Osteoarthritis treatment and diagnosis products targeting ybx1 and applications
The YBX1 gene therapy targeting subchondral bone micromolecular structures (BMMs) and utilizing local injection of the AAV vector has solved the problem that existing OA treatments cannot stop the disease progression, achieving comprehensive improvement in the structure and symptoms of OA while avoiding systemic side effects.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-05
- Publication Date
- 2026-04-07
AI Technical Summary
Current treatments for OA primarily focus on relieving pain symptoms, rather than halting disease progression and improving structural damage. Furthermore, existing medications have side effects, and there is a lack of effective treatments targeting the disease mechanisms of OA.
A gene therapy targeting YBX1 in subchondral bone bone micromolecular masses (BMMs) has been developed. By using an AAV vector to carry specific polynucleotides, YBX1 gene expression is knocked down via RNAi mechanism. Combined with a macrophage-specific promoter, local intra-articular injection is achieved to reduce osteoclast activity.
It effectively reduces joint pain, improves subchondral bone destruction and overlying cartilage degeneration, significantly slows down the progression of osteoarthritis (OA), avoids systemic toxic side effects, and provides a treatment strategy that addresses both the structural and symptom-related aspects of OA.
Smart Images

Figure CN121249673B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of gene therapy, specifically to a gene therapy vector targeting YBX1 and its application. Background Technology
[0002] Osteoarthritis (OA) is the most common chronic, degenerative joint disease, causing pain, dysfunction, and even deformity in the affected joints, severely impairing patients' ability to work and live independently. With the accelerating aging of my country's population and the increasing number of people suffering from sports injuries, the incidence of OA is showing a year-on-year upward trend, creating a significant socioeconomic burden.
[0003] Osteoarthritis (OA) was previously thought to be characterized primarily by the progressive destruction of articular cartilage. However, recent evidence suggests that subchondral bone may develop pathological changes before cartilage in the OA process. As dynamic stress-bearing structural units, cartilage and subchondral bone not only complement each other in joint stress bearing but also engage in close biomechanical and biochemical communication. In the early stages of OA, a significant increase in the number and activity of osteoclasts in the subchondral bone is a key factor in abnormal subchondral bone remodeling, overlying cartilage degeneration, and sensory nerve ingrowth. Therefore, developing novel OA treatments targeting osteoclasts and their precursor cells—bonemarrow macrophages (BMMs)—potentially offers the dual benefits of inhibiting osteochondral structural degeneration and alleviating pain symptoms in the early stages of the disease.
[0004] YBX1 belongs to the Y-box binding protein family and is an evolutionarily conserved multifunctional DNA / RNA binding protein that regulates gene expression at the transcriptional and translational levels. It plays a crucial role in multiple aspects of RNA dynamics, including pre-mRNA splicing, mRNA packaging, mRNA stability, and translation, thus widely participating in biological processes such as cell proliferation, differentiation, aging, stress, and malignant transformation. Its relationship with osteoclast differentiation of subchondral bone microbeads (BMMs) in osteoarthritis (OA) remains unclear and warrants further investigation.
[0005] From a technological perspective, the application of AAV in gene therapy is rapidly developing. Due to its low immunogenicity, good tissue targeting, and relatively safe gene integration properties, AAV is considered one of the most promising gene delivery vectors currently available. To date, the FDA has approved several AAV-based gene therapies for the treatment of inherited retinal diseases, spinal muscular atrophy, and others. Although AAV has shown promising applications in multiple disease areas, no AAV-related gene therapies have yet entered the clinical application stage for the treatment of osteoarthritis (OA).
[0006] In contrast, current treatment strategies for OA aim to relieve pain symptoms. The most frequently recommended pharmacological approaches in guidelines include acetaminophen and nonsteroidal anti-inflammatory drugs (NSAIDs). Oral NSAIDs have been shown to be effective in improving clinically relevant pain and function, but they are prone to gastrointestinal and cardiovascular side effects. For OA patients who do not respond to oral or topical analgesics, intra-articular injection of corticosteroids is currently recommended. In summary, there are currently no drugs that can effectively halt the progression of OA or improve structural damage. The etiology of OA is complex and diverse. Although clinical trials targeting multiple molecular targets have been conducted, the final treatment outcomes have been unsatisfactory. Therefore, there is an urgent need to develop novel drugs targeting the disease mechanisms of OA.
[0007] In conclusion, based on the crucial role of subchondral bone abnormal remodeling in OA, and the technological advantages of YBX1 as a potential regulatory target and AAV as a highly efficient delivery vector, developing gene therapy methods targeting YBX1 in subchondral bone BMMs has significant clinical implications and application prospects. Summary of the Invention
[0008] Given the shortcomings of existing therapies in the aforementioned background art, this invention aims to provide a novel prevention and treatment strategy targeting the core mechanisms of osteoarthritis (OA). The core of this invention lies in the first-ever revelation of the crucial role of Y-box binding protein 1 (YBX1) in the abnormal differentiation of subchondral osteoclasts, and based on this, the development of corresponding gene therapy products, pharmaceutical compositions, and diagnostic applications.
[0009] Specifically, the present invention achieves the above-mentioned objective through the following technical solution: The present invention provides an isolated polynucleotide, the sequence of which is shown in SEQ ID NO:1, or a sequence having at least 90% sequence identity with SEQ ID NO:1 and capable of knocking down YBX1 gene expression. This sequence is specifically designed to effectively knock down YBX1 gene expression through RNA interference (RNAi) mechanism. To cover functionally equivalent variants generated by substituting, deleting, or adding one or more nucleotides based on SEQ ID NO:1, the polynucleotide of the present invention further includes a sequence having at least 90%, 95%, 98%, or 99% sequence identity with SEQ ID NO:1, and still retaining the function of knocking down YBX1 gene expression. "Knocking down YBX1 gene expression" means being able to reduce the mRNA or protein level of YBX1 in cells by at least 30%, 50%, 70%, or more.
[0010] In one specific embodiment, the recombinant vector of the aforementioned polynucleotide is also included. In such a recombinant vector, the polynucleotide is operatively linked to a macrophage-specific promoter; preferably, the macrophage-specific promoter is selected from pAAV-F4 / 80 promoter, CSF1R promoter, CD68 promoter, and CD11b promoter as examples. Specifically, in the recombinant vector, the polynucleotide is operatively linked to a macrophage-specific promoter. "operatively linked" here means that the promoter and the polynucleotide are linked in a manner that allows them to specifically initiate transcription in macrophages and their precursor cells. The macrophage-specific promoter is not limited to: the pAAV-F4 / 80 promoter (highly specific for mature macrophages), the CSF1R promoter (macrophage colony-stimulating factor receptor promoter, widely expressed in myeloid cells), the CD68 promoter, or the CD11b promoter (all promoters of macrophage / monocyte markers).
[0011] The recombinant vector is preferably a viral vector. For example, but not limited to, adeno-associated virus (AAV) vectors (due to their low immunogenicity and long-term expression advantages), adenovirus vectors (with high transduction efficiency), or lentiviral vectors (capable of integrating into the genome for stable expression). Although this embodiment of the invention uses a viral vector as an example, those skilled in the art will recognize that other delivery systems, such as plasmid DNA, lipid nanoparticles, and other non-viral vectors, can also be used in this invention, provided that the polynucleotides can be delivered to the target cells.
[0012] In a specific and preferred embodiment, the recombinant vector contains a specific expression cassette. For example, a GV407 vector backbone may be used, the expression cassette of which is configured as: pAAV-F4 / 80 promoter-EGFP (reporter gene)-MIR155 (RNAi) scaffold (with the target sequence of SEQ ID NO:1 embedded therein)-SV40 PolyA (polyadenylate tail).
[0013] In one specific embodiment, the present invention provides a pharmaceutical composition comprising the aforementioned polynucleotide or recombinant vector and a pharmaceutically acceptable vector.
[0014] For local intra-articular injection, osmotic agents such as physiological saline and phosphate-buffered saline (PBS) can be included. To enhance the stability or transduction efficiency of the viral vector, surfactants (such as Pluronic F68) and sugars (such as trehalose and sucrose) can be included as stabilizers.
[0015] The pharmaceutical composition can be formulated into various dosage forms such as suspension and lyophilized powder.
[0016] This invention further provides the use of YBX1 inhibitors in the preparation of drugs for the prevention and / or treatment of YBX1-mediated osteoclastosis; here, "YBX1 inhibitor" refers to any substance capable of inhibiting YBX1 gene expression or protein activity, and its form should not be limited. It includes, but is not limited to: small molecule inhibitors, antagonistic antibodies targeting YBX1, nucleic acid aptamers, antisense oligonucleotides, ribozymes, and gene silencing elements such as small interfering RNA (siRNA) and short hairpin RNA (shRNA). Preferably, the YBX1 inhibitor is the polynucleotide SEQ ID NO:1 described in this invention and its variants or a recombinant vector containing that sequence.
[0017] The term "YBX1-mediated osteoclast disease" primarily refers to skeletal system disorders caused by abnormally increased osteoclast activity. Preferably, the disease is a degenerative joint disease, specifically including but not limited to: osteoarthritis (OA), spondyloarthritis (such as degenerative intervertebral disc disease), chondromalacia patellae, and osteonecrosis with subchondral bone collapse (such as femoral head necrosis).
[0018] Based on the crucial role of YBX1 in diseases associated with abnormally increased osteoclast activity, this invention further provides the application of the biomarker YBX1 in the preparation of products for the diagnosis and / or prognostic assessment of such diseases. The product is preferably a diagnostic kit. This kit may contain reagents for detecting the YBX1 protein level or gene expression level in samples (such as blood, synovial fluid, or tissue biopsy samples), for example, specific antibodies against YBX1, primers and probes for quantitative PCR, or capture probes for high-throughput sequencing. By detecting the expression level of YBX1, it can be used to assist in the diagnosis of diseases, assess the degree of disease activity, monitor the effectiveness of drug treatment, or predict the risk of disease progression.
[0019] Beneficial effects
[0020] This invention utilizes adeno-associated virus (AAV) that specifically knocks down Y-box-binding protein 1 (YBX1). By carrying the F4 / 80 promoter, it achieves targeted knockdown of YBX1 in subchondral bone marrow macrophages (BMMs), effectively alleviating joint pain in mice induced by destabilization of the medial meniscus (DMM) surgery, improving subchondral bone destruction and overlying cartilage degeneration, thus providing a theoretical basis for drug development to intervene in the osteoclastization process of subchondral bone to treat osteoarthritis (OA). Behavioral, micro-CT, and histopathological examinations have confirmed that this AAV-shYBX1 can effectively intervene in the osteoclastization process of BMMs, thereby alleviating joint pain in an osteoarthritis (OA) model, improving abnormal subchondral bone remodeling and bone loss, and significantly delaying overlying cartilage degeneration. Compared with existing OA treatments that can only relieve symptoms, the treatment plan provided by this invention can target the cause of OA, achieving comprehensive improvement from structure to symptoms. At the same time, thanks to the tissue targeting of the AAV carrier, systemic toxic side effects are effectively avoided after local administration, providing a new strategy and theoretical basis for the clinical treatment of OA. Attached Figure Description
[0021] Figure 1 Immunofluorescence staining results of YBX1 in subchondral bone of DMM-induced OA mice
[0022] Figure 2 Effects of YBX1 inhibitor SU056 on osteoclast differentiation in BMM
[0023] Figure 3 Local injection of subchondral bone into the knee joint of mice
[0024] Figure 4 Results of hot plate test in groups 1-4 of mice
[0025] Figure 5 Micro-CT results of mice in groups 1-4
[0026] Figure 6 Immunofluorescence staining of mice in groups 1-4
[0027] Figure 7 Histopathological staining results of knee joint tissues in groups 1-4 of mice
[0028] Figure 8 Pathological staining results of visceral tissues in groups 1-4 of mice
[0029] Figure 9 GV407 carrier schematic diagram Detailed Implementation
[0030] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be described in detail below with reference to the accompanying drawings and specific embodiments. The following embodiments are intended to further illustrate the invention, but not to limit the scope of protection of the invention. A typical implementation process of this invention mainly includes: constructing a recombinant adeno-associated virus (AAV) vector that targets and knocks down YBX1; delivering the vector into an osteoarthritis model via local injection into the subchondral bone of the knee joint; and then comprehensively evaluating its therapeutic efficacy and safety from multiple perspectives, including behavioral, imaging, and histopathological aspects, through a series of in vitro and in vivo experiments. The specific implementation process is as follows:
[0031] Example 1: Detection of YBX1 expression changes in subchondral bone of OA mice
[0032] 1.1 Establishment of a mouse OA model
[0033] Male C57BL / 6 mice were anesthetized with sodium pentobarbital and disinfected with povidone-iodine. The hind limb knee joint was exposed, and the skin, subcutaneous tissue, and joint capsule were incised. The medial meniscus ligament was then severed, and the joint capsule and skin were sutured. Mice that underwent sham surgery (only the skin, subcutaneous tissue, and joint capsule were incised and sutured) during the same period served as controls.
[0034] 1.2 Expression and localization of YBX1 in subchondral bone of OA
[0035] Knee joint tissues from mice were collected 1 to 4 weeks post-surgery. After fixation, decalcification, paraffin embedding, and sectioning, YBX1 and macrophage / osteoclast precursor cell (BMM) marker F4 / 80 were co-stained with immunofluorescence. Results are as follows: Figure 1 As shown, with the progression of osteoarthritis (OA), the expression level of YBX1 significantly increased in F4 / 80-positive bone marrow membranes (BMMs) within the subchondral bone region of the mouse knee joint. This result indicates that upregulation of YBX1 expression is closely related to the pathological changes in the subchondral bone of OA.
[0036] Example 2: Verification of the regulatory effect of YBX1 on osteoclast differentiation of BMMs
[0037] To clarify the function of YBX1 in osteoclastosis (OA), primary bone marrow mesenchymal stem cells (BMMs) from C57BL / 6 mice were extracted for in vitro osteoclast-inducing experiments. In addition to the key osteoclast-inducing factor RANKL (50 ng / mL), an experimental group was also included with the YBX1-specific inhibitor SU056.
[0038] After 48 hours of culture, the expression levels of key osteoclast differentiation transcription factors NFATc1 and c-Fos were detected by Western blotting and qPCR. The results showed ( Figure 2Compared with the control group treated with RANKL alone, the expression of NFATc1 and c-Fos was significantly inhibited in the SU056 treatment group. This in vitro experiment demonstrates that inhibiting YBX1 activity can effectively block the osteoclast differentiation process of BMMs, suggesting that YBX1 is a key positive regulator in the osteoclast differentiation process.
[0039] Example 3: Construction of AAV-shYBX1 viral vector targeting subchondral bone micromolecular junctions (BMMs)
[0040] To achieve specific knockdown of YBX1 in BMMs in vivo, a targeted recombinant adeno-associated virus (AAV) vector was designed and constructed.
[0041] 3.1 RNAi target design and vector construction
[0042] Based on the principles of RNAi sequence design, RNAi target sequences were designed for the Ybx1 gene sequence and then constructed into the corresponding gland-associated vector.
[0043] Target gene: Mouse Ybx1 gene (gene ID: 22608).
[0044] Specific RNAi target sequence: AACCATTATAGACGCTATCCA (SEQ ID NO:1). This sequence was designed and named AAV9-Ybx1-RNAi (PSC135344-1).
[0045] Control sequence: To exclude nonspecific effects, a control virus was set up, and the inserted disordered nonspecific sequence was: TTCTCCGAACGTGTCACGT (SEQ ID NO:2), and the corresponding control number was CON578.
[0046] The above sequence was synthesized.
[0047] Viral vector: The vector uses a GV407 backbone, with the following components: pAAV-F4 / 80 promoter (SEQ ID NO:5)-EGFP (SEQ ID NO:6)-MIR155(RNAi) (SEQ ID NO:7)-SV40 PolyA (SEQ ID NO:8). The F4 / 80 promoter drives the specific expression of subsequent components in BMM cells.
[0048] Oligo Synthesis and Cloning: Based on the target sequence and vector multiple cloning site described above, the corresponding single-stranded DNA Oligo was synthesized and then annealed to form double strands. The Oligo used to construct the target vector was named PSC135344-1a (SEQ ID NO: 3) and PSC135344-1b (SEQ ID NO: 4). The annealed double-stranded Oligo was cloned into the enzyme-digested GV407 vector, and the correctness of the inserted sequence was verified by sequencing.
[0049] 3.2 Virus Packaging
[0050] The designed RNAi oligonucleotide sequences were introduced into the GV407 vector (i.e., the recombinant vector carrying shYBX1 and the recombinant vector carrying the control sequence) via the cloning sites EcoRI and NheI. The resulting vector was then co-transfected with pAAV-RC and pHelper vectors into HEK293T cells for viral packaging, with transfection time 3 days. Virus harvesting (i.e., unpurified cell supernatant and cell pellet) was performed from the infected AAV-293 cells, and a high-purity AAV virus preservation solution was obtained through gradient density centrifugation and one ultrafiltration.
[0051] 3.3 Virus testing
[0052] The virus was added to AAV-293 cells for verification. After 24 hours of normal culture, microscopic examination showed no bacterial or fungal contamination. Simultaneously, as a reference for the empty cell group, no obvious particles were found in the intercellular spaces. The culture medium was confirmed to be clear and transparent by light inspection. The final AAV-shYBX1 viral genome titer, determined by ddPCR, was 8.06E+12 vg / mL (reference range ≥1.00E+12 v.g. / mL). The virus was clear in appearance and met experimental requirements (see viral vector diagram). Figure 9 ).
[0053] Example 4: Evaluation of the efficacy of AAV-shYBX1 in vivo for the treatment of OA
[0054] 4.1 Surgical Modeling Procedure
[0055] Male C57BL / 6 mice were randomly divided into 4 groups (n=8 per group) and grouped according to the table below. The overall procedure was as follows: AAV solution was injected one week before modeling, surgical modeling was performed 7 days after injection, and tissue samples were collected 28 days after modeling for functional verification and evaluation.
[0056] Table 1
[0057]
[0058] Wherein, 5E+10 vg means 5 × 10 10The virus was dissolved in 10 μL of physiological saline, the same below; the virus solution was injected into the subchondral bone of the tibial plateau.
[0059] Subchondral bone AAV solution injection procedure: Mice were anesthetized and fixed on the operating table, with the right knee joint area fully exposed. Under aseptic conditions, the skin and joint capsule were incised along the longitudinal axis medial to the patellar ligament, and the tissue was gently dissected to expose the tibial plateau. Subsequently, using a 1 mL syringe, an incision was made medial to the tibial plateau under microscope guidance, and the injectable solution was slowly injected into the subchondral bone in the central region of the tibial plateau using a microsyringe. The injection volume was 10 μL, and the needle was inserted at approximately a 45° angle to a depth of approximately 0.5 mm into the cortical bone. After injection, the needle was held in place for 1 minute to reduce the risk of backflow. Finally, the joint cavity was flushed with sterile saline, and the joint capsule and skin were sutured sequentially (see the injection procedure diagram). Figure 3 DMM surgical modeling was performed 7 days after AAV injection. Behavioral testing and tissue sampling were conducted 28 days after modeling, followed by subsequent pathological examination.
[0060] 4.2 Behavioral Analysis
[0061] Twenty-eight days after modeling, the pain sensitivity of mice was assessed using a hot plate test. Results showed that, compared to the sham-operated group, the response latency to heat stimulation was significantly shortened in the OA model group, indicating increased pain sensitivity. Furthermore, the pain sensitivity of mice in the AAV-shYBX1 treatment group was significantly improved compared to both the OA model group and the empty virus control group, with a significantly prolonged response latency (e.g., ...). Figure 4 (As shown).
[0062] 4.3 Subchondral bone microstructure analysis
[0063] Hind limbs of mice from each group were harvested and fixed. Micro-CT scans were performed on the subchondral bone microstructure of OA mice 4 weeks post-surgery. Quantitative analysis of the scan results was conducted, comparing morphological indicators of bone microstructure in each group, including bone volume fraction (BV / TV), bone mineral density (BMD), trabecular number (Tb.N), trabecular thickness (Tb.Th), and trabecular pattern factor (Tb.Pf). Three-dimensional reconstruction of the scan results was performed using Mimics Research 21.0 software. Results showed that, compared to the normal control group, mice with OA surgery exhibited typical bone loss in the subchondral bone, characterized by decreased bone volume fraction (BV / TV) and trabecular thickness (Tb.Th), and increased trabecular pattern factor (Tb.Pf). In contrast, injection of AAV-shYBX1 improved the abnormal subchondral bone remodeling in OA mice, with BV / TV and Tb.Pf showing the same trend (Table 2). Figure 5 ).
[0064] Table 2. Micro-CT analysis results of mice in groups 1-4
[0065]
[0066] Four weeks post-surgery, mouse knee joint tissue samples were fixed, decalcified, paraffin-embedded, and sectioned to evaluate the treatment efficacy from multiple perspectives. First, to verify the knockdown efficiency of the virus in vivo, frozen sections of subchondral bone tissue were subjected to multiplex immunofluorescence staining with YBX1 and F4 / 80. Figure 6 The results showed that YBX1 signaling in F4 / 80 positive cells was significantly reduced in the AAV-shYBX1 treatment group, confirming that BMMs-specific gene knockdown was achieved. Secondly, TRAP staining results indicated that the number of osteoclasts in the subchondral bone region of this treatment group was significantly reduced compared to the OA model group, demonstrating that osteoclast activity was effectively inhibited. Regarding cartilage protection, Safranin O / Fix Green staining and type II collagen (COLII) immunohistochemical staining results (…) Figure 7 The results showed that AAV-shYBX1 treatment effectively delayed the loss of proteoglycans and type II collagen in the cartilage matrix and significantly reduced the OARSI histological score, demonstrating its clear therapeutic effect on the degeneration of overlying cartilage. Finally, H&E staining of major visceral tissues (heart, liver, spleen, lung, and kidney) was performed. Figure 8 The results showed that no significant pathological changes were caused in any of the virus injection groups, indicating that the local injection of the AAV vector of the present invention has good biosafety.
Claims
1. The use of an isolated polynucleotide, or a recombinant vector comprising said isolated polynucleotide, or a composition comprising said isolated polynucleotide, in the preparation of a medicament for treating YBX1-mediated osteoarthritis, characterized in that, The sequence of the polynucleotide is shown in SEQ ID NO:
1.
2. In the application according to claim 1, the polynucleotide in the recombinant vector is operatively linked to a macrophage-specific promoter; the macrophage-specific promoter is selected from the pAAV-F4 / 80 promoter, CSF1R promoter, CD68 promoter, or CD11b promoter.
3. The application according to any one of claims 1-2, wherein the recombinant vector is a viral vector.
4. In the application according to claim 3, the viral vector is selected from any one of adeno-associated virus vector, adenovirus vector, and lentivirus vector.
5. The application according to claim 1, wherein the composition is a pharmaceutical composition and comprises a pharmaceutically acceptable carrier.
Citation Information
Patent Citations
Novel biomarker of tumor neogenesis blood vessel vascular endothelial cell and cancer therapeutic agent which makes the same target
JP2011088876A
Apoptosis inducer and cancer therapeutic medicine
JP2013216627A
Compositions and methods for the treatment and prevention of neoplastic disorders
WO2008026946A2