A valencene synthase mutant and use thereof
By mutating specific amino acid sequences of walrenene synthase to enhance its activity, the problem of low walrenene yield was solved, enabling efficient production of walrenene by the strain and meeting market demand.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- CATAYA BIO (SHANGHAI) CO LTD
- Filing Date
- 2023-12-29
- Publication Date
- 2026-06-19
AI Technical Summary
In existing technologies, the activity of walene synthase is not high, resulting in low yields of walene in microbial cell factories, which is difficult to meet market demand.
By mutating specific amino acid sequences of walrenene synthase derived from North American cypress, including single-site, two-site, and three-site combination mutations, its activity was enhanced, and the walrenene synthase mutant was expressed in Saccharomyces cerevisiae to construct a highly efficient walrenene-synthesizing strain.
It significantly improved the activity of walrenene synthase, resulting in a walrenene yield that was 3.41 times higher than that of the wild type, providing a highly efficient walrenene preparation tool enzyme to meet market demand.
Smart Images

Figure CN121271850B_ABST
Abstract
Description
[0001] This application is a divisional application of patent application number 202311858357.9 (the original application was filed on December 29, 2023, and the invention was entitled "A Valenene Synthase Mutant and Its Application"). Technical Field
[0002] This invention belongs to the field of synthetic biology technology and relates to a Valenene synthase mutant and its applications. Background Technology
[0003] Valencene is a natural sesquiterpene with a citrus aroma, a characteristic aroma component of the citrus genus, and is widely used as a flavoring agent in food and beverage production, possessing high economic value. More importantly, valencene can serve as a precursor to produce another higher-value functional sesquiterpene, nocaketone. Nocaketone not only has a unique grapefruit aroma but also possesses insecticidal, antioxidant, antibacterial, anti-inflammatory, and antitumor properties, making it widely used in food, cosmetics, and pharmaceuticals. A sufficient supply of valencene is crucial for maintaining nocaketone production.
[0004] Currently, commercially available valenene is obtained through the distillation of citrus oil. However, due to its low content in citrus fruits, the yield of valenene is low, and its quality, availability, and price are easily affected by environmental factors such as land use and climate change. In recent years, the rapid development of synthetic biology has accelerated the construction of microbial cell factories, providing an alternative method for the synthesis of high-value-added products. It has been reported that expressing valenene synthase in microorganisms can achieve heterologous biosynthesis of valenene using microbial cell factories, but the achievable yield levels are still very low. In 2014, Beek Wilder et al. discovered the valenene synthase CnVS from *Callitropsis nootkatensi*, but its expression in wild-type yeast only synthesized 1.4 mg / L of valenene.
[0005] Currently, the yield of walrenene synthesized by microbial engineered strains is relatively low, which is difficult to meet market demand. The main limiting factor is the low activity of walrenene synthase. Therefore, obtaining high-activity walrenene synthase is the main bottleneck and research hotspot for efficient biosynthesis of walrenene. Developing high-activity walrenene synthase mutants is of great significance for the production and application of walrenene. Summary of the Invention
[0006] To address the shortcomings of existing technologies and practical needs, this invention provides a walrenene synthase mutant and its applications, and develops highly active walrenene synthase mutants.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] In a first aspect, the present invention provides a Valenene synthase mutant, wherein the amino acid sequence of the Valenene synthase mutant comprises any one of the following sequences:
[0009] (1) The following mutations occur based on the sequence shown in SEQ ID NO.3: any one or at least two combinations of the following sequences: G435R, E496D, I443C, L561F, E489V, E306S, L550S, E306D, S471C, L550S, W310F, M445L, Y549F, S471V, K486C, L477I, L336I, T343F, R442N, R442K, F335Y, F335V, I420C, I340F, I420F, V485I, R572N, Y413F, R572S, or Q472I; or,
[0010] (2) A sequence obtained by substitution, deletion, or addition of one or at least two amino acid residues from the sequence described in (1), and which has the same or similar function as the sequence described in (1); or,
[0011] (3) A sequence that has at least 90% sequence homology with the sequence described in (1) or (2) and has the same or similar function as the sequence described in (1).
[0012] In this invention, the valenene synthase CnVS, derived from North American golden cypress (Callitropsis nootkatensis), is modified by introducing specific mutations, which can significantly improve its activity, providing a novel and effective tool enzyme for the preparation of valenene.
[0013] In this invention, introducing a specific mutation into wild-type varenyl synthase can improve its polymerization activity by up to 241%. It is understood that, based on the varenyl synthase mutant, those skilled in the art can use common techniques in the art to substitute, delete, or add one or at least two amino acid residues to obtain other sequences with the same or similar functions.
[0014] SEQ ID NO.3:
[0015] .
[0016] In this invention, the term "homology" can be evaluated visually or using computer software commonly used in the art. When the positions in the compared sequences are occupied by the same bases or amino acids, the molecules are identical at that position. Homology between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the homology between related sequences. "Sequence homology" of a polynucleotide or amino acid sequence with another sequence at a certain percentage (e.g., 90%, 95%, 98%, or 99%) means that when the sequences are aligned, that percentage of bases or amino acids are the same in the two compared sequences.
[0017] This invention verifies that 30 single-site mutations, including two-site combination mutations and three-site combination mutations, can effectively improve enzyme activity. It is understood that any combination of at least two of these 30 single-site mutations can improve enzyme activity and should be within the scope of protection of this invention.
[0018] Preferably, the combination mentioned in (1) includes any one of the following combinations: G435R and E496D, E489V and E306D, L550S and I443C, L561F and Y549F, G435R, I443C and E496D, or G435R, E496D and L561F.
[0019] In a second aspect, the present invention provides a nucleic acid molecule that encodes the varenen synthase mutant described in the first aspect.
[0020] Thirdly, the present invention provides a recombinant vector containing the nucleic acid molecules described in the second aspect.
[0021] Fourthly, the present invention provides a recombinant cell containing the recombinant vector described in the third aspect or the nucleic acid molecule described in the second aspect integrated into the genome.
[0022] Preferably, the starting cell for the recombinant cells includes Saccharomyces cerevisiae.
[0023] Preferably, the brewing yeast includes brewing yeast CEN.PK2-1C.
[0024] Preferably, the recombinant cells also overexpress farnesyl pyrophosphate synthase and 3-hydroxy-3-methylglutaryl-CoA reductase.
[0025] Fifthly, the present invention provides a method for preparing the varenen synthase mutant described in the first aspect, the method comprising:
[0026] The nucleic acid molecule encoding the varenin synthase mutant described in the first aspect is inserted into an expression vector to obtain a recombinant vector. The recombinant vector is introduced into a host cell, or the nucleic acid molecule is directly integrated into the genome of the host cell to obtain a genetically engineered bacterium. The bacterium is then cultured and purified by enzyme separation to obtain the varenin synthase mutant.
[0027] Preferably, the host cell comprises Saccharomyces cerevisiae.
[0028] Preferably, the brewing yeast includes brewing yeast CEN.PK2-1C.
[0029] In a sixth aspect, the present invention provides the use of the walene synthase mutant described in the first aspect, the nucleic acid molecule described in the second aspect, the recombinant vector described in the third aspect, or the recombinant cell described in the fourth aspect in the preparation of walene.
[0030] In a seventh aspect, the present invention provides a method for preparing walnutene, the method comprising:
[0031] The nucleic acid molecule encoding the valenene synthase mutant described in the first aspect is inserted into the expression vector to obtain a recombinant vector. The recombinant vector is introduced into a host cell, or the nucleic acid molecule is directly integrated into the genome of the host cell to obtain a genetically engineered bacterium. The bacterium is then cultured and valenene is isolated and purified to obtain the valenene.
[0032] Compared with the prior art, the present invention has the following beneficial effects:
[0033] This invention utilizes directed evolution of wild-type walrenene synthase derived from Callitropsis nootkatensis in North America to obtain a walrenene synthase mutant with enhanced enzyme performance. The strain obtained using the synthase mutant achieved a walrenene yield up to 3.41 times that of the wild-type synthase strain, providing a novel and effective tool enzyme for walrenene preparation. Attached Figure Description
[0034] Figure 1 Here is the gas chromatogram of the varenene standard;
[0035] Figure 2 This is a gas chromatogram of the product of strain YC3. Detailed Implementation
[0036] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.
[0037] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.
[0038] Example 1
[0039] This embodiment constructs a background yeast strain for producing walrenene.
[0040] This invention uses the wild-type yeast strain CEN.PK2-1C (purchased from Euroscarf) as the starting strain for the production of valenene. One copy of the farnesyl pyrophosphate synthase gene ERG20 (SEQ ID NO.1) and one copy of the truncated 3-hydroxy-3-methylglutaryl-CoA reductase tHMG1 (SEQ ID NO.2) were inserted into the dpp1 site of the genome, using the gRNA sequence ATGTAAAACTGACGTTCGAA, to construct the corresponding gRNA-1 plasmid. Then, one copy of ERG20 and one copy of tHMG1 were inserted into the lpp1 site, using the gRNA sequence CCAGGGATATCTCCGAATAG, to construct the corresponding gRNA-2 plasmid. Simultaneously, two donor plasmids, pYC1 and pYC2, containing the complete expression cassettes of ERG20 and tHMG1 and upstream and downstream homologous arms of the integration site were constructed. Using CEN.PK2-1C as a template, the desired fragment was amplified using primers. After gel recovery, it was ligated into the HindШ digested expression vector pUC19 using the Novozymes homologous recombination kit. After sequencing confirmation, two donor plasmids containing ERG20 and tHMG1 were obtained and named pYC1 and pYC2. The required primers and fragments are shown in Table 1.
[0041] Table 1. Fragments, primers, and primer sequences required for vector construction in Example 1.
[0042]
[0043] Using primers P-F1 / P-R7 and plasmid pYC1 as a template, the Donor 1 fragment was amplified. This fragment, along with plasmids containing Cas9 and gRNA-1, was then transformed into competent cells of yeast strain CEN.PK2-1C using the PEG / LiAC method, yielding strain YC1. Next, using primers P-F8 / P-R11 and plasmid pYC2 as a template, the Donor 2 fragment was amplified. This fragment, along with plasmids containing Cas9 and gRNA-2, was then transformed into competent cells of yeast strain YC1 using the PEG / LiAC method, yielding strain YC2.
[0044] SEQ ID NO.1
[0045]
[0046] SEQ ID NO.2
[0047]
[0048] Example 2
[0049] This embodiment constructs a varenene synthesis carrier.
[0050] The valenyl synthase CnVS (amino acid sequence shown in SEQ ID NO.3) from *Callitropsis nootkatensis* was selected. After optimizing the coding sequence of CnVS according to the *Saccharomyces cerevisiae* codons, the gene was synthesized using Genewiz, and its nucleotide sequence is shown in SEQ ID NO.4. CRISPR-Cas9-mediated genome editing is a commonly used synthetic biology tool in *Saccharomyces cerevisiae*. The wild-type valenyl synthase CnVS was integrated into the *ho* site of the genome using the CRISPR-Cas9 method. The gRNA sequence used was *acgactattctgatggctaa*, and the corresponding gRNA-3 plasmid was constructed. Specific gene primer pair P-F14 / P-R14 was designed. Using the synthesized gene CnVS (SEQ ID NO.4) as a template, the CnVS gene fragment was obtained by PCR amplification using the high-fidelity enzyme phanta from Novizan. Simultaneously, using Saccharomyces cerevisiae CEN.PK2-1C as a template, primers P-F13 / P-R13 and P-F15 / P-R15 were selected for PCR amplification to obtain the promoter pGAL1 and terminator tCYC1 fragments. Continuing to use Saccharomyces cerevisiae CEN.PK2-1C as a template, primers P-F12 / P-R12 and P-F16 / P-R16 were used to amplify the upstream and downstream homologous arms UH1 and DH1 fragments of the integration site. After the above fragments were recovered using the Tiangen Gel Recovery Kit, they were ligated into the HindIII-digested expression vector pUC19 using the Novizan Seamless Assembly Kit. After sequencing confirmation, the donor plasmid containing the complete wild-type CnVS expression cassette and upstream and downstream homologous arms of the integration site was obtained and named pYC3.
[0051] Table 2 Primers and their sequences required for Example 2
[0052]
[0053] SEQ ID NO.4:
[0054]
[0055] Example 3
[0056] This embodiment constructs a walrenene-synthesizing strain and a well plate fermentation.
[0057] Using primers P-F12 / P-R16 and plasmid pYC3 as a template, the Donor3 fragment UH1-pGAL1-CnVS-tCYC1-DH1 was amplified. This fragment, along with plasmids containing Cas9 and gRNA-3, was then transformed into competent cells of yeast strain YC2 using the PEG / LiAC method to obtain strain YC3.
[0058] Strains YC2 and YC3 were inoculated into 96-well plates containing YPD seed medium (seed medium: 20 g / L peptone, 10 g / L yeast extract, 20 g / L glucose) and cultured at 30℃ and 1000 rpm for 48 h. They were then transferred to wells containing fermentation medium (20 g / L peptone, 10 g / L yeast extract, 40 g / L glucose, with 20% of the fermentation broth volume covered by n-dodecane or isopropyl myristate) and cultured at 30℃ and 1000 rpm for 48 h. Methanol and n-heptane were added to the samples in the wells, and the plates were shaken vigorously for 20 min and centrifuged. A small amount of the oil phase was collected for gas chromatography analysis. Analysis was performed on an Agilent GC8890 gas chromatograph equipped with an Agilent HP-5 capillary column (30.0 m × 0.32 mm × 0.25 μm). The injector and FID detector temperatures were set to 280℃ and 300℃, respectively. The gas flow rate through the column was set to 2 mL / min for the first 3 min and 3 mL / min for the next 1.675 min. The initial column temperature was maintained at 150℃ for 1.5 min, increased to 180℃ at a rate of 16℃ / min, then increased to 300℃ at a rate of 120℃ / min for 0.3 min, and then cooled to 150℃ until the next injection. The sample injection volume was 1 μL, the split ratio was 50:1, the air flow rate was 300 mL / min, the hydrogen flow rate was 30 mL / min, and the carrier gas flow rate was 25 mL / min. Quantitative analysis was performed using a standard curve established based on gas chromatography to determine the concentration of walrenene in the intact culture medium. After GC detection, the walrenene yield of strain YC2 was 0 mg / L, and the walrenene yield of strain YC3 was 45 mg / L. The gas chromatogram of the walrenene standard is shown below. Figure 1 As shown, the chromatogram of the product of strain YC3 is as follows. Figure 2 As shown, the peak elution time of Valenene is 3.587 min.
[0059] Example 4
[0060] This embodiment constructs a Valenene synthase mutant.
[0061] Examples 1-3 have demonstrated that valenene synthase CnVS can heterologously synthesize valenene in *Saccharomyces cerevisiae* CEN.PK2-1C, but the valenene yield remains below 50 mg / L. Improving the activity and stability of terpene synthases is beneficial for competing with the precursor FPP, directing carbon flux towards the target terpene compound. Therefore, it is necessary to further improve the performance of valenene synthase, effectively overcome metabolic flux bottlenecks, and further increase valenene yield. In this example, enzyme engineering was used to screen for CnVS mutants with higher production performance. First, we performed a three-dimensional structural simulation of CnVS using a Swiss-model with 3LZ9 as the template. After aligning the two protein sequences, 61 amino acids within a 4A distance from the CnVS active site were selected as the main modification sites (Table 3).
[0062] Table 3 Example 4 CnVS enzyme engineering modification sites
[0063]
[0064] By introducing NDT degenerate primers, the three bases of the mutated amino acid were designed as NDTs, meaning the synthesized primers contained codons for 12 corresponding amino acids. Saturation mutations were performed on these 61 amino acid sites to screen for mutants with higher enzyme activity. Using plasmid pYC3 as a template, NDT primers were designed to amplify donor fragments containing the CnVS mutant. These donor fragments were amplified in two segments. The upstream fragment was amplified using the homologous arm upstream primer P-F13 and the mutation site reverse primers PM-R1~PM-R61, yielding a total of 61 upstream fragments CnVS_u1~CnVS_u61. The downstream fragment was amplified using the mutation site forward primers PM-F1~PM-F66 and the homologous arm downstream primer P-R15, yielding a total of 61 downstream fragments CnVS_d1~CnVS_d61. The required primers and their sequences are shown in Table 4 below.
[0065] Table 4 Primers and their sequences required for CnVS enzyme engineering in Example 4
[0066]
[0067]
[0068]
[0069]
[0070] After recovering the above fragments using a Tiangen gel recovery kit, the corresponding upstream and downstream fragments CnVS_u1, CnVS_d1, the plasmid containing Cas9, and the gRNA-3 plasmid were transformed into competent cells of yeast strain YC2 using the PEG / LiAC method, resulting in a yeast strain library YCm1 containing 12 mutants of CnVS_m1. This process was repeated to obtain yeast strain libraries YCm1~YCm61 containing different mutants. From yeast strain libraries YCm1~YCm61, appropriate single clones were selected and cultured using the well plate culture method used in Example 3. The valenene yield of the mutants was detected by gas chromatography to screen for highly active CnVS mutants. A single clone strain that increased valenene production by 40% compared to the wild-type synthase strain YC3 was selected. Primers P-F13 and P-R15 were used to amplify the CnVS mutant expression cassette. After gel recovery, the sample was sent to Genewiz for sequencing to determine the genotype of the mutation site. Finally, 30 CnVS mutants were screened, among which the highest yield increased by 1.52 times, as shown in Table 5 below.
[0071] Table 5. Effective unit point mutant activity of CnVS enzyme engineering in Example 4
[0072]
[0073] Example 5
[0074] This embodiment constructs a two-site mutant of varenen synthase.
[0075] Building upon Example 4, this invention further constructs a two-site mutant of varenin synthase. First, using the complete expression cassette of the single-point mutant as a template, primers are designed to introduce a second mutation site, thus constructing the two-site mutant. This is used to construct CnVS. G435R,E496D Taking a two-site mutant as an example, with CnVS G435R Using the strain as a template, PCR amplification was performed using primers PD-F / P-E496D-R to obtain the upstream fragment U1, and PCR amplification was performed using primers P-E496D-F / PD-R to obtain the downstream fragment D1. After gel recovery of the above fragments using a Tiangen gel recovery kit, the corresponding upstream and downstream fragments U1 and D1, along with a plasmid containing Cas9 and a gRNA-3 plasmid, were transformed into competent cells of yeast strain YC2 using the PEG / LiAC method to obtain a plasmid containing CnVS. G435R ,E496D mutant yeast strain YC-CnVS G435R,E496D By analogy, yeast strains containing different two-site mutants can eventually be constructed, as shown in Table 6.
[0076] Table 6 Construction of CnVS two-site mutants in Example 5
[0077]
[0078] A suitable number of single clones of the two-site mutant strain were selected and cultured using the well plate culture method used in Example 3. The varenin yield of the mutants was detected by GC to screen for highly active CnVS two-site mutants. The varenin yield was significantly increased compared to strain YC3, reaching up to 3.18 times that of the wild type, as shown in Table 7 below.
[0079] Table 7. Yields of CnVS double-site mutant strains in Example 5
[0080]
[0081] Example 6
[0082] This embodiment constructs a three-point mutant of varenen synthase.
[0083] Building upon Example 5, this invention further constructs a three-point mutant of varenin synthase. First, using the complete expression cassette of the two-site mutant as a template, primers are designed to introduce a third mutation site, thus constructing the three-point mutant. This is used to construct CnVS. G435R,I443C,E496D Taking the three-site mutant as an example, with CnVS G435R,E496D Using the strain as a template, PCR amplification was performed using primers PD-F / P-I443C-G435R-R to obtain the upstream fragment U1, and PCR amplification was performed using primers P-I443C-G435R-F / PD-R to obtain the downstream fragment D1. After gel recovery of the above fragments using a Tiangen gel recovery kit, the corresponding upstream and downstream fragments U5 and D5, along with a plasmid containing Cas9 and a gRNA-3 plasmid, were transformed into competent cells of yeast strain YC2 using the PEG / LiAC method to obtain a plasmid containing CnVS. G435R,I443C,E496D mutant yeast strain YC-CnVS G435R,I443C,E496D Similarly, yeast strains containing different three-point mutants can eventually be constructed, as shown in Table 8.
[0084] Table 8 Construction of CnVS three-point mutants in Example 6
[0085]
[0086] A suitable number of single clones of the three-point mutant strain were selected and cultured using the well plate culture method used in Example 3. The varenin yield of the mutants was detected by GC to screen for highly active CnVS three-point mutants. The varenin yield was significantly increased compared to strain YC3, reaching up to 3.41 times that of the wild type, as shown in Table 9 below.
[0087] Table 9. Yields of CnVS three-point mutant strains in Example 6
[0088]
[0089] In summary, this invention modifies the valenene synthase CnVS from North American Callitropsis nootkatensis by introducing specific mutations, which can significantly improve its activity and provide a novel and effective tool enzyme for the preparation of valenene.
[0090] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.
Claims
1. A valencene synthase mutant, characterized in that, The amino acid sequence of the Valenene synthase mutant is modified by the S471C mutation based on the sequence shown in SEQ ID NO.
3.
2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the varenen synthase mutant of claim 1.
3. A recombinant vector, characterized in that, The recombinant vector contains the nucleic acid molecule as described in claim 2.
4. A recombinant cell, characterized in that, The recombinant cell contains the recombinant vector of claim 3 or the nucleic acid molecule of claim 2 integrated into its genome.
5. The recombinant cell of claim 4, wherein, The starting cells for the recombinant cells include Saccharomyces cerevisiae.
6. The recombinant cell of claim 5, wherein, The brewing yeast includes brewing yeast CEN.PK2-1C.
7. The recombinant cell of any one of claims 4-6, wherein, The recombinant cells also overexpress farnesyl pyrophosphate synthase and 3-hydroxy-3-methylglutaryl-CoA reductase.
8. The use of the walene synthase mutant of claim 1, the nucleic acid molecule of claim 2, the recombinant vector of claim 3, or the recombinant cell of any one of claims 4-7 in the preparation of walene.
9. A process for the preparation of valencene, characterized in that, The method includes: The nucleic acid molecule encoding the valenene synthase mutant of claim 1 is inserted into the expression vector to obtain a recombinant vector. The recombinant vector is introduced into a host cell, or the nucleic acid molecule is directly integrated into the genome of the host cell to obtain a genetically engineered bacterium. The bacterium is then cultured and valenene is isolated and purified to obtain the valenene.
Citation Information
Patent Citations
Engineering algal strain capable of synthesizing valarene and preparation method of engineering algal strain
CN115927427A
Engineering bacterium for producing lactose as well as preparation method and application of engineering bacterium
CN116496963A