibody molecules in a multiple antibody or antigen-binding fragment do not contain a fucosylation moiety. In some preferred embodiments, the defucosylated antibody or peptide, or a group or multiple defucosylated antibody or antigen-binding fragments thereof, contains asparagine (N) at EU position 297. Fucosylation or its absence can be evaluated using, for example, mass spectrometry (e.g., electrospray ionization mass spectrometry (ESI-MS)). In some embodiments, compositions comprising one or more of the currently disclosed peptides are provided, wherein the composition comprises a defucosylated peptide.

[0283] In some embodiments, the antibody or antigen-binding fragment can induce sustained protection in a subject, even when no detectable levels of the antibody or antigen-binding fragment are found in the subject (i.e., when the antibody or antigen-binding fragment has been cleared from the subject after administration). This protection is referred to herein as a vaccine effect. It is not desired to be bound by theory that dendritic cells can internalize antibody-antigen complexes and then induce or facilitate an endogenous immune response against the antigen. In some embodiments, the antibody or antigen-binding fragment contains one or more modifications, such as, for example, mutations in G236A, A330L, and I332E in Fc, which can activate dendritic cells capable of inducing, for example, T-cell immunity against the antigen.

[0284] In some embodiments, the antibody or antigen-binding fragment of this disclosure comprises an Fc variant selected from the Fc variants summarized in Table 1 (see also PCT Publication No. WO 2022 / 251119). In some embodiments, the Fc variant, or antibody or antigen-binding fragment, is fucosylated. In other embodiments, the Fc variant, or antibody or antigen-binding fragment, is defucosylated.

[0285] Table 1. Fc variants (fucosylated, unless otherwise stated) and their properties In some embodiments, an anti-sabevirus antibody or antigen-binding fragment is provided, which contains any of the described amino acid mutations (i)-(xix) in the human IgG1 heavy chain: (i) G236A, L328V, and Q295E; (ii) G236A, P230A, and Q295E; (iii) G236A, R292P, and I377N; (iv) G236A, K334A, and Q295E; (v) G236S, R292P, and Y300L; (vi) G236A and Y300L; (vii) G236A, R292P, and Y300L; (viii) G236S, G420V, G446E, and L309T; (ix) G236A and R292P; (x) R292P and Y300L; (xi) G236A and R292P; (xii) Y300L; (xiii) E345K, G236S, L235Y and S267E; (xiv) E272R, L309T, S219Y and S267E; (xv) G236Y; (xvi) G236W; (xvii) F243L, G446E, P396L and S267E; (xviii) G236A, S239D and H268E, and (xix) M252Y / S254T / T256E, wherein the amino acid residues are numbered according to the EU index as described in Kabat. In some embodiments, the antibody or antigen-binding fragment is defucosylated. In some embodiments, the antibody or antigen-binding fragment also includes one or more mutations that enhance binding to human FcRn, such as the M428L and N434S mutation or the M428L and N434A mutation (EU number), or any other mutation that enhances binding to human FcRn, such as those described herein. In some embodiments, the antibody or antigen-binding fragment is defucosylated.

[0286] In any of the embodiments disclosed herein, the antibody or antigen-binding fragment comprises an Fc polypeptide or a fragment thereof, including CH2 (or a fragment thereof), CH3 (or a fragment thereof), or CH2 and CH3, wherein CH2, CH3, or both can be any isotype and may contain amino acid substitutions or other modifications compared to the corresponding wild-type CH2 or CH3. In some embodiments, the Fc of this disclosure comprises two CH2-CH3 polypeptides that associate to form a dimer.

[0287] In any of the embodiments currently disclosed, the antibody or antigen-binding fragment may be monoclonal. As used herein, the term "monoclonal antibody" (mAb) refers to an antibody obtained from a substantially homogeneous population of antibodies, i.e., the individual antibodies constituting that population are identical except for possibly naturally occurring mutations that may be present (in some cases, in small amounts). Monoclonal antibodies are highly specific, targeting a single antigenic site. Furthermore, unlike polyclonal antibody formulations which contain different antibodies targeting different epitopes, each monoclonal antibody targets a single epitope of the antigen. In addition to their specificity, monoclonal antibodies have the advantage that they can be synthesized without contamination by other antibodies. The term "monoclonal" should not be construed as requiring the antibody to be produced by any particular method. For example, monoclonal antibodies that can be used in the present invention can be produced by methods first described by Kohler et al. Nature 256 The hybridoma method described in :495 (1975) can be used to prepare the hybridoma, or it can be prepared in bacterial, eukaryotic, or plant cells using recombinant DNA methods (see, for example, U.S. Patent No. 4,816,567). Alternatively, it can be prepared using, for example, Clackson et al. Nature, 352 :624-628 (1991) and Marks et al. , J. Mol.Biol., 222 Monoclonal antibodies can be isolated from phage antibody libraries using the techniques described in 581-597 (1991). Monoclonal antibodies can also be obtained using the methods disclosed in PCT Publication No. WO2004 / 076677A2.

[0288] The antibody-antigen binding fragments disclosed herein include “chimeric antibodies” in which a portion of the heavy chain and / or light chain is identical or homologous to a corresponding sequence in an antibody derived from a specific species or belonging to a specific antibody class or subclass, while the remainder of the chain is identical or homologous to a corresponding sequence in an antibody derived from another species or belonging to another antibody class or subclass, and fragments of such antibodies, provided they exhibit the desired biological activity (see, U.S. Patents 4,816,567; 5,530,101 and 7,498,415; and Morrison et al.). , Proc.Natl.Acad.Sci.USA, 81 (6851-6855 (1984)). For example, chimeric antibodies may contain human and non-human residues. Furthermore, chimeric antibodies may contain residues not found in receptor or donor antibodies. These modifications are made to further improve antibody performance. For more details, see Jones et al. , Nature 321:522-525 (1986); Riechmann et al. Nature 332:323-329 (1988); and Presta, Curr.Op.Struct.Biol.2:593-596 (1992). Chimeric antibodies also include primate-derived and humanized antibodies.

[0289] "Humanized antibodies" are generally considered to be human antibodies containing one or more amino acid residues introduced from a non-human source. These non-human amino acid residues are typically derived from variable domains. Humanization can be performed according to the method of Winter and colleagues (Jones et al.). Nature 321:522-525 (1986); Reichmann et al. Nature , 332:323-327 (1988); Verhoeyen et al., Science , 239:1534-1536 (1988)), specifically by replacing the corresponding sequence of a human antibody with a non-human variable sequence. Therefore, such "humanized" antibodies are chimeric antibodies (US Patent Nos. 4,816,567; 5,530,101 and 7,498,415), in which substantially less than the complete human variable domain has been replaced by a corresponding sequence from a non-human species. In some cases, "humanized" antibodies are produced by non-human cells or animals and contain human sequences (e.g., H...). C Antibodies (structural domains).

[0290] A "human antibody" is an antibody that contains only the sequences present in antibodies produced by humans. However, as used herein, human antibodies may contain residues or modifications not found in naturally occurring human antibodies (e.g., antibodies isolated from humans), including those modifications and variant sequences described herein. These are often made to further improve or enhance antibody performance. In some cases, human antibodies are produced by transgenic animals. See, for example, U.S. Patent Nos. 5,770,429; 6,596,541 and 7,049,426.

[0291] In some embodiments, the antibody or antigen-binding fragment of this disclosure is chimeric, humanized, or human.

[0292] In some embodiments, the antibody or antigen-binding fragment may be present in the antibody-drug conjugate (“ADC”), which comprises the antibody or antigen-binding fragment and a compound comprising or consisting of a small molecule active component (“drug”).

[0293] In specific implementation plans, the drug can be an antiviral agent capable of treating sabevir infection, particularly a drug capable of treating SARS-CoV-2 infection, such as nucleotide analogs or nucleotide analog prodrugs, such as remdesivir, sofosbuvir, acyclovir, zidovudine, favipiravir, nirmatrelvir (PF-07321332), lufotrelvir, atazanavir, ebselen, lopinavir, and levofloxacin. Ritavir, Danoprevir, Boceprevir, PBI-0451, EDP-235, S-217622, ​​13b, GC-376, GRL-0920, GRL-1720, IPA-3, JX-06, LN5535, S-217622, ​​EB2-7, EB2-19, GC-14, ML-300, ML-188, PF-07321332, PF-00835231, PF-07304814, N3, UAWJ9d-36-3, MI-09, MI-30, SH-5, YH-53, YH-71 and their Kronenberger... T, Laufer SA, Pillaiyar T. COVID-19therapeutics: Small-molecule drug development targeting SARS-CoV-2 mainprotease Drug Discov Today The variants and any combination thereof described in . June 2023; 28(6):103579.

[0294] In specific implementation plans, the drug can be an anti-inflammatory agent, such as dexamethasone or prednisone.

[0295] In some implementations, the ADC may contain both antiviral and anti-inflammatory agents.

[0296] In some implementations, the antibody or antigen-binding fragment may comprise, consist substantially of, or be composed of any S2V29-v37.2 or variant thereof described herein.

[0297] In some implementations, the ADC may further include a conjugation adapter that may be able to bind to both the antibody or antigen-binding fragment and the small molecule.

[0298] As described herein, ADCs containing antibody or antigen-binding fragments may include various drug-to-antibody ratios (DAR) (i.e., the ratio of the total number of active small molecules attached to the antibody or antigen-binding fragment; DAR is typically reported as the average of conjugate molecules in the sample), various linker-to-antibody ratios (LAR) (i.e., the total number of conjugate and linker sites per antibody or antigen-binding fragment; LAR may be reported as the average of conjugate molecules in the sample), or both. In some embodiments, two ADC molecules may have different DARs but the same LAR. In other embodiments, two ADC molecules may have different LARs but the same or different DARs. In some embodiments, the DAR may be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 21, 32, or greater. In some implementations, the DAR is 1-5, 6-10, 11-15, 16-20, 21-25, 26-30, 31-35, or greater than 35. In some implementations, the DAR is 1-8, 9-12, 13-18, 19-22, 23-28, 29-32, 33-38, or greater than 38.

[0299] In some implementations, the LAR can be 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 21, 32 or greater. In some implementations, the LAR is 1-5, 6-10, 11-15, 16-20, 21-25, 26-30, 31-35 or greater than 35. In some implementations, the LAR is 1-8, 9-12, 13-18, 19-22, 23-28, 29-32, 33-38 or greater than 38.

[0300] In some embodiments, the ratio of drug molecule to linker molecule in the ADC is 1:1, 2:1, 4:1, or greater. In some embodiments, the ADC may contain: 7 LARs and 7 DARs; 4 LARs and 8 DARs; 5 LARs and 10 DARs; 6 LARs and 12 DARs; 16 LARs and 32 DARs; or 8 LARs and 32 DARs. In some embodiments, the ADC has 5 LARs and 10 DARs. In some embodiments, the ADC has 6 LARs and 12 DARs. The comparison of DARs to LARs in an ADC can be expressed as DAR / LAR; for example, an ADC containing DAR 3 and LAR 3 has a DAR / LAR ratio of 1. As another example, an ADC containing DAR 6 and LAR 3 has a DAR / LAR ratio of 2. As yet another example, an ADC containing DAR 12 and LAR 3 has a DAR / LAR ratio of 4.

[0301] DAR or LAR can be determined, for example, by full mass spectrometry analysis of deglycosylated ADCs. The molecular weights of the small molecules and antibody components are used to match each peak in the spectrum with the DAR or LAR. In some embodiments, for the purpose of defining each batch of ADC prepared, the reported DAR or LAR refers to the highest intensity peak of the mass distribution. In some embodiments, the DAR or LAR is reported as the average value of the ADC molecules within the sample.

[0302] In some embodiments, the ADC retains or substantially retains one or more antibody effector functions of the parent antibody or antigen-binding fragment (i.e., the antibody or antigen-binding fragment not conjugated to the drug). In some embodiments, the in vivo half-life of the ADC in a subject is substantially the same as or greater than the half-life of the unconjugated antibody or antigen-binding fragment.

[0303] In some implementations, the coupling linker can be a bivalent, trivalent, or tetravalent linker. A "bivalent linker" refers to a continuous chain of atoms containing two parts of the same molecule bonded by single bonds. A "trivalent linker" refers to a continuous chain of atoms containing three parts of the same molecule bonded by single bonds. A "tetravalent linker" refers to a continuous chain of atoms containing four parts of the same molecule bonded by single bonds.

[0304] In some embodiments, the conjugation linker may include a chemical linker, such as an alkylene linker, a heteroalkylene linker (e.g., a polyethylene glycol (PEG) linker), or a combination thereof. In some embodiments, the conjugation linker is positioned between and connects an antibody or antigen-binding fragment and the active moiety of a drug (i.e., having or derived from a compound with antiviral activity). The conjugation linker may contain one or more PEG units (i.e., -(CH2CH2O)).n - where n represents the number of PEG units. In some embodiments, the splice joint contains 5, 6, 7, 8, 9 or 10 PEG units, or more than 10 PEG units.

[0305] In some implementations, the conjugated linker is a non-cleavable linker. The term "non-cleavable linker" refers to a linker that covalently binds to both the antibody or antigen-binding fragment and the drug under normal physiological conditions. Generally, "normal physiological conditions" include a temperature of approximately 20°C to 40°C, an atmospheric pressure of approximately 1 atmosphere (101 kPa or 14.7 psi), a pH of approximately 6 to 8, a glucose concentration of approximately 1 mM to 20 mM, an atmospheric oxygen concentration, and gravity. In some implementations, physiological conditions include the presence of an enzyme (i.e., a protease or nuclease).

[0306] In some implementations, the splice adapter is a cleavable adapter. The term "cleavable adapter" refers to an adapter that no longer covalently binds to antibody or antigen-binding fragments and drugs after exposure to normal physiological conditions for a period of time (such as 1 minute, 5 minutes, 10 minutes, or 30 minutes).

[0307] In a specific implementation, the conjugation linker can bind to the antibody or antigen-binding fragment at a location other than VH or VL.

[0308] Polynucleotides, vectors, DNA therapeutics, RNA therapeutics, and host cells In another aspect, this disclosure provides isolated polynucleotides that encode any currently disclosed antibody or antigen-binding fragment or a portion thereof (e.g., CDR, VH, VL, heavy chain, or light chain). In some embodiments, the polynucleotide is codon-optimized for expression in host cells. Once the coding sequence is known or identified, known techniques and tools (e.g., using GenScript) can be used. ® OptimiumGene ™ Tools) for codon optimization; see also Scholten et al., Clin.Immunol.119 (135, 2006). Codon-optimized sequences include partially codon-optimized sequences (i.e., one or more codons are optimized for expression in the host cell) and fully codon-optimized sequences.

[0309] It should also be understood that, due to factors such as the degeneracy of the genetic code and splicing, the polynucleotides encoding the antibody and antigen-binding fragments disclosed herein may have different nucleotide sequences while still encoding the same antibody or antigen-binding fragment.

[0310] In any of the currently disclosed embodiments, the polynucleotide may comprise deoxyribonucleic acid (DNA) or ribonucleic acid (RNA). In some embodiments, the RNA includes messenger RNA (mRNA), more specifically circRNA, taRNA, or saRNA. In some embodiments, the polynucleotide is optimized for expression in host cells. In embodiments where the polynucleotide comprises taRNA or saRNA, one or more sequences encoding a replication protein or peptide, one or more sequences encoding an antibody or antigen-binding fragment, or combinations thereof may be optimized for expression in human cells.

[0311] In some embodiments, the polynucleotide comprises, is substantially composed of, or is composed of a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 89%, 92%, 96, 100, 104, 108, 112, 136, 138, 141, 165, 169, 173, 176, 178, 181, 183, 76, 80, 115, 118, 121, 124, 127, 130, 132, 134, 144, 149, 151, 154, 158, and 162) identity with any one of the nucleic acid sequences. In a more specific embodiment, the polynucleotide comprises, is substantially composed of, or is composed of a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a nucleic acid sequence according to any one of SEQ ID NOs: 165, 169, 173, 176, 178, 181, and 183. In a further embodiment in which the polynucleotide is saRNA, all T bases in the aforementioned sequence may be replaced by U bases, and the first polynucleotide may further comprise a nucleic acid sequence encoding a replication protein or peptide, such as SEQ ID NOs: 249 to 250. In other further embodiments in which the polynucleotide is taRNA, a second polynucleotide is provided comprising a nucleic acid sequence encoding a replication protein or peptide suitable for inducing replication of the first polynucleotide.

[0312] In other, more specific embodiments, at least two polynucleotides are provided, wherein the first polynucleotide comprises, is substantially composed of, or is composed of a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 92, 96, 100, 104, 108, 112, 136, 138, 141, 165, 169, 173, 176, 178, 181, and 183) identity with any one of these nucleic acid sequences, and the second polynucleotide comprises, is substantially composed of, or is composed of a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with any one of these sequences, and the second polynucleotide comprises, is substantially composed of, ...99%, or 100%) identity with any one of these sequences, and the second polynucleotide comprises, is substantially composed of, a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 99%, or 100%) identity with any one of these sequences, and the second polynucleotide comprises, is substantially composed of, a nucleic acid sequence having The nucleic acid sequences of any one of 76, 80, 115, 118, 121, 124, 127, 130, 132, 134, 144, 149, 151, 154, 158, and 162 have at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity, are substantially composed of, or are composed of, these sequences. In a further embodiment where the polynucleotide is saRNA, all T bases in the aforementioned sequences may be replaced by U bases, and the first polynucleotide may further comprise a nucleic acid sequence encoding a replication protein or peptide, such as SEQ ID NO: 249 to 250. In other further embodiments where the polynucleotide is taRNA, a third polynucleotide is provided, which comprises a nucleic acid sequence encoding a replication protein or peptide suitable for inducing replication of the first and second polynucleotides.

[0313] In a more specific embodiment, at least two polynucleotides are provided, wherein the first polynucleotide comprises, is substantially composed of, or is composed of a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a nucleic acid sequence according to any one of SEQ ID NO: 165, 169, 173, 176, 178, 181, and 183, and the second polynucleotide comprises, is substantially composed of, a nucleic acid sequence according to SEQ ID NO: Nucleic acid sequences of any one of 76, 80, 115, 118, 121, 124, 127, 130, 132, 134, 144, 149, 151, 154, 158, and 162 have at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity, are substantially composed of, or are composed of.

[0314] In some embodiments where the antibody or antigen-binding fragment is S2V29-v37.2 or a variant thereof, the polynucleotide comprises, is substantially composed of, or is composed of a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with a nucleic acid sequence according to one or more of SEQ ID NO: 115 and 183. In some embodiments, the polynucleotide having at least 85% identity with a nucleic acid sequence according to SEQ ID NO: 183 may comprise a nucleic acid sequence according to one or more of SEQ ID NO: 225 to 227, 231 to 234, and 239 to 245. In some embodiments, the polynucleotide having at least 85% identity with the nucleic acid sequence according to SEQ ID NO: 115 may comprise one or more nucleic acid sequences according to SEQ ID NO: 228 to 230, 235 to 238 and 246 to 248.

[0315] In some embodiments, the polynucleotide comprises, is substantially composed of, or is composed of a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the nucleic acid sequence according to SEQ ID NO: 183. In some embodiments, the polynucleotide having at least 85% identity with the nucleic acid sequence according to SEQ ID NO: 183 may comprise nucleic acid sequences of one or more of SEQ ID NO: 225 to 227, 231 to 234, and 239 to 245.

[0316] In a more specific embodiment, at least two polynucleotides are provided, wherein the first polynucleotide comprises, is substantially composed of, or is composed of, a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the nucleic acid sequence according to SEQ ID NO: 83, and the second polynucleotide comprises, is substantially composed of, or is composed of, a nucleic acid sequence having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the nucleic acid sequence according to SEQ ID NO: 115. In some embodiments, the polynucleotide having at least 85% identity with the nucleic acid sequence according to SEQ ID NO: 183 may comprise one or more nucleic acid sequences according to SEQ ID NO: 225 to 227, 231 to 234, and 239 to 245. In some embodiments, the polynucleotide having at least 85% identity with the nucleic acid sequence according to SEQ ID NO: 115 may comprise one or more nucleic acid sequences according to SEQ ID NO: 228 to 230, 235 to 238, and 246 to 248.

[0317] In a further embodiment in which the polynucleotide is mRNA, one or more of the first and second polynucleotides, and optionally both, are saRNA, and further comprise a nucleic acid sequence encoding a replication protein or peptide. In other further embodiments in which the polynucleotide is mRNA, a third polynucleotide is provided, comprising a nucleic acid sequence encoding a replication protein or peptide suitable for inducing replication of the first and second polynucleotides.

[0318] Vectors are also provided, wherein such vectors contain or contain polynucleotides as disclosed herein (e.g., polynucleotides encoding antibody or antigen-binding fragments that bind to two or more sabeviruses).

[0319] The vector may include any one or more of the vectors disclosed herein. In a particular embodiment, a vector is provided that comprises a DNA plasmid construct encoding an antibody or antigen-binding fragment or a portion thereof (e.g., a so-called "DMAb"; see, for example, Muthumani et al.). J Infect Dis.214 (3):369-378 (2016); Muthumani et al. Hum Vaccin Immunother9 :2253-2262 (2013); Flingai et al. Sci Rep.5 :12616 (2015); and Elliott et al. NPJ Vaccines18 (2017), the antibody-encoding DNA construct and related methods of use (including its application) are incorporated herein by reference. In some embodiments, the DNA plasmid construct comprises a single open reading frame encoding a heavy chain and a light chain (or VH and VL) encoding an antibody or antigen-binding fragment, wherein the sequence encoding the heavy chain and the sequence encoding the light chain are optionally separated by a polynucleotide encoding a protease cleavage site and / or a polynucleotide encoding a self-cleaving peptide. In some embodiments, the replacement component of the antibody or antigen-binding fragment is encoded by a polynucleotide contained in a single plasmid. In other embodiments, the replacement component of the antibody or antigen-binding fragment is encoded by a polynucleotide contained in two or more plasmids (e.g., a first plasmid contains a polynucleotide encoding a heavy chain, VH, or VH+CH, and a second plasmid contains a polynucleotide encoding a homologous light chain, VL, or VL+CL). In some embodiments, a single plasmid contains a polynucleotide encoding a heavy chain and / or a light chain from two or more antibody or antigen-binding fragments of the present disclosure. Exemplary expression vectors are available from Invitrogen. ® pVax1 was obtained. The DNA plasmid disclosed herein can be delivered to the subject, for example, by electroporation (e.g., intramuscular electroporation) or with a suitable formulation (e.g., hyaluronidase).

[0320] In some embodiments, the vector may comprise or consist of circRNA, taRNA, or saRNA. In embodiments where the RNA therapeutic agent comprises a naked circRNA, taRNA, or saRNA vector, the circRNA, taRNA, or saRNA may specifically contain a modified nucleoside or other modifications disclosed herein to facilitate delivery into human host cells and expression therein.

[0321] Similarly, naked DNA vectors or other naked DNA therapeutics may contain modifications to facilitate delivery into human host cells and expression therein.

[0322] DNA therapeutics and RNA therapeutics, including circRNA therapeutics, taRNA therapeutics or saRNA therapeutics, are also provided, wherein the DNA therapeutics or RNA therapeutics contain or contain polynucleotides as disclosed herein (e.g., polynucleotides encoding antibody or antigen-binding fragments that bind to two or more sabeviruses).

[0323] In another aspect, this disclosure also provides a host cell that expresses an antibody or antigen-binding fragment according to this disclosure; or contains or includes a DNA therapeutic agent, RNA therapeutic agent, vector, or polynucleotide according to this disclosure.

[0324] Examples of such cells include, but are not limited to, eukaryotic cells such as yeast cells, animal cells, insect cells, and plant cells; and prokaryotic cells, including Escherichia coli (E. coli). E. coli In some embodiments, the cells are mammalian cells. In some such embodiments, the cells are mammalian cell lines, such as CHO cells (e.g., DHFR-CHO cells (Urlaub et al.)). PNAS 77:4216 (1980)), human embryonic kidney cells (e.g., HEK293T cells), PER.C6 cells, Y0 cells, Sp2 / 0 cells. NS0 cells, human hepatocytes, such as Hepa RG cells, myeloma cells, or hybridoma cells. Other examples of mammalian host cell lines include: mouse supporting cells (e.g., TM4 cells); SV40-transformed monkey kidney CV1 line (COS-7); young hamster kidney cells (BHK); African green monkey kidney cells (VERO-76); monkey kidney cells (CV1); human cervical cancer cells (HELA); human lung cells (W138); human hepatocytes (Hep G2); canine kidney cells (MDCK); buffalo rat hepatocytes (BRL 3A); mouse mammary tumors (MMT 060562); TRI cells; MRC 5 cells; and FS4 cells. Suitable mammalian host cell lines for antibody production also include those described in the following literature: for example, Yazaki and Wu, Methods in Molecular Biology Volume 248 (edited by BKCLo, Humana Press, Totowa, NJ), pp. 255-268 (2003).

[0325] In some implementations, the host cell is a prokaryotic cell, such as *Escherichia coli*. The expression of peptides in prokaryotic cells such as *E. coli* is well-established (see, for example, Pluckthun, A). Bio / Technology 9:545-551 (1991). For example, antibodies can be produced in bacteria, especially when glycosylation and Fc effector function are not required. For the expression of antibody fragments and peptides in bacteria, see, for example, U.S. Patent Nos. 5,648,237; 5,789,199; and 5,840,523.

[0326] In certain embodiments, cells may be transfected using vectors, DNA therapeutics, or RNA therapeutics and expression vectors according to this specification. The term "transfection" refers to the introduction of nucleic acid molecules, such as DNA or RNA (e.g., mRNA), into cells, such as into eukaryotic cells. In the context of this specification, the term "transfection" encompasses any method known to those skilled in the art for introducing nucleic acid molecules into cells, such as into eukaryotic cells, including into mammalian cells. Such methods encompass, for example, electroporation, lipid transfection (e.g., based on cationic lipids and / or liposomes), calcium phosphate precipitation, nanoparticle-based transfection, virus-based transfection, or transfection based on cationic polymers (such as DEAE-glucan or polyethyleneimine). In some embodiments, the introduction is non-viral.

[0327] Furthermore, host cells of this disclosure can be stably or transiently transfected using vectors, DNA therapeutics, or RNA therapeutics according to this disclosure, for example, to express antibodies or antigen-binding fragments according to this disclosure. In such embodiments, transfected cells can be stably transfected using vectors or DNA therapeutics as described herein. Alternatively, cells can be transiently transfected using vectors, DNA therapeutics, or RNA therapeutics according to this disclosure encoding antibodies or antigen-binding fragments as disclosed herein. In any of the embodiments currently disclosed, the polynucleotide may be heterologous to the host cell.

[0328] Therefore, this disclosure also provides recombinant host cells that heterologously express the antibodies or antigen-binding fragments of this disclosure. For example, the cells may be of a different species than the species from which the antibody is obtained, either fully or partially (e.g., CHO cells expressing human antibodies or engineered human antibodies). In some embodiments, the cell type of the host cell does not express the antibody or antigen-binding fragment in nature. Furthermore, the host cell may confer post-translational modifications (PTMs; e.g., glycosylation or fucosylation) on the antibody or antigen-binding fragment that are not present in the native state of the antibody or antigen-binding fragment (or in the native state of the parent antibody of the engineered or derived antibody or antigen-binding fragment). Such PTMs can lead to functional differences (e.g., reduced immunogenicity). Thus, antibodies or antigen-binding fragments of this disclosure produced by host cells as disclosed herein may contain one or more post-translational modifications that differ from antibodies (or parent antibodies) in their native state (e.g., human antibodies produced by CHO cells may contain multiple post-translational modifications that differ from antibodies isolated from humans and / or produced by natural human B cells or plasma cells).

[0329] Insect cells that can be used to express the binding proteins of this disclosure are known in the art, and include, for example, the fall armyworm (…). Spodoptera frugiperaSf9 cells, Trichoplusia in BTI-TN5B1-4 cells, and fall armyworm SfSWT01 “Mimic” cells ™ "Cells. See, for example, Palmerger et al." J. Biotechnol. 152 (3-4):160-166 (2011). Many baculovirus strains have been identified that can be used in combination with insect cells, particularly for transfection of fall armyworm cells.

[0330] Eukaryotic microorganisms (such as filamentous fungi or yeast) are also suitable hosts for cloning or expressing protein-coding vectors, DNA therapeutics, or RNA therapeutics, including fungal and yeast strains with “humanized” glycosylation pathways, thereby producing antibodies with partial or complete human glycosylation patterns. See Gerngross. Nat. Biotech. 22:1409-1414 (2004); Li et al. , Nat. Biotech. 24:210-215 (2006).

[0331] Plant cells can also be used as hosts for expressing the binding proteins disclosed herein. For example, PLANTIBODIES ™ The technology (described, for example, in U.S. Patent Nos. 5,959,177; 6,040,498; 6,420,548; 7,125,978; and 6,417,429) uses genetically modified plants to produce antibodies.

[0332] In some embodiments, the host cell includes mammalian cells. In specific embodiments, the host cell is CHO cells, HEK293 cells, PER.C6 cells, Y0 cells, Sp2 / O cells, NSO cells, human hepatocytes, myeloma cells, or hybridoma cells.

[0333] In some embodiments involving RNA therapeutics, particularly circRNA, taRNA, or saRNA or DNA therapeutics, the host cell for production can be any host cell described above or otherwise disclosed herein. The in vivo human host cell can be any cell that serves as the host cell as described above or otherwise disclosed herein.

[0334] In related aspects, this disclosure provides methods for generating antibodies or antigen-binding fragments, wherein the method includes culturing host cells of this disclosure under conditions and for a time sufficient to generate antibodies or antigen-binding fragments. For example, methods for isolating and purifying recombinantly generated antibodies may include obtaining a supernatant from a suitable host cell / carrier system that secretes recombinant antibodies into a culture medium, and then concentrating the culture medium using a commercially available filter. After concentration, the concentrate may be applied to a single suitable purification matrix or a series of suitable matrices, such as an affinity matrix or an ion exchange resin. One or more reverse-phase HPLC steps may be used to further purify the recombinant peptide. These purification methods may also be used when isolating immunogens from their native environment. Methods for large-scale generation of one or more of the isolated / recombinant antibodies described herein include batch cell culture, which is monitored and controlled to maintain appropriate culture conditions. Purification of soluble antibodies may be performed according to methods described herein and those known in the art that comply with the laws and regulations of domestic and international regulatory agencies.

[0335] Composition This document also provides compositions comprising, alone or in any combination of, any one or more currently disclosed antibodies, antigen-binding fragments, ADCs, polynucleotides, vectors, DNA therapeutics, RNA therapeutics (including circRNA, taRNA, and saRNA therapeutics), or host cells, and may further comprise pharmaceutically acceptable loaders, excipients, or diluents. Loaders, excipients, and diluents are discussed in further detail herein.

[0336] In some embodiments, the composition comprises an antibody or antigen-binding fragment of S2V29-v37.2 or a variant thereof and VL, or according to a CDR comprising VH and VL respectively comprising the amino acid sequences according to SEQ ID NO: 184 and 113, or a variant thereof specifically described herein in the description of the S2V29-v37.2 variant antibody.

[0337] In some embodiments, the composition comprises two or more different antibody or antigen-binding fragments according to the present disclosure. In some embodiments, the antibody or antigen-binding fragments used for combination each independently have one or more of the following properties: neutralization of one, two, three, four, five or more naturally occurring sabevirus variant lineages; non-competitive with each other for spike protein binding; binding to different sabevirus spike protein epitopes; reduced formation of resistance to sabevirus; reduced formation of resistance to sabevirus when combined; effective neutralization of one, two, three, four, five or more live sabeviruses; exhibiting an additive or synergistic effect of neutralization of one, two, three, four, five or more live sabeviruses when used in combination; exhibiting effector function; providing protection in relevant animal infection models; and being able to be produced in sufficient quantities for large-scale production. In one specific embodiment, one or more sabeviruses may be SARS-CoV-2 or SARS-CoV. In another specific embodiment, at least two sabeviruses may be SARS-CoV-2 and SARS-CoV.

[0338] In some embodiments: the composition comprises a first antibody or antigen-binding fragment and a second antibody or antigen-binding fragment; a multispecific (e.g., bispecific) antibody or antigen-binding fragment is provided; or the combination therapy comprises a first antibody or antigen-binding fragment and a second antibody or antigen-binding fragment, wherein the first antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3, and optionally VH and VL, which are any S2V29 antibodies described herein and any antibodies having VH and VL having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequences according to SEQ ID NO: 14 and 15; 16 and 17; 18 and 19; 20 and 21; 22 and 23; 24 and 25; 26 and 27; or 28 and 29, respectively.

[0339] In some embodiments comprising an antibody or antigen-binding fragment of S2V29-v37.2 or a variant thereof, the first antibody or antigen-binding fragment comprises CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3, and optionally VH and VL, wherein the VH and VL are based on, and optionally on, any antibody having at least 85% (e.g., 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identity with the amino acid sequences according to SEQ ID NO: 184 and 113, respectively. More specifically, the first antibody or antigen-binding fragment may be an antibody or antigen-binding fragment of S2V29-v37.2 or a variant thereof, as specifically described herein.

[0340] In some implementations, the antibody or antigen-binding fragment described above is present in the ADC.

[0341] In some embodiments, the composition comprises a polynucleotide, a carrier, an RNA therapeutic agent, or a DNA therapeutic agent.

[0342] In some embodiments, the composition comprises a single polynucleotide encoding i) a heavy chain, VH, or VH+CH; and ii) a homologous light chain, VL, or VL+CL. In some such embodiments, the polynucleotide is saRNA and further encodes a replication protein or peptide. In some embodiments, the polynucleotide is circRNA.

[0343] In some embodiments, the composition comprises a first taRNA encoding i) a heavy chain, VH, or VH+CH; and ii) a homologous light chain, VL, or VL+CL; and a second taRNA encoding a replication protein or peptide. In some embodiments, one or both of the first and second taRNAs are circRNAs.

[0344] In some embodiments, the composition comprises a heavy chain, VH, or VH+CH, encoding an antibody or antigen-binding fragment, and a homologous light chain, VL, or VL+CL, encoding the antibody or antigen-binding fragment. In some such embodiments where the polynucleotide is mRNA, the first polynucleotide, the second polynucleotide, or both are saRNA or taRNA, and further encode a replication protein or peptide. In some embodiments, one or more, at least two, or all of the polynucleotides are circRNA.

[0345] In some embodiments, the composition comprises a first mRNA encoding a heavy chain, VH, or VH+CH, that encodes an antibody or antigen-binding fragment, and a second mRNA encoding a homologous light chain, VL, or VL+CL, that encodes the antibody or antigen-binding fragment. In some such embodiments, where the polynucleotide is mRNA, the composition is a taRNA composition comprising a third taRNA encoding a replication protein or peptide. In some embodiments, one or more, at least two, or all of the polynucleotides are circRNAs.

[0346] In a specific implementation, the composition can be formulated for intramuscular administration.

[0347] Methods and uses This document also provides methods for diagnosing sabevirus infection (e.g., in human subjects or in samples obtained from human subjects) using antibodies or antigen-binding fragments, ADCs, nucleic acids, vectors, cells, or compositions disclosed herein.

[0348] Diagnostic methods (e.g., in vitro, ex vivo) may include contacting an antibody, antibody fragment (e.g., antigen-binding fragment), with a sample. Such samples may be isolated from a subject, such as isolated tissue samples obtained from, for example, the nasal passages, sinuses, salivary glands, lungs, liver, pancreas, kidneys, ears, eyes, placenta, digestive tract, heart, ovaries, pituitary gland, adrenal glands, thyroid gland, brain, skin, or blood. Diagnostic methods may also include detecting antigen / antibody complexes, particularly after contacting the sample with an antibody or antibody fragment. This detection step can be performed benchtop, i.e., without any contact with the human or animal body. Examples of detection methods are well known to those skilled in the art and include, for example, ELISA (enzyme-linked immunosorbent assay), including direct, indirect, and sandwich ELISA.

[0349] This document also provides methods for treating subjects using antibodies or antigen-binding fragments or ADCs of the present disclosure, or compositions comprising such antibodies or antigen-binding fragments, wherein the subject has, is believed to have, or is at risk of having an infection caused by sabevirus. “Treatment” or “improvement” refers to the medical management of a disease, disorder, or condition in a subject (e.g., a human or non-human mammal, such as a primate, horse, cat, dog, goat, mouse, or rat). Generally, an appropriate dose or treatment regimen comprising the antibodies or compositions of the present disclosure is administered in an amount sufficient to elicit a therapeutic or preventive benefit. Therapeutic or preventive / preventive benefits include improved clinical outcomes; reduction or relief of disease-related symptoms; reduced symptom occurrence; improved quality of life; longer disease-free status; reduction in disease severity; stabilization of disease status; delay or prevention of disease progression; remission; survival; prolonged survival; or any combination thereof. In some embodiments, the therapeutic or preventive / preventive benefit includes a reduction or prevention of hospitalization for the treatment of sabevirus infection (i.e., in a statistically significant manner). In some embodiments, therapeutic or preventive / protective benefits include a reduction in the duration of hospitalization for treatment of sabevir infection (i.e., in a statistically significant manner). In some embodiments, therapeutic or preventive / protective benefits include a reduction or elimination of the need for respiratory interventions such as intubation and / or the use of ventilator devices. In some embodiments, therapeutic or preventive / protective benefits include reversal of late-stage disease pathology and / or reduced mortality.

[0350] The term "therapeutic effective amount" or "effective amount" for antibodies, antigen-binding fragments, ADCs, polynucleotides, vectors, DNA therapeutic agents, RNA therapeutic agents, host cells, or related compositions disclosed herein refers to an amount of composition or molecule sufficient to produce a therapeutic effect, including improved clinical outcomes; reduction or relief of disease-related symptoms; reduced symptom occurrence; improved quality of life; longer disease-free status; reduction in disease severity; stabilization of disease status; delay in disease progression; remission; survival; or prolonged survival (in a statistically significant manner). When referring to a single active ingredient administered alone, the therapeutic effective amount refers to the individual effect of that ingredient or cells expressing that ingredient. When referring to a combination, the therapeutic effective amount refers to the combined amount of an active ingredient or co-active ingredient of the combination with cells expressing the active ingredient that produces the therapeutic effect, whether administered sequentially, successively, or simultaneously. Combinations may include, for example, two different antibodies that specifically bind to sabevirus antigens, which in some embodiments may be the same or different sabevirus antigens, and / or may contain the same or different epitopes.

[0351] Therefore, in some embodiments, a method for treating a subject with sabevirus infection is provided, wherein the method includes administering to the subject an effective amount of an antibody, antigen-binding fragment, polynucleotide, vector, DNA therapeutic agent, RNA therapeutic agent, host cell, or composition disclosed herein.

[0352] Generally, subjects who can be treated with this disclosure are human and other primate subjects, such as monkeys and apes for veterinary purposes. Other model organisms such as mice and rats can also be treated according to this disclosure. In any of the foregoing embodiments, the subject can be a human subject. The subject can be male or female and can be of any suitable age, including infants, adolescents, teenagers, adults, and elderly subjects.

[0353] Many criteria are considered to contribute to a high risk of severe symptoms or death associated with sabevirus infection. These criteria include, but are not limited to, age, occupation, general health status, pre-existing health conditions, and lifestyle habits. In some implementations, subjects treated according to this disclosure have one or more risk factors.

[0354] In some embodiments, the subjects treated according to this disclosure are infants, children, young adults, middle-aged adults, or older adults. In some embodiments, the subjects treated according to this disclosure are less than 1 year old, or 1 to 5 years old, or between 5 and 125 years old (e.g., 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 105, 110, 115, or 125 years old, including any and all ages therein). In some embodiments, the subjects treated according to this disclosure are 0 to 19 years old, 20 to 44 years old, 45 to 54 years old, 55 to 64 years old, 65 to 74 years old, 75 to 84 years old, or 85 years old or older. Middle-aged people, especially older people, are believed to have specific risks. In certain embodiments, the human subjects are aged 45 to 54, 55 to 64, 65 to 74, 75 to 84, or 85 or older. In some embodiments, the human subjects are male. In some embodiments, the human subjects are female.

[0355] In some implementations, the subjects treated according to this disclosure are residents of nursing homes or long-term care facilities, hospice caregivers, healthcare providers or healthcare workers, first responders, family members or other close contacts of subjects diagnosed with or suspected of having sabevirus infection, overweight or clinically obese, are or have been smokers, have or have had chronic obstructive pulmonary disease (COPD), have asthma (e.g., moderate to severe asthma), have an autoimmune disease or condition (e.g., diabetes), and / or have a compromised or weakened immune system (e.g., due to AIDS / HIV infection, cancers such as blood cancer, lymphocyte removal therapies such as chemotherapy, bone marrow or organ transplantation, or genetic immune disorders), have chronic liver disease, have cardiovascular disease, have lung or heart defects, work or otherwise spend time in close proximity to others (e.g., in a factory, shipping center, or hospital setting), etc.

[0356] In some implementations, the subjects treated according to this disclosure have received a vaccine against sabevirus, and the vaccine has been determined to be ineffective, for example, by means of post-vaccination infection or symptoms in the subjects, as determined by clinical diagnosis or scientific or regulatory guidelines.

[0357] In some implementations, treatment is administered as peri-exposure prophylaxis. In some implementations, treatment is administered to subjects with mild to moderate illness, and this treatment may be administered in an outpatient setting. In some implementations, treatment is administered to subjects with moderate to severe illness, such as those requiring hospitalization.

[0358] Therefore, typical routes of administration of the currently disclosed compositions include, but are not limited to, oral, topical, percutaneous, inhalation, parenteral, sublingual, buccal, rectal, vaginal, and intranasal administration. As used herein, the term "parenteral" includes subcutaneous, intravenous, intramuscular, intrasternal injection, or infusion techniques. In some embodiments, administration includes administration via a route selected from: oral, intravenous, parenteral, gastric, intrapleural, intrapulmonary, intrarectal, intradermal, intraperitoneal, intratumoral, subcutaneous, topical, percutaneous, intracisional, intrathecal, intranasal, and intramuscular. In specific embodiments, the method includes oral administration of an antibody, antigen-binding fragment, polynucleotide, vector, DNA therapeutic agent, RNA therapeutic agent, host cell, or composition to a subject.

[0359] In one specific implementation, administration may be intramuscular. In other implementations, administration may be intravenous.

[0360] Pharmaceutical compositions according to certain embodiments of the invention are formulated such that the active ingredient contained therein is bioavailable when administered to a patient. The composition to be administered to a subject or patient may be in the form of one or more dose units, wherein, for example, a tablet may be a single dose unit, and a container of the antibody or antigen-binding fragment described herein in the form of an aerosol may contain multiple dose units. Practical methods for preparing such dosage forms are known or will be obvious to those skilled in the art; see, for example, Remington: The Science and Practice of Pharmacy, 20th edition (Philadelphia College of Pharmacy and Science, 2000). In any case, the composition to be administered will contain an effective amount of the antibody or antigen-binding fragment, polynucleotide, carrier, DNA therapeutic agent, RNA therapeutic agent, host cell, or composition disclosed herein for the treatment of a disease or condition of interest in accordance with the teachings herein.

[0361] The composition may be in solid or liquid form. In some embodiments, the carrier is granular, such that the composition is in tablet or powder form, for example. The carrier may be liquid, and the composition may be, for example, an oral oil, an injectable liquid, or an aerosol suitable for, for example, inhalation. When intended for oral administration, the pharmaceutical composition is preferably in solid or liquid form, wherein semi-solid, semi-liquid, suspension, and gel forms are included in forms considered solid or liquid herein.

[0362] As a solid composition intended for oral administration, the pharmaceutical composition may be formulated into powders, granules, compressed tablets, pills, capsules, chewing gum, films, etc. Such solid compositions typically contain one or more inert diluents or edible carriers. In addition, one or more of the following may be present: binders, such as carboxymethyl cellulose, ethyl cellulose, microcrystalline cellulose, tragacanth gum, or gelatin; excipients, such as starch, lactose, or dextrin; disintegrants, such as alginate, sodium alginate, sodium carboxymethyl starch (Primogel), corn starch, etc.; lubricants, such as magnesium stearate or hydrogenated castor oil (Sterotex); flow aids, such as colloidal silica; sweeteners, such as sucrose or saccharin; flavoring agents, such as peppermint, methyl salicylate, or orange flavorings; and coloring agents. When the composition is in capsule form (e.g., gelatin capsules), in addition to the materials of the above types, it may also contain a liquid carrier, such as polyethylene glycol or oil.

[0363] The composition may be in liquid form, such as an elixir, syrup, solution, emulsion, or suspension. As two examples, the liquid may be for oral administration or for injection delivery. When intended for oral administration, the preferred composition, in addition to the compounds of the present invention, contains one or more of a sweetener, preservative, dye / coloring agent, and flavor enhancer. In compositions intended for injection administration, one or more of a surfactant, preservative, wetting agent, dispersant, suspending agent, buffer, stabilizer, and isotonic agent may be included.

[0364] Liquid pharmaceutical compositions, whether in solution, suspension, or other similar form, may include one or more of the following adjuvants: sterile diluents, such as water for injection, saline solution, preferably physiological saline, Ringer's solution, or isotonic sodium chloride; fixing oils, such as synthetic monoglycerides or diglycerides, polyethylene glycol, glycerol, propylene glycol, or other solvents that can be used as a solvent or suspension medium; antimicrobial agents, such as benzyl alcohol or methylparaben; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates, or phosphates; and agents for tension regulation, such as sodium chloride or dextran. Parenteral preparations may be encapsulated in ampoules, disposable syringes, or multi-dose vials made of glass or plastic. Physiological saline is a preferred adjuvant. Injectable pharmaceutical compositions are preferably sterile.

[0365] Liquid compositions intended for parenteral or oral administration should contain an amount of the antibody or antigen-binding fragment as disclosed herein, such that a suitable dose will be obtained. Typically, this amount is at least 0.01% of the antibody or antigen-binding fragment in the composition. When intended for oral administration, this amount can vary from about 0.1% to about 70% by weight of the composition. Some oral pharmaceutical compositions contain about 4% to about 75% of the antibody or antigen-binding fragment. In some embodiments, pharmaceutical compositions and formulations according to the invention are prepared such that, prior to dilution, the parenteral dose unit contains 0.01% to 10% by weight of the antibody or antigen-binding fragment.

[0366] The composition may be intended for topical application, in which case the carrier may suitably comprise a solution, emulsion, ointment, or gel matrix. For example, the matrix may include one or more of the following: petrolatum, lanolin, polyethylene glycol, beeswax, mineral oil, diluents such as water and alcohol, and emulsifiers and stabilizers. A thickener may be present in the composition for topical application. If intended for transdermal application, the composition may comprise a transdermal patch or an iontophoresis device. The pharmaceutical composition may be intended for rectal application, for example, in the form of a suppository, which melts in the rectum and releases the drug. Compositions for rectal application may contain an oily matrix as a suitable, non-irritating excipient. Such matrices include, but are not limited to, lanolin, cocoa butter, and polyethylene glycol.

[0367] The composition may comprise a variety of materials that modify the physical form of the solid or liquid dosage unit. For example, the composition may comprise a material that forms a coating shell around the active ingredient. The material forming the coating shell is typically inert and may be selected from, for example, sugars, shellac, and other enteric coating agents. Alternatively, the active ingredient may be encapsulated in a gelatin capsule. The composition, in solid or liquid form, may comprise an agent that binds to an antibody or antigen-binding fragment of the present disclosure and thereby aids in the delivery of the compound. Suitable agents that can perform this function include monoclonal or polyclonal antibodies, one or more proteins, or liposomes. The composition may consist essentially of dosage units that can be administered in aerosol form. The term aerosol is used to refer to a variety of systems, ranging from colloidal systems to systems consisting of pressurized packaging. Delivery may be carried out by liquefying or compressing gas or by a suitable pump system dispensing the active ingredient. Aerosols may be delivered in single-phase, biphase, or three-phase systems to deliver the active ingredient. Aerosol delivery includes necessary containers, activators, valves, sub-containers, etc., which together form a kit. Preferred aerosols can be determined by those skilled in the art without extensive experimentation.

[0368] Pharmaceutical compositions can be prepared using methods well-known in the pharmaceutical industry. For example, compositions intended for injection can be prepared by combining a composition comprising one or more of an antibody, antigen-binding fragment, or ADC as described herein, and optionally a salt, buffer, and / or stabilizer, with sterile distilled water to form a solution. Surfactants may be added to promote the formation of a homogeneous solution or suspension. Surfactants are compounds that non-covalently interact with the peptide composition to promote the dissolution or homogeneous suspension of the antibody, antigen-binding fragment, or ADC in an aqueous delivery system.

[0369] Generally, appropriate dosages and treatment regimens provide an amount of composition sufficient to provide therapeutic and / or preventive benefits, such as those described herein, including improved clinical outcomes (e.g., reduced frequency, duration, or severity of diarrhea or related dehydration or inflammation, or longer disease-free survival and / or overall survival, or reduced symptom severity). For preventive use, the dosage should be sufficient to prevent the disease or disorder associated with it, delay its onset, or reduce its s...

Claims

1. An antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising complementarity determining regions (CDRs) H1, CDRH2, and CDRH3, and a light chain variable domain (VL) comprising CDRL1, CDRL2, CDRL3, wherein the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 are according to SEQ ID NOs: 68, 171, 70, 72, 73, and 114, respectively.

2. An antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising complementarity determining regions (CDRs) H1, CDRH2, and CDRH3, and a light chain variable domain (VL) comprising CDRL1, CDRL2, CDRL3, wherein the CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 are according to SEQ ID NOs: 68, 215 or 216, 70, 72, 73, and 114, respectively.

3. The antibody or antigen-binding fragment of claim 1 or claim 2, comprising a heavy chain variable domain (VH) and a light chain variable domain (VL), wherein the VH is according to any one of SEQ ID NOs: 184 and 187-202, and the VL is according to SEQ ID NO:

113.

4. The antibody or antigen-binding fragment of claim 3, wherein the VH comprises an amino acid sequence according to one or more of SEQ ID NOs: 215-221, and the VL comprises an amino acid sequence according to any one of SEQ ID NOs: 113 and 222-224.

5. An antibody or antigen-binding fragment comprising a heavy chain variable domain (VH) comprising an amino acid sequence that is at least 85% identical to SEQ ID NO:

184.

6. The antibody or antigen-binding fragment of claim 5, wherein the VH further comprises i) an amino acid sequence according to any one of SEQ ID NOs: 184-202; and / or ii) an amino acid sequence according to one or more of SEQ ID NOs: 215-221, and optionally complementarity determining regions (CDRs) H1, CDRH2, and CDRH3 according to SEQ ID NOs: 68, 171, and 70.

7. The antibody or antigen-binding fragment of claim 6, further comprising a light chain variable domain (VL) comprising an amino acid sequence that is at least 85% identical to SEQ ID NO:

113.

8. The antibody or antigen binding fragment of claim 7, wherein the VL further comprises an amino acid sequence according to one or more of SEQ ID NOs: 222 to 224, and optionally the complementarity determining regions (CDRs) L1, CDRL2 and CDRL3 according to SEQ ID NOs: 72, 73 and 114.

9. The antibody or antigen binding fragment of any one of claims 5 to 8, wherein the antibody is capable of not comprising both a VH consisting of an amino acid sequence according to SEQ ID NO: 67 and a VL consisting of an amino acid sequence according to SEQ ID NO:

71.

10. The antibody or antigen binding fragment of any one of claims 1 to 9, wherein the antibody or antigen binding fragment is capable of binding to a Sars-like virus, optionally a clade 1b Sars-like virus.

11. The antibody or antigen binding fragment of any one of claims 1 to 10, wherein the antibody or antigen binding fragment is capable of binding to SARS-CoV-2 and SARS-CoV.

12. The antibody or antigen binding fragment of any one of claims 1 to 11, wherein the antibody or antigen binding fragment comprises a heavy chain constant domain (CH) or Fc polypeptide or fragment thereof comprising an amino acid sequence according to any one of SEQ ID NOs: 30 to 66.

13. The antibody or antigen binding fragment of claim 12, wherein the antibody comprises a heavy chain constant domain (CH) comprising an amino acid sequence according to SEQ ID NO:

49.

14. The antibody or antigen binding fragment of any one of claims 1 to 13, wherein the antibody or antigen binding fragment comprises a light chain constant domain (CL) comprising an amino acid sequence according to SEQ ID NO:

186.

15. The antibody or antigen binding fragment of any one of claims 1 to 14, which is human, humanized or chimeric, and / or comprises a human antibody, a monoclonal antibody, a purified antibody, a single chain antibody, a Fab, a Fab’, a F(ab’)2, a Fv, a scFv or a scFab.

16. The antibody or antigen binding fragment of any one of claims 1 to 15, wherein the antibody or antigen binding fragment comprises two identical VH domains and two identical VL domains, wherein each VH and VL together form an antigen binding site.

17. The antibody or antigen binding fragment of any one of claims 1 to 15, wherein the antibody or antigen binding fragment is a bispecific antibody or antigen binding fragment.

18. An antibody or antigen-binding fragment, comprising: a first VH and a first VL; and a second VH and a second VL, wherein the first VH and the first VL comprise an amino acid sequence that is at least 85% identical to the amino acid sequence according to SEQ ID NO: 184, and an amino acid sequence that is at least 85% identical to the amino acid sequence according to SEQ ID NO: 113, respectively; wherein the first VH and the second VL are different from the second VH and the second VL; wherein the first VH and the first VL together form a first antigen-binding site; and wherein the second VH and the second VL together form a second antigen-binding site.

19. An antibody drug conjugate (ADC), comprising the antibody of any one of claims 1-18 conjugated to a drug, wherein the drug is an antiviral or anti-inflammatory small molecule.

20. An isolated polynucleotide encoding the antibody or antigen-binding fragment of any one of claims 1-18.

21. The polynucleotide of claim 20, wherein the polynucleotide comprises or consists of a nucleic acid sequence that is at least 85% identical to the nucleic acid sequence according to one or more of SEQ ID NOs: 115 and 183.

22. The polynucleotide of any one of claims 20-21, wherein the polynucleotide comprises deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), wherein the RNA optionally comprises messenger RNA (mRNA), optionally self-amplifying RNA (saRNA), trans- amplifying RNA (taRNA), or circular RNA (circRNA).

23. A recombinant vector, DNA therapeutic, or RNA therapeutic comprising the polynucleotide of any one of claims 20-22.

24. A DNA therapeutic construct or RNA therapeutic construct comprising the polynucleotide of any one of claims 20-22 encapsulated in a carrier, wherein the carrier optionally comprises a lipid, a lipid-derived delivery vehicle such as a liposome, a solid lipid nanoparticle, an oily suspension, a submicron lipid emulsion, a lipid microbubble, a reverse lipid micelle, a cochleate, a lipid microtube, a lipid microcylinder, a lipid nanoparticle (LNP), or a nanoscale platform.

25. A host cell comprising the polynucleotide of any one of claims 20-22 and / or the vector, DNA therapeutic, or RNA therapeutic of claim 23 or 24, wherein the polynucleotide is heterologous to the host cell.

26. A human B cell comprising the polynucleotide of any one of claims 20-22 and / or the vector, DNA therapeutic, or RNA therapeutic of claim 23 or 24, wherein the polynucleotide is heterologous to the human B cell, and / or wherein the human B cell is immortalized.

27. A composition comprising: (i) the antibody or antigen-binding fragment of any one of claims 1-18; (ii) the ADC of claim 19; (iii) the polynucleotide of any one of claims 20-22; (iv) the recombinant vector, DNA therapeutic, or RNA therapeutic of claim 23 or 24; (v) the host cell of claim 25; and / or (vi) the human B cell of claim 26, and a pharmaceutically acceptable excipient, carrier, or diluent.

28. A method of treating a sarbecovirus infection (e.g., an infection with SARS-CoV-2) in a subject, the method comprising administering to the subject an effective amount of: (i) the antibody or antigen-binding fragment of any one of claims 1-18; (ii) the ADC of claim 19; (iii) the polynucleotide of any one of claims 20-22; (iv) the recombinant vector, DNA therapeutic, or RNA therapeutic of claim 23 or 24; (v) the host cell of claim 25; and / or (vi) the human B cell of claim 26, and / or (vii) the composition of claim 27.

29. The antibody or antigen-binding fragment of any one of claims 1-18, the ADC of claim 19, the polynucleotide of any one of claims 20-22, the recombinant vector, DNA therapeutic, or RNA therapeutic of claim 23 or 24, the host cell of claim 25, the human B cell of claim 26, and / or the composition of claim 27 for use in a method of treating a sarbecovirus infection (e.g., an infection with SARS-CoV-2) in a subject, or for use in the manufacture of a medicament for treating a sarbecovirus infection (e.g., an infection with SARS-CoV-2) in a subject.

30. A kit comprising a liquid composition comprising: (i) the antibody or antigen binding fragment of any one of claims 1 to 18; (ii) the ADC of claim 19; (iii) the polynucleotide of any one of claims 20 to 22; (iv) the recombinant vector, DNA therapeutic, or RNA therapeutic of claim 23 or 24; (v) the host cell of claim 25; and / or (vi) the human B cell of claim 26, and / or (vii) the composition of claim 27, and instructions for use of the liquid composition for treating a SARS-CoV-2 infection in a subject.

Citation Information

Patent Citations

  • Expression using fused genes providing for protein product

    US4751180A

  • Recombinant immunoglobin preparations

    US4816567A

  • Covalently linked polypeptide cell modulators

    US4935233A

  • System to detect protein-protein interactions

    US5283173A

  • System to detect protein-protein interactions

    US5468614A