Cyclic non-coding RNA circRNA_0049814 and application thereof

Abstract

The present application relates to the technical field of molecular biology, and provides a kind of circular non-coding RNA-circRNA_0049814 and its application.The present application establishes the molecular identification method based on the expression detection of circRNA_0049814 in PBMC, provides new standard gene and effective means for the early diagnosis of pSS.The implementation of the method is helpful to realize the early identification of primary Sjogren's syndrome in clinical through targeted screening, so as to reduce the risk of disease progression and improve the prognosis of patients.In addition, the present application proves by functional experiment that circRNA_0049814 has a regulatory effect on the proliferation of human submandibular gland epithelial cells and the level of inflammatory factors in cell supernatant, reveals its key role in the occurrence and development of primary Sjogren's syndrome, and proves its potential in the treatment of primary Sjogren's syndrome.

Description

Technical Field

[0001] This invention belongs to the field of molecular biology technology, specifically relating to a circular non-coding RNA circRNA_0049814 and its applications. Background Technology

[0002] Primary Sjögren's syndrome (pSS) is a chronic systemic autoimmune disease that primarily affects exocrine glands, leading to symptoms such as dry mouth and dry eyes, and may be accompanied by multi-system involvement. The disease has been shown to have a significant genetic background, with multiple susceptibility genes involved in its pathogenesis. Increasing evidence suggests a close relationship between gene expression regulation, immune response activation, and epigenetic modification. PSS is characterized by lymphocyte infiltration and autoantibody production in exocrine glands as the initiating factor, accompanied by abnormal immune activation, release of inflammatory mediators, and tissue damage, involving the interaction and functional disorder of multiple cells, including glandular epithelial cells, B cells, T cells, and dendritic cells.

[0003] The pathogenesis of primary Sjögren's syndrome (SS) is complex, encompassing multiple aspects including genetic factors, environmental influences, inherent glandular defects, and immune responses. Studies have confirmed that various factors stimulate autoreactive cells such as T and B lymphocytes and macrophages, causing them to produce cytokines and immune complexes, leading to acinar destruction, ductal atrophy, and glandular secretory disorders. Simultaneously, damaged glandular epithelial cells release cytokines and autoantigens, resulting in persistent inflammation and subsequent damage to multiple systems and organs. Research indicates that epithelial cells are the core effector and target cells in the cellular composition of damaged glandular tissue in SS patients. In the early stages of SS, glandular epithelial cells are key to triggering and maintaining local autoimmune responses through abnormal activation, presentation of autoantigens, and secretion of various inflammatory factors such as BAFF and IFN. Furthermore, glandular epithelial cells can express various SSA / Ro and SSB / La autoantigens, activating antigen-specific T and B cells, promoting lymphocyte infiltration and germinal center-like structure formation; glandular epithelial cells can also undergo impaired apoptosis, enhancing their immunogenicity and continuously releasing pro-inflammatory signals. As the disease progresses, widespread damage and death of glandular epithelial cells are the main causes of glandular structural destruction and loss of secretory function. Therefore, abnormal immune activation and damage of epithelial cells are inextricably linked to the occurrence and development of primary Sjögren's syndrome.

[0004] Circular RNA (circRNA) is a class of endogenous non-coding RNAs widely expressed in eukaryotic cells, characterized by structural stability, highly conserved sequences, and tissue-specific expression. For primary Sjögren's syndrome (pSS), current technologies lack novel RNA-level diagnostic biomarkers and therapeutic targets such as circRNA, necessitating further exploration and development based on the pathogenesis of pSS. Summary of the Invention

[0005] The purpose of this invention is to provide a non-coding circular RNA circRNA_0049814 that is significantly highly expressed in peripheral blood mononuclear cells (PBMCs) of patients with primary Sjögren's syndrome and affects the function of human submandibular gland epithelial cells, and to provide its applications in various aspects.

[0006] In a first aspect, a reagent for detecting the expression level of circRNA_0049814 is provided for use in the preparation of diagnostic products for primary Sjögren's syndrome, wherein the nucleotide sequence of circRNA_0049814 is shown in SEQ ID NO: 1.

[0007] As an optional option, the reagent includes a specific primer pair for circRNA_0049814; the specific primer pair includes a forward primer as shown in SEQ ID NO: 2 and a reverse primer as shown in SEQ ID NO: 3.

[0008] As an optional option, the products include reagents, test strips, kits, gene chips, or high-throughput sequencing platforms.

[0009] As an optional approach, the method of using the diagnostic product for primary Sjögren's syndrome includes: detecting the expression level of circRNA_0049814 in PBMCs of the subject's blood sample; comparing the expression level of circRNA_0049814 with a preset value; if it is higher than the preset value, the subject is highly likely to have primary Sjögren's syndrome.

[0010] Secondly, the present invention provides a detection kit for primary Sjögren's syndrome, the detection kit containing a preparation for detecting the expression level of circRNA_0049814, the nucleotide sequence of which is shown in SEQ ID NO: 1.

[0011] As an optional option, the test kit includes RNA extraction reagents, reverse transcription reagents, real-time quantitative PCR reagents, and primers that can specifically amplify circRNA_0049814; its usage includes extracting RNA from the subject's blood sample, preparing cDNA, amplifying circRNA_0049814 by real-time quantitative PCR, measuring the expression level of circRNA_0049814, and comparing the expression level with a preset value to determine whether the subject has primary Sjögren's syndrome.

[0012] The above-described uses and detection kit for circRNA_0049814 reveal a diagnostic method for primary Sjögren's syndrome provided by this invention. Based on the detection of circRNA_0049814 expression levels in PBMCs, a significant upregulation of this gene expression in subjects compared to healthy controls suggests a risk of Sjögren's syndrome or salivary gland damage. Therefore, circRNA_0049814 can serve as a potential molecular marker for diagnosing or predicting the risk of Sjögren's syndrome.

[0013] Thirdly, the present invention provides the use of an inhibitor of circRNA_0049814 in the preparation of a therapeutic drug for primary Sjögren's syndrome, wherein the inhibitor comprises siRNA of circRNA_0049814, the sense strand nucleotide sequence of the siRNA is shown in SEQ ID NO: 4, and the antisense strand nucleotide sequence is shown in SEQ ID NO: 5.

[0014] Fourthly, the present invention provides a therapeutic drug for primary Sjögren's syndrome, comprising an inhibitor of circRNA_0049814, said inhibitor comprising siRNA of circRNA_0049814, the sense strand nucleotide sequence of said siRNA being shown in SEQ ID NO: 4, and the antisense strand nucleotide sequence being shown in SEQ ID NO: 5.

[0015] Alternatively, the drug may include a pharmaceutically acceptable carrier or excipient.

[0016] Alternatively, the drug may include injectable or oral formulations.

[0017] This invention establishes a molecular identification method based on the detection of circRNA_0049814 expression in peripheral blood micromolecular cells (PBMCs), providing a novel standard gene and effective means for the early diagnosis of primary Sjögren's syndrome (pSS). The implementation of this method can facilitate early identification of pSS through targeted screening in clinical practice, potentially reducing the risk of disease progression and improving patient prognosis. Compared to existing diagnostic methods that rely on invasive procedures such as labial gland biopsy or have serological limitations, this invention uses peripheral blood testing, offering advantages such as minimal invasiveness, high reproducibility, and high patient acceptance, making it particularly suitable for early screening and auxiliary diagnosis in serologically negative patients.

[0018] Furthermore, this invention demonstrates through functional experiments that circRNA_0049814 has a regulatory effect on the proliferation of human submandibular epithelial cells and the level of inflammatory factors in the cell supernatant, revealing its key role in the occurrence and development of primary Sjögren's syndrome and proving its potential in the treatment of primary Sjögren's syndrome. Attached Figure Description

[0019] Figure 1 Characterize the expression of circRNA_0049814 in clinical specimens.

[0020] Figure 2 The results of receiver operating characteristic (ROC) curve analysis of circRNA_0049814 in clinical specimens.

[0021] Figure 3 The expression characteristics of circRNA_0049814 were identified in another clinical specimen.

[0022] Figure 4 The receiver operating characteristic curve analysis results for circRNA_0049814 in another clinical specimen.

[0023] Figure 5 This refers to the siRNA silencing effect.

[0024] Figure 6 To verify using CCK8 experiments that silencing the expression of circRNA_0049814 in human submandibular epithelial cells in vitro can promote the proliferation activity of human submandibular epithelial cells.

[0025] Figure 7 ELISA experiments confirmed that silencing the expression of circRNA_0049814 in human submandibular epithelial cells in vitro can reduce the levels of inflammatory factors IL-1β and IL-6. Detailed Implementation

[0026] The technical solution of the present invention will be described in detail below with reference to specific embodiments.

[0027] Studies have shown that circRNAs exhibit significant differential expression in the peripheral blood and salivary gland tissues of patients with primary Sjögren's syndrome (SS). As an autoimmune disease regulated by both genetic and epigenetic factors, researching the gene regulatory network mediated by circRNAs at the post-transcriptional level can provide a deeper understanding of its immune abnormalities and glandular damage mechanisms. circRNAs participate in regulating key pathological processes such as lymphocyte activation, the type I interferon pathway, and glandular epithelial cell apoptosis by acting as miRNA sponges, regulating parental gene transcription, and interacting with proteins. Therefore, exploring the function of circRNAs helps to systematically elucidate the pathogenesis of primary Sjögren's syndrome and provides a theoretical basis for developing novel RNA-level diagnostic biomarkers and therapeutic targets.

[0028] This invention discovered that circRNA_0049814 is differentially expressed in the peripheral blood of pSS patients. Using it as a target circRNA, further research was conducted on its role as a detection biomarker and therapeutic target.

[0029] Based on circRNA_0049814, this invention provides its application as a diagnostic biomarker and its application as a therapeutic target.

[0030] The circRNA_0049814 is a human circular RNA containing a backsplicing site. This sequence (SEQ ID NO: 1) is as follows:

[0031] GGCCCCTTTGTAACGTGGAGATCAATGAGGTGTGCTTCCAGCCCATGCGGCGAGGGAGGTTCCTGTGTGGATGGGGAAAATGGCTTCCGCTGCCTCTGCCCNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNTGGCTTCTGGTCAAAATCCCTGTGTAGCTGAATTCCCAAGCCCTGCATTGTACAGCCCCCCACTCCCTCACCACCTAATAAAGGAATAGTTAACACTCA

[0032] In the above sequence, "N" represents an undetermined base, meaning the base at that position could be any of A, T, G, or C. These undetermined bases typically appear in the back-splice junction region of circular RNA. "N" indicates that the bases in this region cannot be definitively identified using current sequencing techniques, but this region does not affect the biological function of the circRNA or its role as a diagnostic biomarker. With current technology, it is still possible to accurately detect the expression level of the circRNA or to design and synthesize siRNA targeting it; therefore, the presence of the N region does not affect the implementation and application of this invention.

[0033] Regarding diagnostic biomarkers, the present invention provides the application of reagents for detecting the expression level of circRNA_0049814 in the preparation of diagnostic products for primary Sjögren's syndrome. From another perspective, it provides a detection product for primary Sjögren's syndrome. This product includes reagents, test strips, kits, gene chips, or high-throughput sequencing platforms, etc. In some detection methods, the expression level of circRNA_0049814 in PBMCs of a subject's blood sample is specifically detected; the expression level of circRNA_0049814 is compared with a preset value; if it is higher than the preset value, the subject is highly likely to have primary Sjögren's syndrome.

[0034] Here, the term "expression level" refers to the statistically significant value of expression, specifically the relative expression level of the target circRNA, circRNA_0049814, after standardization. More specifically, in some protocols, this standardization is achieved by obtaining the difference in the cycle threshold (Ct) between the target circRNA and an internal reference gene (such as U6) through real-time quantitative PCR. For sample comparison, a further 2... –ΔΔCT The relative expression level was calculated to reflect the transcriptional abundance of the target circRNA relative to the internal reference gene in the subject sample.

[0035] The "preset value" refers to a diagnostic threshold used to distinguish whether a subject has a disease. In some protocols, this preset value is obtained from known healthy population samples through statistical data processing. Specifically, the expression level of circRNA_0049814 detected in healthy populations is used as a reference, and the expression level value that is higher than this reference value to a certain extent or has a statistically significant difference is used as the preset value.

[0036] Regarding therapeutic targets, the present invention provides the application of circRNA_0049814 as a therapeutic target. Specifically, the present invention has found that by inhibiting the expression of circRNA_0049814, such as by constructing siRNA of circRNA_0049814, it is possible to regulate the proliferation of human submandibular gland epithelial cells and the level of inflammatory factors in the cell supernatant, thereby achieving the effect of treating Sjögren's syndrome, indicating its potential for pSS drug development.

[0037] Example 1: Efficacy of circRNA_0049814 as a diagnostic biomarker for primary Sjögren's syndrome

[0038] 1. Enrolled patients: 30 patients with primary Sjögren's syndrome and 50 normal control group were enrolled.

[0039] The patient group consisted of newly diagnosed patients meeting the 2002 revised International Classification (Diagnosis) criteria for Sjögren's syndrome, excluding other connective tissue diseases, autoimmune diseases, hematologic malignancies, graft-versus-host disease, hepatotropic virus infection, and human immunodeficiency virus infection. None of them had received glucocorticoid or immunosuppressant treatment prior to blood collection, and none had a history of organ transplantation or viral hepatitis. The normal control group consisted of healthy individuals with normal blood routine, liver and kidney function, ESR, CRP, and immunoglobulin levels. They had no serious bacterial or viral infections within two weeks prior to blood collection, no vaccination history within four weeks, and no history of autoimmune diseases, organ transplantation, hematologic malignancies, viral hepatitis, or HIV infection.

[0040] 2. Experimental Methods

[0041] 2.1 Separating the Sample

[0042] After collecting heparin-anticoagulated whole blood samples, PBMCs were separated using density gradient centrifugation. The cell pellet was first resuspended moderately in PBS, and then slowly stacked onto the upper layer of an equal volume of human lymphocyte separation medium. After centrifugation, a distinct white membrane layer was visible at the interface; this cell layer was collected and washed twice with PBS. The cell pellet was then stored in TRIzol reagent for subsequent RNA extraction. Total RNA was extracted using chloroform extraction, and phase separation was achieved by centrifugation at 12000g for 15 minutes. RNA in the aqueous phase was precipitated by adding an equal volume of isopropanol and centrifuging at 12000g for 10 minutes; it was then washed and purified by centrifugation at 7500g for 5 minutes with 75% ethanol. Finally, the purified RNA was dissolved in RNase-free water.

[0043] 2.2 Primer Design

[0044] PCR-specific primers were designed and synthesized by Sangon Biotech Co., Ltd.

[0045] The primers are as follows:

[0046] hsa_circRNA_0049814, Forward primer: AAGGAATAGTTAACACTCAGGCCC (SEQ IDNO: 2);

[0047] hsa_circRNA_0049814, Reverse primer: CATTTTCCCCATCCACACAGG (SEQ ID NO: 3).

[0048] 2.3 Reverse transcription reaction

[0049] The reverse transcription reaction was performed using the Evo M-MLV reverse transcription premixed kit according to the instructions.

[0050] 2.4 PCR amplification

[0051] The reaction mixture was prepared according to the instructions of the TB Green™ Premix Ex Taq™ II (Tli RNaseH Plus) quantitative kit. The total volume was 20 μL, containing: 10 μL of 2× premix, 0.4 μL each of forward and reverse primers, 2 μL of cDNA template, and 7.8 μL of ddH2O. The PCR amplification program was set as follows: 95℃ pre-denaturation for 30 seconds; followed by 40 cycles of 95℃ denaturation for 5 seconds and 60℃ annealing / extension for 30 seconds; finally, melting curves were collected (95℃ for 10 seconds, 65℃ for 1 minute, 97℃ for 1 second). Relative gene expression levels were determined by 2... –ΔΔCT The calculation was performed using the algorithm, and the data was visualized using GraphPad Prism 10 software.

[0052] 3. Experimental Results

[0053] The results showed that the expression abundance of circRNA_0049814 differed significantly between the two groups (P < 0.001). Furthermore, it was significantly higher in PBMCs of patients with primary Sjögren's syndrome than in the control group. Figure 1 Furthermore, ROC curve analysis showed that the gene expression level had a certain ability to distinguish pSS patients from controls, with an area under the curve (AUC) of 0.849 and a cut-off value of 2.667. At the optimal cut-off value, the diagnostic sensitivity was 70.0% and the specificity was 98.0%. Figure 2 ).

[0054] Example 2: Validation of circRNA_0049814 in the diagnosis of primary Sjögren's syndrome (pSS)

[0055] To further validate the stability and applicability of circRNA_0049814 as a diagnostic biomarker in patients with primary Sjögren's syndrome (pSS), repeated testing and analysis were performed using another independent sample set.

[0056] 1. Sample Information

[0057] In addition, 64 patients with primary Sjögren's syndrome and 100 normal controls were collected. The inclusion criteria for the patient group and the normal control group were the same as those for the patient group and the normal control group in Example 1.

[0058] 2. Experimental Methods

[0059] The experimental procedures used in this embodiment (including PBMC isolation, RNA extraction, primer design, reverse transcription, and qPCR) are the same as in Example 1. The qPCR reaction conditions and data processing methods are also the same. The relative expression level was calculated using the 2^-ΔΔCT method, and GraphPad Prism 10 was used for statistical analysis and graphing.

[0060] 3. Experimental Results

[0061] The results showed that circRNA_0049814 was again significantly highly expressed in pSS patients in this validation set, with a statistically significant difference compared to the control group (p<0.001). Figure 3 As shown.

[0062] Further ROC curves were plotted to evaluate the diagnostic performance of this circRNA. The results showed that the AUC (area under the curve) was 0.866 and the cut-off value was 2.479. At the optimal cut-off value, its diagnostic sensitivity was 90.6% and its specificity was 82%. Figure 4 It can be considered that this circRNA can serve as a biomarker for the diagnosis of primary Sjögren's syndrome.

[0063] The validation set results provided in this embodiment are consistent with those in Example 1, further confirming that circRNA_0049814 exhibits stable differential expression and good diagnostic efficacy in patients with primary Sjögren's syndrome, demonstrating its potential as a diagnostic biomarker. circRNA_0049814 shows potential clinical application value as a diagnostic and differential diagnostic tool for pSS.

[0064] Example 3: Constructing a silencing model of circRNA_0049814 in human submandibular gland epithelial cells

[0065] 1. Materials

[0066] 1.1 Cells and siRNA

[0067] The human submandibular gland epithelial cells used in this invention were purchased from Tongpai Technology Co., Ltd., and cultured using Roswell Park Memorial Institute (RPMI) 1640 medium. The culture conditions were 37°C and 5% CO2. Small interfering RNA (siRNA) was designed and synthesized.

[0068] The silent circRNA_0049814 (siRNA) sequence, RNAi-1 sense strand: CUCAGGCCCCUUUGUAACGTT (SEQ ID NO: 4), antisense strand: CGUUACAAAGGGGCCUGAGTT (SEQ ID NO: 5).

[0069] 2. Methods

[0070] 2.1 Expression of circRNA_0049814 in human submandibular gland epithelial cells

[0071] Human submandibular epithelial cells were counted and seeded, reaching a cell density of approximately 70% after 2 days of culture. Transfection experiments were then performed using Lipofectamine™ 2000 transfection reagent, with the following steps: Lipofectamine™ 2000 and circRNA mixtures were prepared separately. For the former, 250 μl of serum-free and antibiotic-free DMEM medium was added to a 1.5 ml sterile EP tube, followed by 5 μl of Lipofectamine™ 2000, and incubated at room temperature for 5 minutes. For the latter, an equal volume of the same medium and 5 μl of circRNA solution were added to another EP tube, and incubated at room temperature for 5 minutes. The two solutions were then mixed and incubated at room temperature for 20 minutes to promote complex formation. Finally, 500 μl of DMEM medium was added to prepare the transfection working solution. Before transfection, the original medium in the six-well plates was aspirated, and the cells were gently rinsed twice along the well walls with PBS. The transfection working solution was then slowly added along the well walls, and after 8 hours, the medium was replaced with 2 ml of complete DMEM medium for continued culture. Continue culturing for 48 hours until the cell density reaches approximately 90%, then detect the expression level of circRNA_0049814 in the cells using qPCR.

[0072] 3. Results

[0073] Total RNA was extracted from human submandibular gland epithelial cells, and the expression level of circRNA_0049814 was detected by qPCR. The results showed that the expression of circRNA_0049814 was significantly downregulated in the si-RNA transfection group compared with the si-NC transfection group, indicating that the silencing model of circRNA_0049814 in this cell line was successfully established. Figure 5 The establishment of this model provides a foundation for further in-depth research into the function of circRNA_0049814 in human submandibular epithelial cells.

[0074] Example 4: The regulatory effect of circRNA_0049814 on the proliferation of human submandibular gland epithelial cells

[0075] 1. Materials

[0076] 1.1 Cells

[0077] The cells and culture methods used in the experiment were the same as in Example 3.

[0078] 1.2 Reagents

[0079] The siRNA used in the experiment was the same as in Example 3. CCK-8 was purchased from Qisai Biotechnology, catalog number QS-S321.

[0080] 2. Methods

[0081] 2.1 CCK8 proliferation experiment

[0082] Following Example 3, siRNA was transfected, and the transfected human submandibular gland epithelial cells were seeded into 96-well plates at a density of 5 × 10⁶ cells / well. 3 Cells were seeded per well in a 96-well plate. 200 μl of sterile PBS was added to the well surrounding each cell. The plates were incubated overnight at 37°C with 5% CO2. Incubation was repeated for 1 day, 2 days, and 3 days. 10 μl of CCK8 was added to each well, and the plates were incubated for 2 hours. The absorbance of each well was measured using a microplate reader at OD 450, and a growth curve was plotted.

[0083] 3. Results

[0084] This invention used the CCK8 assay to detect the proliferation of human submandibular gland epithelial cells after in vitro transfection with siRNA to silence circRNA_0049814. The results showed that cell proliferation was significantly increased in the circRNA_0049814 silencing group. Figure 6 The results suggest that circRNA_0049814 has the ability to inhibit the proliferation of human submandibular gland epithelial cells.

[0085] Example 5: Regulatory effect of circRNA_0049814 on inflammatory factors in the supernatant of human submandibular gland epithelial cell culture

[0086] 1. Materials

[0087] 1.1 Cells

[0088] The cells and culture methods used in the experiment were the same as in Example 3.

[0089] 1.2 Reagents

[0090] The siRNA used in the experiment was the same as in Example 3. The ELISA detection kit was obtained from Plankton Biotechnology, IL-6 catalog number FY-2899A1, IL-1β catalog number FY-2776A1.

[0091] 2. Methods

[0092] 2.1 ELISA serological detection

[0093] Human submandibular gland epithelial cells in the logarithmic growth phase and in good growth condition were selected and processed at a concentration of 5 × 10⁻⁶ cells / year. 5 Cells were inoculated into 6-well plates and cultured overnight at 37°C. siRNA was transfected according to Example 1. After 72 hours of cell culture, the cell culture supernatant was collected for later use. The cell culture supernatant was diluted according to the ELISA kit instructions and the IL-6 and IL-1β levels in the cell culture supernatant were detected.

[0094] 3. Results

[0095] To verify whether circRNA_0049814 affects the levels of inflammatory factors in the culture supernatant of human submandibular epithelial cells, this invention used ELISA serological experiments to detect changes in the levels of inflammatory factors in the culture supernatant after siRNA transfection. It was found that the levels of IL-6 and IL-1β in the cell culture supernatant of the circRNA_0049814 silencing group were significantly reduced. Figure 7 The results suggest that circRNA_0049814 has the ability to promote the expression of inflammatory factors.

[0096] Based on the experimental results of the above embodiments, it can be concluded that circRNA_0049814 is a key molecule involved in the pathogenesis of pSS and regulating the function of submandibular gland epithelial cells, and inhibitors of circRNA_0049814 have the potential to be used as therapeutic drugs for pSS. Furthermore, the detection of its expression level demonstrates its potential clinical application value as a diagnostic and differential diagnostic tool for pSS.

[0097] The present invention has been described in detail above with reference to specific embodiments and exemplary examples. However, these descriptions should not be construed as limiting the present invention. Those skilled in the art will understand that various equivalent substitutions, modifications, or improvements can be made to the technical solutions and embodiments of the present invention without departing from the spirit and scope of the present invention, and all such modifications and improvements fall within the scope of the present invention.

Claims

1. Application of a reagent for detecting the expression level of circRNA_0049814 in the preparation of diagnostic products for primary Sjögren's syndrome, wherein the nucleotide sequence of circRNA_0049814 is shown in SEQ ID NO:

1.

2. Use according to claim 1, characterized in that, The reagent includes a specific primer pair for circRNA_0049814; the specific primer pair includes a forward primer as shown in SEQ ID NO: 2 and a reverse primer as shown in SEQ ID NO:

3.

3. Use according to claim 1, characterized in that, The products include reagents, test strips, kits, gene chips, or high-throughput sequencing platforms.

4. The application according to claim 1, characterized in that, The method of using the diagnostic product for primary Sjögren's syndrome includes: detecting the expression level of circRNA_0049814 in PBMCs of the subject's blood sample; comparing the expression level of circRNA_0049814 with a preset value; if it is higher than the preset value, the subject is highly likely to have primary Sjögren's syndrome.

5. The application of an inhibitor of circRNA_0049814 in the preparation of a therapeutic drug for primary Sjögren's syndrome, wherein the inhibitor is siRNA of circRNA_0049814, the sense strand nucleotide sequence of the siRNA is shown in SEQ ID NO: 4, and the antisense strand nucleotide sequence is shown in SEQ ID NO:

5.

6. A treatment for primary Sjögren's syndrome, characterized in that, The inhibitor includes an inhibitor of circRNA_0049814, wherein the inhibitor is a siRNA of circRNA_0049814, the nucleotide sequence of the sense strand of the siRNA is shown in SEQ ID NO: 4, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

5.

7. The therapeutic agent for primary Sjögren's syndrome according to claim 6, characterized in that, This includes pharmaceutically acceptable carriers or excipients.

Images