Key gene for synthesizing flavonoids of abelmoschus manihot as well as encoding protein and application of key gene

Abstract

The invention discloses an abelmoschus manihot flavonoid compound synthetic gene as well as an encoding protein and application thereof. The gene is obtained by cloning from abelmoschus manihot, the nucleotide sequence of the gene is as shown in 245th to 1225th basic groups of SEQ ID NO.1, and the coded amino acid sequence of the gene is as shown in SEQ ID NO.2. The gene is over-expressed in tobacco, so that the increase of the total flavonoid content of the tobacco can be promoted. The gene is over-expressed in the abelmoschus manihot, and the increase of the total flavone content and anthocyanin of the abelmoschus manihot can be promoted. Therefore, the abelmoschus manihot gene provided by the invention has important application value for promoting germplasm improvement, variety optimization and industrial development of abelmoschus manihot.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of genetic engineering, and particularly relates to an application of a key gene for synthesizing Abelmoschus manihot flavonoids and a protein coded by the key gene. BACKGROUND

[0002] Abelmoschus manihot is a plant of Malvaceae and Abelmoschus, with large and light yellow flowers, and has ornamental value and medicinal and edible properties. It is a typical health-care flower and is widely used in various fields. In the South Pacific islands, the flowers and fruits are often used as vegetables (RUBIANG-YALAMBING et al., 2016). In China, Vanuatu, Fiji and New Caledonia, Abelmoschus manihot is an important medicinal plant, and the seeds, roots and flowers can be used as medicine to treat inflammation, primary glomerular disease and type II diabetic nephropathy (CHEN et al., 2015). The flowers are rich in flavonoids and organic acids, and have anti-inflammatory, antioxidant, antitumor and neuroprotective activities (HOSSEINI et al., 2018; HEITMAN et al., 2017), and can be used for the clinical treatment of burns, chronic kidney disease and oral ulcers, and have been developed into functional foods, flower tea and other products (Du LY et al., 2015b; YANG et al., 2018).

[0003] Phytochemical analysis shows that Abelmoschus manihot contains various functional active ingredients, including flavonoids, high polysaccharide gum, phenolic compounds, vitamin E, mineral elements (calcium, potassium, magnesium, zinc, iron, etc.), organic acids (DIAO et al., 2024), nucleotides and various amino acids (Du LY et al., 2015). Among them, flavonoids are the core active ingredients, and hyperoside, quercetin, myricetin, rutin and anthocyanin are rich in Abelmoschus manihot and have outstanding medicinal value. Specifically, hyperoside has anti-inflammatory, antioxidant and neuroprotective effects, and is particularly effective in improving chronic kidney disease and ischemic brain injury (WANG ZH et al., 2025). Quercetin can exert significant antioxidant and antitumor activities by scavenging free radicals (SUN MJ et al., 2025), and both of them can also improve plant stress resistance by regulating the redox balance in plant signal transduction (GUAN SH et al., 2025). Anthocyanin is often used for chronic disease prevention due to its antioxidant and anti-inflammatory properties (WU X et al., 2025).

[0004] The total flavonoid content is a key indicator for evaluating the medicinal value of Abelmoschus. With the development of molecular biology technology and gene editing tools, researchers have been able to analyze the regulation mechanism of specific genes on flavonoid synthesis to some extent. However, due to the great difference in genetic background of different plants, the existing research on Abelmoschus still lacks new genes for regulating flavonoid synthesis, and an effective method for improving flavonoid synthesis by regulating the expression of key genes has not been formed. Therefore, it is of important application value to explore new regulatory genes for flavonoid synthesis in Abelmoschus and propose corresponding new synthesis regulation methods, which can promote the improvement of Abelmoschus germplasm, optimization of varieties and industrial development. SUMMARY

[0005] The first object of the present application is to provide a protein that can be used to regulate the synthesis of flavonoids in plants, characterized in that the amino acid sequence of the protein is shown in SEQ ID NO. 2.

[0006] The second object of the present application is to provide a gene encoding the above-mentioned protein, preferably, the base sequence of the gene is shown in SEQ ID NO. 1.

[0007] The third object of the present application is to provide a recombinant plant expression vector for expressing the protein.

[0008] The expression vector is any binary vector that can be used for Agrobacterium transformation of plants or a vector that can be used for plant microprojectile bombardment, such as pCAMBIA series vectors, pBI series vectors, pBin series vectors or Gateway™ series vectors.

[0009] The fourth object of the present application is to provide a method for increasing the content of flavonoids in plants, characterized in that a gene encoding the aforementioned protein is introduced into plant cells, tissues or organs, and the transformed plant cells, tissues or organs are cultivated into plants, so that the gene is overexpressed in plants.

[0010] Preferably, the gene is introduced into plant cells, tissues or organs by a plant expression vector, and the plant is tobacco and / or Abelmoschus.

[0011] The fifth object of the present application is to provide the aforementioned protein, its encoding gene and recombinant plant expression vector for promoting the synthesis of flavonoids.

[0012] The regulation of the synthesis of flavonoids in plants is to increase the expression of the gene to promote the increase of total flavonoid content or to promote the increase of anthocyanin content.

[0013] The sixth object of the present application is to provide a method for promoting the synthesis of plant flavonoids, characterized in that the aforementioned gene is introduced into plant cells, tissues or organs, and the transformed plant cells, tissues or organs are cultivated into plants, so that the gene is overexpressed in the plants.

[0014] Preferably, the gene is introduced into plant cells, tissues or organs by a plant expression vector, and the plants are tobacco and Abelmoschus.

[0015] The seventh object of the present application is to provide the use of the aforementioned protein, gene or recombinant plant expression vector in regulating the synthesis of plant flavonoids.

[0016] Preferably, the regulation of the synthesis of plant flavonoids is achieved by increasing the expression of the aforementioned gene to increase the content of flavonoids.

[0017] The eighth object of the present application is to provide the use of the aforementioned protein, gene or recombinant plant expression vector in cultivating high-flavonoid plant varieties.

[0018] Preferably, the cultivation of high-flavonoid plant varieties is achieved by increasing the expression of the aforementioned gene to cultivate high-flavonoid plant varieties.

[0019] Preferably, the aforementioned plants are tobacco or Abelmoschus.

[0020] Compared with the prior art, the present application has the following advantages: 1) The present application provides new proteins and their encoding genes that have the function of regulating the content of plant flavonoids.

[0021] 2) The new proteins and their encoding genes provided by the present application have the function of regulating the content of flavonoids in plants with different genetic backgrounds.

[0022] 3) The present application provides a new method for increasing the content of plant flavonoids, i.e. increasing the content of plant flavonoids by increasing the expression of the aforementioned gene or the encoded protein.

[0023] 4) The present application provides a method for cultivating high-flavonoid plant varieties, i.e. cultivating high-flavonoid plant varieties by increasing the expression of the aforementioned gene. BRIEF DESCRIPTION OF DRAWINGS

[0024] The present application will be described in detail below with reference to the accompanying drawings and specific embodiments.

[0025] Figure 1 The expression of the gene in the flowers of Abelmoschus at different developmental stages is detected by Real-time PCR, and the ordinate represents the relative expression level.

[0026] Figure 2 The relative expression amount of the gene in the application in each floral organ (ovary, style, petal, sepal) of the beginning of flowering of Abelmoschus esculentus was detected by Real-time PCR, and the vertical coordinate represented the high and low of the relative expression amount.

[0027] Figure 3 The PCR identification figure of transgenic tobacco is shown, wherein M is Marker 2000, 1 is wild type tobacco, and 2-4 are transgenic tobacco lines.

[0028] Figure 4 The total flavonoid content comparison figure of transgenic tobacco is shown, wherein CK is wild type tobacco, Empty Vector is trans-empty vector tobacco, and OE-1, OE-2, and OE-3 are three lines of transgenic tobacco of the gene of interest.

[0029] Figure 5 The expression amount of the gene of interest in the control Abelmoschus esculentus and transgenic Abelmoschus esculentus was detected by Real-time PCR, and the vertical coordinate represented the high and low of the relative expression amount. CK is the control Abelmoschus esculentus without transformation, Empty Vector is the trans-empty vector Abelmoschus esculentus, and OE-1, OE-2, and OE-3 are three lines of transgenic Abelmoschus esculentus of the gene of interest.

[0030] Figure 6 The total flavonoid content comparison figure of transgenic Abelmoschus esculentus is shown, wherein CK is the control Abelmoschus esculentus without transformation, Empty Vector is the trans-empty vector Abelmoschus esculentus, and OE-1, OE-2, and OE-3 are three lines of transgenic Abelmoschus esculentus of the gene of interest.

[0031] Figure 7 The anthocyanin content comparison figure of transgenic Abelmoschus esculentus is shown, wherein CK is the control Abelmoschus esculentus without transformation, Empty Vector is the trans-empty vector Abelmoschus esculentus, and OE-1, OE-2, and OE-3 are three lines of transgenic Abelmoschus esculentus of the gene of interest. DETAILED DESCRIPTION

[0032] The application will be further described in conjunction with specific examples. It should be understood that these examples are only used to illustrate the application and not to limit the scope of the application. If the specific experimental methods are not specified in the following examples, they can be carried out according to the conventional methods. For example, the conditions described in J. Sambrook et al. Molecular Cloning: A Laboratory Manual, F. Ausubel et al. Short Protocols in Molecular Biology, or the instructions of the product manufacturer.

[0033] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0034] Example 1: Cloning of the Ipomoea nil gene Ipomoea nil was used as the experimental material, and the plant material was grown under natural conditions.

[0035] RNA extraction: The flower organs of Ipomoea nil were used to extract total RNA using a plant RNA rapid extraction kit (Huaiyueyang, Beijing, China). The specific steps for extracting RNA are described in the relevant instructions.

[0036] Reverse transcription: The mRNA was reverse transcribed into cDNA first strand using a reverse transcription kit from Novozyme. The method was performed according to the instructions of the reagent.

[0037] Gene cloning: The reverse-transcribed cDNA first strand of Ipomoea nil flower buds was used as the template, and F1: ATGTATCAACCGAAGACTGCTC and R1: TTAATCGTCATTTCCGATTGATATCCC were used as primers for routine PCR amplification. The full-length of the target gene was cloned according to the product instructions of the high-fidelity DNA polymerase reagent (Phanta Max DNA Polymerase) from Novozyme. The sample addition system was referred to the instructions of the enzyme, and the PCR reaction program was as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 s, 55°C annealing for 15 s, 72°C extension for 80 s, a total of 34 cycles, followed by 72°C extension for 5 min. The PCR product was detected by 1.5% agarose gel electrophoresis and the target band was recovered. The method was operated according to the product instructions of the column-type PCR product purification kit (SanPrep Column PCR Product Kit) (Shenguo Bioengineering Co., Ltd.). The recovered target fragment was ligated to a T vector, and the method was referred to the product instructions of the T vector kit (pClone007 Blunt Simple Vector Kit) from Qianke Biotechnology Co., Ltd. The T vector ligation product with the target fragment was constructed. 5 μl of the ligation product was transferred to E. coli DH5α competent cells (Weidi Biology), 700 ul of LB was added, and it was incubated for 1 h. It was then plated on LB plates containing 50 mg / L ampicillin (Amp) and incubated at 37°C overnight. White clones were picked and cultured in LB+Amp (50 mg / L) liquid medium, and then sent for sequencing. The nucleotide sequence is shown in SEQ ID NO. 1, the open reading frame is from the 245th to the 1225th base, which is 981 bp long, and it encodes 327 amino acids. The amino acid sequence is shown in SEQ ID NO. 2.

[0038] SEQ ID NO. 1 (nucleotide sequence of the target gene) SEQ ID NO. 2 (amino acid sequence encoded by the gene of interest) MYQPKTAPGRSLGRNNSLGHGQHLDCRATTMDAVGRGNNHPNNPNLASKQRLRWTHELHERFVDAVAQLGGPDRATAIGVLRVMGVQDLTIYHVKSHLQKYRLAKYLPDSSSDGKEPDKKETGDMLPNLDVMNGMQITEALKLQMEVQKRLHEQLEVQRQLQLRIEAQGKYLKKSIEEQQRLSGVLVETPGSGASLTALGDNGLEYDEKTDPATPPPISESLLPDKAATEGVPAKSHSVDESFSSPCQTLTPDSGCHVGSSAGGAKDERLIKKQRVSMAAAFAKPEIVLPHHILESSISASYQQMQSDFVVDQVNLSSGISIGNDD Example 2: Analysis of the expression pattern of the ipomoea gene Flowers of four developmental stages of ipomoea were taken: flower bud stage, initial flowering stage, full flowering stage and wilting stage. Different floral organs (petals, sepals, styles and ovaries) at the initial flowering stage were taken to detect the expression amount of the gene in the flowers of different developmental stages of ipomoea and in different floral organs. The total RNA was extracted using a plant RNA rapid extraction kit (Huayueyang, Beijing, China), and the genomic DNA was removed by DNase I (Takara). After determining OD260, 2 μg of RNA was quantitatively taken, and then a reverse transcription reaction was performed using a Novozyme reverse transcription kit (the method is described in the instruction manual). The cDNA was diluted 5 times, and according to the product instruction of the fluorescent quantitative qPCR kit (ChamQ TM Universal SYBR qPCR Mix) of Novozyme, a fluorescent quantitative PCR instrument (LightCycler480 II, Roche) was used for qPCR detection, the primer sequences were F2: TGGAGTCCGAGTCGTAGA and R2: ATGGCCCAAAGAGTTGTT, the internal reference primers elF-F: GGTCCATCCTCATACATC and elF-R: GCTATCACTTCACTCCCAC, and real-time fluorescent quantitative PCR detection was performed on the expression amount of the gene in the flowers of ipomoea at different developmental stages and in different floral organs.

[0039] The qPCR reaction system (20 μl) was as follows: The reaction procedure is as follows: 1) pre-denaturation at 95℃ for 30 sec; 2) PCR reaction for 40 cycles: 95℃ for 5 sec, 60℃ for 10 sec, 3) 95℃ for 15 sec.

[0040] The obtained data are processed and analyzed by using the ABI 7500 Real-time PCR system software. The results show that the expression amount of the gene in the application is the highest at the beginning of the flower period, and the expression amount in the bud is the weakest; in different flower organs at the beginning of the flower period, the expression amount of the gene in the application is the highest in the petal, and the petal may be the key tissue site for the synthesis, regulation and accumulation of flavonoids in Abelmoschus.

[0041] Example 3: Overexpression of the Abelmoschus gene in tobacco and functional identification of the transgenic plants (1) Construction of the overexpression vector of the target gene The Gateway method is used to construct the overexpression vector. The cDNA obtained by reverse transcription is used as a template, and the high-fidelity DNA polymerase reagent (Phanta Max DNA Polymerase) of Novozyme is used for amplification. The reaction system is according to the product instruction, and the amplification primers are as follows: F3: GGGGACAAGTTTGTACAAAAAAGCAGGCTTAATGTATCAACCGAAGACTGCTCC; R3: GGGGACCACTTTGTACAAGAAAGCTGGGTTATCGTCATTTCCGATTGATATCCCAGA The reaction procedure is pre-denaturation at 95℃ for 3 min; denaturation at 95℃ for 15 s, annealing at 56℃ for 15 s, extension at 72℃ for 80 s, a total of 34 cycles, and then extension at 72℃ for 5 min. The amplification product is subjected to agarose electrophoresis, and the gel is recovered and sequenced to determine the gene in the application. The PCR product of the recovered target fragment is placed on the ice surface, and the Gateway BP cloning technology is used for connection with the donor vector pDONR221. The connection reaction system is as follows: After mixing, centrifugation for a short time, incubation at 25℃ for 1 h, addition of 1 μL of proteinase K and mixing, incubation at 37℃ for 10 min to terminate the reaction. The connection product is transformed into E. coli competent DH5α, and the LB+ 50 mg / L Kan +The medium was screened and cultured, and single colony was suspended and cultured. The bacterial liquid PCR was detected, and the correct bacterial liquid was sent to the company for sequencing. After the correct bacterial liquid was expanded and cultured, the plasmid was extracted. These plasmids are called primary vectors with target genes. The plasmid is connected with the terminal vector pk7WG2D through the Gateway LR reaction, and the connection reaction system is as follows: After mixing, centrifugation, incubation at 25°C for 1 h, add 1 μL of proteinase K, 37°C for 10 min to terminate the reaction. The ligation product is transformed into E. coli competent cells DH5α, and the positive single colony is identified on LB+50 mg / L Spec medium, that is, the overexpression vector with the target gene is successfully constructed.

[0042] (2) Transform the recombinant plasmid expression vector into Agrobacterium GV3101 Mix 5 μl of recombinant plasmid expression vector with Agrobacterium GV3101 competent cells, and place on ice for 30 min. Then freeze in liquid nitrogen for 1 min, and then quickly transfer to 37°C for 5 min. Add 700 μl of LB medium without antibiotics, and incubate at 28°C, 180 rpm for 3 h. Centrifuge at room temperature at 6000 rpm for 1 min, and remove the supernatant. Leave 100 μl of supernatant for resuspension, and evenly coat on LB solid medium containing Kan (50 mg / L) using a spreader. Place the plate upside down in a 28°C incubator and incubate until colonies grow (about 2 days). Pick single colonies for colony PCR identification. The colony identification PCR primer uses F1 and R1 primers for identification, as shown in Figure 3 , the total length of the amplified product is 981 bp; it can be determined that the expression vector is transformed into Agrobacterium GV3101. Select positive clones for subsequent infection experiments.

[0043] (3) Transform tobacco by leaf disc infiltration method 1. Pick a positive clone and inoculate in LB+Kan (kanamycin) 50 mg / L liquid medium, 28°C, 220 rpm shaking culture for 24-36 h, so that OD 600 =0.8. Centrifuge at 5000 rpm for 10 min to collect the bacterial cells, suspend the bacterial cells with MS liquid medium, and adjust the OD value to about 0.8 to prepare the infection liquid for standby.

[0044] 2. Take 1-2 month old tobacco aseptic seedlings and cut off the edges and main veins, then cut into 0.5 cm small pieces. Soak the treated leaves in the infection liquid and gently shake for 5 min.

[0045] 3. Absorb the excess bacterial solution with sterile filter paper, and inoculate the leaf pieces on co-culture medium (4.74 g MS powder, 10 g sucrose, 7 g agar, 0.01 mg NAA, 0.1 mg IBA, 80 μM AS per liter) and incubate in dark at 25°C for 2 days.

[0046] 4. Transfer the co-cultured leaf pieces to bud induction differentiation medium (4.74 g MS powder, 10 g sucrose, 7 g agar, 0.01 mg NAA, 0.1 mg IBA, 250 mg Cef + , 30 mg Kan + per liter) and subculture every two weeks to induce bud formation.

[0047] 5. Cut the transformed buds grown to 1-3 cm and inoculate on rooting medium (2.47 g 1 / 2MS powder, 10 g sucrose, 6 g agar, 0.1 mg NAA, 250 mg Cef + , 100 mg Kan + per liter) and incubate at 25°C under a 16 h / 8 h light cycle until the formation of complete plantlets.

[0048] (4) Molecular identification of transgenic plants Extract the genomic DNA of transgenic tobacco leaf pieces by CTAB method, and screen positive plants by PCR detection. The PCR primer sequences are as follows: F1: ATGTATCAACCGAAGACTGCTC and R1: TTAATCGTCATTTCCGATTGATATCCC. The identification results are shown in Figure 3 , in which M is Marker 2000, 1 is wild-type tobacco control, and 2-4 are transgenic tobacco lines. The target bands are amplified in 2-4, and the results show that the expression vector recombinant plasmid has been inserted into the tobacco genome, thereby obtaining transgenic tobacco into which the overexpression vector is transferred.

[0049] (5) Functional analysis of transgenic tobacco Comparative analysis of total flavonoids content in wild type tobacco and transgenic tobacco. The determination method of total flavonoids content is: taking the leaves of wild type tobacco and transgenic tobacco, drying at 60°C, and then sampling 0.1 g. Each sample is fully ground and then 2 mL of 70% ethanol is added as the extracting agent, ultrasonic extraction for 30 min, centrifugation at 12000 g for 15 min, taking the supernatant in the centrifuge tube and using 70% ethanol to make up to 2 mL; in the color development process, 0.4 mL of 10% sodium nitrite is added to the extract, shaken and then placed for 6 min, 0.4 mL of 10% aluminum nitrate is added, shaken and then placed again for 6 min, 4 mL of 1 moL sodium hydroxide is added, using 30% ethanol to make up to 10 mL, thoroughly mixed and then placed for 15 min. The OD value of all samples is determined at 510 nm, and the total content of flavonoids is calculated according to the standard solution regression curve.

[0050] The results are shown in Table 1. Figure 4 It is shown that the total flavonoids content in the three transgenic tobacco lines is significantly higher than that of wild type tobacco and transgenic tobacco with empty vector. It is indicated that overexpression can promote the synthesis of flavonoids in tobacco.

[0051] Example 4: Overexpression of the gene in Abelmoschus esculentus and functional analysis of transgenic plants (1) Construction of overexpression vector of Abelmoschus esculentus F: acgggggactcttgaccatggGGGTAATATTTTAGAGAGAGAAAAAGAGAA and R: cctcgcccttgctcaccatggGAGAGAAATCCTTAAACTTATGTATTTAAAGA. The reaction procedure was 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 56℃ annealing for 15 s, 72℃ extension for 80 s, for a total of 34 cycles, and then 72℃ extension for 5 min. The amplified product was subjected to agarose electrophoresis, gel recovery and sequencing to determine the gene of the application. The plant expression vector pCAMBIA1302 was selected to construct the Abelmoschus super-expression vector. The reaction system for preparing the linearized vector was as follows: NcoI, 1 μL; 10×H Bufer, 2 μL; vector plasmid, 1 μl; ddH2O, 16 μl. The reaction system was subjected to enzyme digestion at 37℃ for 2 h, and the linearized vector was obtained by 1.5% agarose gel electrophoresis and gel recovery. The target gene fragment was connected with the linearized vector, and the connection system was as follows: 2×Uniclone SeamLess Cloning Mix 5 μL, linearized vector (50-200 ng) 1 μL, gene fragment 1 μL, and ddH2O to 10 μL. The connection product was transformed into E. coli competent cells, and the single colony was selected and suspended for culture, and then subjected to bacterial liquid PCR detection. The bacterial liquid with correct amplification bands was sent to GenScript for sequencing, and the bacterial liquid with correct sequencing was expanded and cultured, and the plasmid was extracted and kept for standby, i.e. the super-expression vector with the target gene was obtained. The constructed super-expression vector was transformed into Agrobacterium GV3101 competent cells, and the correct bacterial liquid was identified and used for subsequent genetic transformation of Abelmoschus. + The culture medium was selected and cultured, the single colony was suspended for culture, and then subjected to bacterial liquid PCR detection. The bacterial liquid with correct amplification bands was sent to GenScript for sequencing, and the bacterial liquid with correct sequencing was expanded and cultured, and the plasmid was extracted and kept for standby, i.e. the super-expression vector with the target gene was obtained. The constructed super-expression vector was transformed into Agrobacterium GV3101 competent cells, and the correct bacterial liquid was identified and used for subsequent genetic transformation of Abelmoschus.

[0052] (2) Agrobacterium-mediated transformation and selection of Abelmoschus callus 1. 80 μL of Agrobacterium bacterial liquid containing the target gene was taken into 40 ml of LB medium, and the medium was cultured at 28℃ and 200 r / min until OD 600 =0.8. The bacterial body was collected by centrifugation at room temperature and 6000 rpm for 8 min.

[0053] 2. The activated bacterial body was resuspended in MS liquid medium, and the bacterial liquid concentration was adjusted to OD 600 =0.8. 100 μmol / L acetyl-syringone (AS) was added as an inducer, and 0.001% Triton-100 was added as a surfactant for transformation.

[0054] 3. Select the callus with tender green color and tight texture, cut into small pieces of about 0.8 cm, and immerse the callus in the infection solution, 28°C, 50 r / min oscillation for 20 min. After the callus is immersed, place it on sterile filter paper to absorb excess bacterial solution and dry slightly.

[0055] 4. Transfer the callus into co-culture medium (per liter: MS complex agent powder 4.74 g, 30 g sucrose, 5.6 g agar, 1 mg ZT, 0.2 mg IBA, 100 μM AS), 26°C, dark culture for 2 d.

[0056] 5. Transfer the dark-cultured callus into screening medium (per liter: MS complex agent powder 4.74 g, 30 g sucrose, 5.6 g agar, 1 mg ZT, 0.2 mg IBA, 500 mg / L Cef + , 30 mg / L Kan + ), continue screening and inducing adventitious buds under the condition of 26°C light cycle 12 h / 12 h.

[0057] 6. When the screened and induced adventitious buds grow to 2-3 cm, cut and inoculate them into rooting medium (per liter: 1 / 2MS complex agent powder 2.47 g, 20 g sucrose, 5.6 g agar, 0.5 mg NAA, 0.2 mg IBA, 250 mg Cef + , 30 mg Kan + ), culture under the condition of 26°C light cycle 12 h / 12 h until rooting forms complete seedlings.

[0058] (3) Molecular identification of transgenic Abelmoschus esculentus plants Extract the genomic DNA of the leaves of Abelmoschus esculentus by CTAB method, perform PCR detection, and screen positive plants. Subsequently, extract the RNA of the leaves of the positive plants, reverse transcribe into cDNA, and detect the expression level of the target by qRT-PCR. The results are shown in Figure 5 The expression level of the target gene in the three Abelmoschus esculentus transformation lines is significantly higher than that in the control plants and the plants transformed with empty vector. It is indicated that the target gene is overexpressed in the Abelmoschus esculentus transformation plants.

[0059] (4) Functional analysis of transgenic Abelmoschus esculentus Take the leaves of the control Abelmoschus esculentus and the transgenic Abelmoschus esculentus, and compare and analyze the total flavonoid content and anthocyanin content in the leaves.

[0060] The total flavonoid content was determined as follows: 0.1 g of fresh leaves was taken in a mortar and 2 mL of 70% ethanol was added as an extractant. The sample was ultrasonically extracted for 30 min and centrifuged at 12000 g for 15 min. The supernatant was taken in a centrifuge tube and diluted to 2 mL with 70% ethanol. In the color development process, 0.5 mL of 10% sodium nitrite was added to the extract, shaken and allowed to stand for 6 min. Then, 0.5 mL of 10% aluminum nitrate was added, shaken and allowed to stand for another 6 min. Then, 4 mL of 4% sodium hydroxide was added, diluted to 10 mL with 30% ethanol, mixed thoroughly and allowed to stand for 15 min. The absorbance at 510 nm was determined by a spectrophotometer. The total content of flavonoids was calculated according to the regression curve of the standard solution.

[0061] The results are shown in Table 1. Figure 6 As shown in Table 1, the total flavonoid content of the three transgenic Abelmoschus esculentus lines was significantly higher than that of the control Abelmoschus esculentus and the empty vector transgenic Abelmoschus esculentus. This indicates that overexpression can promote the synthesis of flavonoids in Abelmoschus esculentus.

[0062] Determination of anthocyanin content. 0.1 g of fresh leaves was quickly placed in a pre-cooled mortar, and 5 mL of pre-cooled acidified methanol was added to the mortar. The mortar was ground thoroughly to form a homogenate under ice bath conditions. The homogenate was transferred to a 10 mL brown volumetric flask, the mortar was washed several times with acidified methanol, and the washing liquid was also transferred to the volumetric flask. Finally, the volume was adjusted to 10 mL with acidified methanol. The sample was extracted at 4°C in the dark for 12 h, with shaking every 3 h. After 12 h, the centrifuge tube was centrifuged at 10000 g for 10 min, and the supernatant was taken as the test solution. Two tubes, A and B, were prepared. In tube A, 1.0 mL of the pigment supernatant was taken, 4.0 mL of pH 1.0 buffer (potassium chloride-hydrochloric acid buffer) was added, and the mixture was mixed well. In tube B, 1.0 mL of the pigment supernatant was taken, 4.0 mL of pH 4.5 buffer (acetic acid-sodium acetate buffer) was added, and the mixture was mixed well. Tubes A and B were incubated at 40°C for 30 min. The absorbance values of the solutions in tubes A and B at 510 nm and 700 nm were determined by UV spectrophotometry. The anthocyanin content was calculated according to the formula.

[0063] In the formula, A is the absorbance value, A = (A510 pH 1.0 - A700 pH 1.0) (A510 pH 4.5 - A700 pH 4.5), each sample was measured 3 times, and the average value was taken; MW is the molecular weight of cyanidin-3-O-glucose, about 449.2; DF is the dilution factor of the Abelmoschus esculentus extract; V is the total volume of the extract (mL); ε is the extinction coefficient of cyanidin 3-glucose, 26900. L is the cuvette optical path (cm); and m is the fresh weight of the sample (g).

[0064] The results are shown in Table 2. Figure 7 As shown in Table 2, the anthocyanin content of the three transgenic Abelmoschus esculentus lines is significantly higher than that of the control Abelmoschus esculentus and the Abelmoschus esculentus with empty vector, which indicates that overexpression can promote the synthesis of anthocyanin in Abelmoschus esculentus.

[0065] The above results show that the gene is a key gene for the synthesis of flavonoids, and overexpression of the gene in tobacco can promote the synthesis of flavonoids, thereby increasing the total flavonoid content; overexpression of the gene in Abelmoschus esculentus can promote the synthesis of flavonoids, especially the synthesis of anthocyanin, thereby increasing the total flavonoid and anthocyanin content of the plant, and improving the medicinal value of the plant.

Claims

1. A key protein for the synthesis of flavonoids from Abelmoschus manihot, characterized in that, The amino acid sequence of the protein is shown in SEQ ID NO.

2.

2. A key gene for the synthesis of flavonoids in okra, characterized in that, The gene encodes the amino acid sequence shown in SEQ ID NO.

2.

3. A recombinant plant expression vector for expressing the protein as described in claim 1.

4. The recombinant plant expression vector according to claim 3, characterized in that, The plant expression vectors mentioned are pBI series vectors, pBin series vectors, and Gateway vectors. TW Series vectors or pCAMBIA series vectors.

5. A method for increasing the content of flavonoids in plants, characterized in that, The gene encoding the protein of claim 1 is introduced into plant cells, tissues or organs, and the transformed plant cells, tissues or organs are then cultured into plants, so that the gene is overexpressed in the plants.

6. The method according to claim 5, characterized in that, The gene is introduced into plant cells, tissues or organs via a plant expression vector, and the plant is tobacco and / or okra.

7. The use of the protein of claim 1, the gene of claim 2, or the recombinant plant expression vector of any one of claims 3-4 in regulating the synthesis of plant flavonoids.

8. The use of the protein of claim 1, the gene of claim 2, or the recombinant plant expression vector of any one of claims 3-4 in cultivating plant varieties with high flavonoid content.

9. The application according to claim 7, characterized in that, The regulation of plant flavonoid synthesis is achieved by increasing the expression of the aforementioned gene, thereby increasing the flavonoid content.

10. The application according to claim 8, characterized in that, The cultivation of plant varieties with high flavonoid content is achieved by increasing the expression of the aforementioned gene.

Images