Two phytase genes SgPAPhy_a and SgPAPhy_b capable of enhancing plant tolerance to aluminum toxicity stress and application thereof

Abstract

The application discloses two purple acid phytase genes of alfalfa which can enhance the aluminum toxicity stress tolerance of plants SgPAPhy_a and SgPAPhy_b and application thereof, and transgenic plants of the genes SgPAPhy_a and SgPAPhy_b can significantly improve the aluminum toxicity stress tolerance of plants; SgPAPhy_a The genes and SgPAPhy_b have important effects on improving the aluminum toxicity stress tolerance of plants, can be used for improving crops through transgenic technology, and improve the aluminum toxicity stress tolerance of plants, and have important guiding significance for subsequent cultivation of new germplasm of aluminum toxicity stress tolerant crops suitable for planting in acid soil.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to two purple acidic phytase genes from *Styrax styrax* that can enhance plant tolerance to aluminum toxicity stress. SgPAPhy_a and SgPAPhy_b And its applications. Background Technology

[0002] Globally, approximately 50% of potentially arable land is acidic soil (pH < 5.5), primarily concentrated in tropical and subtropical regions. In acidic soils, aluminum mainly exists as Al. 3+ It exists in the form of Al. 3+ It can cause serious damage to plant roots, leading to reduced root elongation. 3+ Within the roots, it inhibits cell division, elongation, and membrane polarization, and reduces photosynthetic efficiency and chlorophyll content in the leaves. Furthermore, Al... 3+ It can also lead to the excessive accumulation of reactive oxygen species, which in turn interferes with cell wall proteins and other metabolic pathways, resulting in insufficient mineral nutrition and decreased crop productivity. Therefore, aluminum stress has become a major challenge facing global agriculture.

[0003] Phytase is a special type of phosphatase, systematically named myo-inositol hexakisphosphate phosphohydrolase. It catalyzes the stepwise hydrolysis of phytic acid (inositol-1,2,3,4,5,6-hexaphosphate) to release inorganic phosphate, producing inositol phosphate esters and free inositol. The main function of phytase in plants is to hydrolyze phytic acid (accounting for approximately 70% of the total phosphorus in seeds) during seed germination, releasing the bound inorganic phosphate for use by seedlings in the early stages of growth. This is crucial for seedlings to establish photosynthetic capacity. In plants, phytase is mainly encoded by two gene families: the histidine acid phosphatase (HAP) gene family and the purple acid phytase (PAPhy) gene family. Several PAPhy encoding genes have been cloned in different plants, such as barley. HvPAPhy_a , HvPAPhy_b1 and HvPAPhy_b2 wheat TaPAPhy_a1 , TaPAPhy_a2 , TaPAPhy_b1 and TaPAPhy_b2 Rice OsPAPhy_ b Corn ZmPAPhy_b However, there are no reports on PAPhy's involvement in plant tolerance to aluminum toxicity stress.

[0004] Stylosanthes (Stylosanthes guianensis Originating in the acidic soils of South America, *Stylosanthes stylosanthes* has developed a strong tolerance to aluminum toxicity stress through long-term evolution. Discovering the aluminum-tolerant genes in *Stylosanthes stylosanthes* can be used to improve the tolerance of other plants to aluminum toxicity stress, which is of great significance for breeding new crop varieties adapted to acidic soil cultivation. Summary of the Invention

[0005] This invention provides two purple acidic phytase genes from *Styrax chinensis* that can enhance plant tolerance to aluminum toxicity stress. SgPAPhy_a and SgPAPhy_b Regarding its applications, this invention cloned two PAPhy encoding genes from Stylosanthes kirilowii and named them... SgPAPhy_a and SgPAPhy_b Furthermore, it was demonstrated that transforming these two genes into other plants (Arabidopsis thaliana) significantly enhanced their resistance to aluminum toxicity.

[0006] To achieve the above objectives, the technical solution of the present invention is as follows: This invention provides two purple acidic phytase genes from *Stylosanthes spp.* that can enhance plant tolerance to aluminum toxicity stress. The two purple acidic phytase genes from *Stylosanthes spp.* are respectively... SgPAPhy_a Genes and SgPAPhy_b Genes, the ones mentioned SgPAPhy_a The nucleotide sequence of the gene is shown in SEQ ID NO: 1. SgPAPhy_b The nucleotide sequence of the gene is shown in SEQ ID NO: 2.

[0007] Furthermore, the aforementioned SgPAPhy_a The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO: 3; The SgPAPhy_b The amino acid sequence of the gene-encoded protein is shown in SEQ ID NO: 4.

[0008] The present invention provides another aspect of the application of the two purple acidic phytase genes of Stylosanthes styracifolium that can enhance the plant's tolerance to aluminum toxicity stress in improving the plant's ability to tolerate aluminum toxicity stress.

[0009] Furthermore, the method for improving the plant's tolerance to aluminum toxicity stress involves: increasing the concentration of aluminum in the plant... SgPAPhy_a Gene or the stated SgPAPhy_b Gene expression levels.

[0010] Furthermore, the improvement in the plant SgPAPhy_a Gene or the stated SgPAPhy_b The method for measuring gene expression levels is as follows: Overexpression is achieved through transgenic technology. SgPAPhy_a Gene or SgPAPhy_b Recombinant plant expression vectors are used to transfer recombinant plant expression vectors into plants via Agrobacterium-mediated transformation.

[0011] Furthermore, the plant in question is Arabidopsis thaliana.

[0012] The beneficial effects of this invention are: This invention discloses two types of Stylosanthes kirilowii that can improve the plant's resistance to aluminum toxicity stress. SgPAPhy_a Gene, SgPAPhy_b Genes, through overexpression SgPAPhy_a Gene, SgPAPhy_b Transgenic plants can significantly improve their tolerance to aluminum toxicity and aluminum stress. SgPAPhy_a Genes and SgPAPhy_b Genes play an important role in improving the ability of plants to tolerate aluminum toxicity stress. They can be used to improve crops through transgenic technology, enhance the tolerance of plants to aluminum toxicity stress, and provide important guidance for the subsequent breeding of new germplasm of aluminum-tolerant crops suitable for planting in acidic soils. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 for SgPAPhy_a , SgPAPhy_b In other species PAPhy Phylogenetic tree analysis diagram; Figure 2 For gPAPhy_a and SgPAPhy_b Figure showing the results of protein purification and biochemical enzymatic property analysis; Figure 3 For heterologous expression SgPAPhy_a and SgPAPhy_b Electrophoresis image of transgenic Arabidopsis thaliana identified by PCR; Figure 4 for SgPAPhy_a and SgPAPhy_b Figure showing the results of the analysis of the aluminum toxicity stress tolerance of transgenic Arabidopsis thaliana; Figure 5 for SgPAPhy_a and SgPAPhy_b A bar chart showing the acid phosphatase activity and ascorbic acid content in transgenic Arabidopsis thaliana. Detailed Implementation

[0015] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0016] The invention uses Stylosanthes pubescens ( Stylosanthes guianensis ) and Arabidopsis thaliana ( Arabidopsis thaliana All materials were obtained from the Grassland Research Center of the Institute of Tropical Crop Germplasm Resources, Chinese Academy of Tropical Agricultural Sciences.

[0017] Example 1: Stylosanthes SgPAPhy_a and SgPAPhy_b Gene cloning and identification 1. Total RNA extraction from Stylosanthes kirilowii Whole seedlings of Stylosanthes were taken and ground into powder using liquid nitrogen as samples. Total RNA was then extracted from the Stylosanthes using a plant total RNA extraction kit (DP432, TIANGEN). The integrity of the RNA was checked by 1% agarose gel electrophoresis, following the instructions in the product manual. cDNA was then synthesized using the HiScript III RT SuperMix for qPCR reverse transcription kit (R323-01, Vazyme), following the instructions in the product manual.

[0018] 2. Amplification of Stylosanthes kirilowii SgPAPhy_a and SgPAPhy_b gene fragments design SgPAPhy_a Gene amplification primers ( SgPAPhy_a -OE-F: GCGAGCTCGGTACCCGGGATGGGTTGTGTTTCTGTGC (SEQ ID NO: 5); SgPAPhy_a -OE-R: CTCTAGAGGATCCCCGGGTTAAATATCGTTACTGGAGCCATATC (SEQ ID NO: 6) and SgPAPhy_b Gene amplification primers ( SgPAPhy_b -OE-F: GCGAGCTCGGTACCCGGGATGGGTTTCTGTTTATGTGCA (SEQ ID NO: 7); SgPAPhy_b -OE-R: CTCTAGAGGATCCCCGGGTCAAGCATCCTTTGGCTTGA (SEQ ID NO: 8)). Using cDNA as a template, the vector adapter carrying pTF101s was amplified by PCR. SgPAPhy_aand SgPAPhy_b Full-length CDS sequence of the gene; The PCR reaction system consisted of: 20 μl of a high-fidelity single enzyme (Phanta Flash Super-Fidelity DNA Polymerase, P521-d1, Vazyme), 1 μl each of forward and reverse primers, 2 μl of cDNA template, and 16 μl of ddH2O. The PCR program was as follows: 95℃ pre-denaturation for 3 minutes; 95℃ denaturation for 15 seconds, 55℃ annealing for 15 seconds, and 72℃ extension for 25 seconds, for a total of 35 cycles; followed by a complete extension at 72℃ for 5 minutes; and storage at 4℃. PCR products were purified using the FastPure Gel DNA Extraction MiniKit (DC301-01, Vazyme), and then sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing using the aforementioned amplification primers. SgPAPhy_a Genes and SgPAPhy_b Gene, SgPAPhy_a The full-length CDS sequence of the gene is shown in SEQ ID NO:1, and its amino acid sequence is shown in SEQ ID NO:3. SgPAPhy_b The full-length CDS sequence of the gene is shown in SEQ ID NO:2, and its amino acid sequence is shown in SEQ ID NO:4.

[0019] 3. Stylosanthes SgPAPhy_a and SgPAPhy_b Phylogenetic analysis of genes Stylosanthes SgPAPhy_a and SgPAPhy_b Gene sequences from other leguminous plants (alfalfa, pigeon pea, soybean, etc.) Arachis duranensis Peanuts and Arachis ipaensis Multiple sequence alignment was performed on the PAPhy gene of peanut and the model plant Arabidopsis thaliana, and a phylogenetic tree was constructed. The results are as follows: Figure 1 As shown, SgPAPhy_a and SgPAPhy_b The gene is highly homologous to the PAPhy gene in other species.

[0020] Example 2: Stylosanthes SgPAPhy_a and SgPAPhy_b Analysis of proteomic properties 1. GST:: SgPAPhy_a Fusion proteins and GST:: SgPAPhy_b Expression and purification of fusion proteins Using Stylosanthes cDNA as a template, primers were designed ( SgPAPhy_a-GST-F:GATCCCCGAATTCCCGGGTTATGGGTTGTGTTTCTGTGC (SEQ ID NO: 9); SgPAPhy_a -GST-R: CGCTCGAGTCGACCCGGGTTAAATATCGTTACTGGAGCCATATC (SEQ ID NO: 10) amplifies the vector adapter carrying PGEX6P3. SgPAPhy_a and SgPAPhy_b Full-length CDS; the PGEX6P3 vector was digested with the restriction endonuclease SmaI; the PGEX6P3 vector was then combined with homologous recombination with... SgPAPhy_a Gene, SgPAPhy_b Gene linking was used to construct a recombinant protein expression vector PGEX6P3- with a GST tag fused to the gene sequence. SgPAPhy_a The recombinant protein expression vector PGEX6P3- with the gene sequence fused with the GST tag SgPAPhy_b ; The constructed PGEX6P3- SgPAPhy_a and PGEX6P3- SgPAPhy_b The vector was transformed into *Escherichia coli* BL21 (EC1001, Weidi Biotechnology) via heat shock. An appropriate amount of bacterial culture was added to 200 ml of LB liquid medium and cultured in a shaker at 37°C until OD (Organic Degree) was reached. 600 The concentration was set to 0.8, then 0.8 mM IPTG was added and the mixture was transferred to a shaker at 28°C for 6 h of further incubation. The bacterial culture was then centrifuged at 6000 rpm for 10 min, the supernatant was removed, and the bacterial cells were collected. The precipitate was resuspended in 20 ml of binding buffer (140 mM NaCl, 2.7 mM KCl, 10 mM Na₂HPO₄, 1.8 mM KH₂PO₄, 5 mM DTT), and the bacterial cells were disrupted using an ultrasonic homogenizer. The supernatant was collected by centrifugation, and the protein was then purified using a GST fusion protein purification kit (70601-K10, BEAVER). The procedure was performed according to the product instructions. The final purified GST was obtained. SgPAPhy_a and GST:: SgPAPhy_b Fusion protein. For purified GST:: SgPAPhy_a and GST:: SgPAPhy_b The fusion protein was analyzed by SDS-PAGE, with the unpurified total protein (collected supernatant) as a reference to determine protein purity.

[0021] The results are as follows Figure 2 As shown in A, 2B ( Figure 2 A: GST:: ​ Image showing the purification results of the fusion protein; ​ B:GST:: ​Figure 1 shows the purification results of the fusion protein; 1: Total soluble protein; 2: Total soluble protein without GDH magnetic beads; 3: Target protein eluted in the first elution; 4: Target protein eluted in the second elution. Compared with the total soluble protein channels, the purified protein channels show clear and single protein bands with molecular weights of approximately 61.2 kDa and 61.3 kDa. This indicates that GST:: ​ a and GST:: ​ The fusion protein was successfully induced to be expressed in Escherichia coli, and the target protein was obtained with good purification results.

[0022] 2. GST:: ​ Fusion proteins and GST:: ​ Enzymatic characterization of fusion proteins Using bovine serum albumin as a standard, the purified GST was determined by the Coomassie brilliant blue method. ​ and GST:: ​ Fusion protein concentration. Fusion protein concentrations were prepared using 50 mM sodium acetate buffer (pH to 5.6, containing 5 mM MgCl2) as the solvent, with each protein containing 2 mM p-nitrophenyl phosphate (…). p NPP) or substrate buffer containing 2 mM phytic acid (InsP6). Then add the following reaction system: 50 μL substrate buffer + 50 μL fusion protein solution (containing 0.5 μg protein), for a total system volume of 100 μL. Control reaction system: 50 μL substrate buffer + 50 μL sodium acetate buffer. Place the added reaction system at 37°C for 15 min, and determine the phosphorus content released by the enzyme reaction using a malachite green phosphate assay kit (S0196S, Beyotime). Calculate the enzyme activity using formula (1).

[0023] (1) The results are as follows ​ As shown in C ( ​ C:GST:: ​ and GST:: ​ by p Enzyme activity using NPP and InsP6 as substrates; p NPP: p-nitrophenyl phosphate; InsP6: phytic acid; data are the mean ± standard error of three biological replicates, different letters indicate significant differences between groups (One-Way ANOVA). P <0.05), GST: ​ and GST: ​ It exhibits hydrolytic activity against all InsP6 substrates and is compatible with... p There was no significant difference in enzyme activity when NPP was used as a substrate. These results indicate that... ​ and​ All of them have phytase activity.

[0024] Example 3: Stylosanthes SgPAPhy_a and SgPAPhy_b Heterologous expression of genes in Arabidopsis 1. Construction of plant overexpression vectors The pTF101s vector was digested with the restriction endonuclease BamHI. The digestion system (50 μl) consisted of: 10 μl (5 μg) of pTF101s vector plasmid, 2.5 μl of BamHI, 5 μl of restriction enzyme buffer, and 30 μl of ddH2O. The mixture was incubated at 37°C for 2 h. The purified PCR product and the digested vector were then combined with the cloned pTF101s vector using the ClonExpress II One Step Cloning Kit (C112-01, Vazyme) to recombinase the pTF101s vector. SgPAPhy_a and SgPAPhy_b Gene fragment ligation was performed, and the ligation product was transformed into *E. coli* DH5α (DL1001, Vazyme) using the heat shock method and sequenced. After confirming that the sequencing was correct, the recombinant plasmid was extracted using the FastPure Plasmid Mini Kit (DC201-01, Vazyme) to obtain the recombinant vector plasmid pTF101s- SgPAPhy_a and pTF101s- SgPAPhy_b ; The two recombinant vector plasmids were transformed into GV3101 Agrobacterium tumefaciens, and the transformed GV3101 Agrobacterium tumefaciens was stored at -80℃ for later use.

[0025] 2. Transformation of transgenic Arabidopsis thaliana The specific steps for transforming transgenic Arabidopsis thaliana are as follows: Take the above-transformed Agrobacterium tumefaciens culture (glycerol, OD) stored at -80℃. 600 = 1.0), applied to a solution containing 50 mg L -1 Kan (kanamycin, Kan) and 50 mg L -1 Sterilomycin (Stre) was placed on LB agar plates, inverted, and incubated at 28°C for 2 days. Once colonies had grown, single colonies were picked and added to 5 mL of a solution containing 50 mg of Streptomycin. -1 Kan and 50 mgL -1 Stre was activated overnight in LB broth at 28°C and 200 rpm. 60 μl of the activated bacterial culture was then added to 10 mL of medium containing 50 mg L. -1 Kan and 50 mg L -1 Stre was cultured in LB liquid medium until OD 600= 1.0, centrifuge at 5000 rpm for 10 min, discard the supernatant, and use the infiltration buffer (50 g L). -1 Sucrose + 2.2 g L -1 MS + 0.5 g L -1 MES + 10 μg L -1 6-BA + 200 μL -1 Resuspend the bacterial cells to OD500 using SilwetL-77 (pH adjusted to 5.7 with KOH). 600 = 0.8-1.0, used for subsequent infection; Arabidopsis thaliana plants that have grown for 4 weeks and have bolted with inflorescences were selected. The inflorescences were immersed in the infection solution for 5 minutes. The entire Arabidopsis plant was then wrapped in plastic wrap and placed in the dark for 24 hours. After removing the plastic wrap, the plants were cultured at 22°C under 16 hours of light and 8 hours of darkness. The infection process was repeated after 1 week of culture, and the culture was continued for about three months. Seeds of the T0 generation transgenic Arabidopsis thaliana were then harvested.

[0026] 3. Screening and identification of transgenic Arabidopsis thaliana After harvesting transgenic Arabidopsis thaliana T0 generation seeds and drying them in a 37℃ incubator for 5 days, they were rinsed 5 times repeatedly with ddH2O in a clean bench, then rinsed 3 times with 75% ethanol solution, disinfected with 3% sodium hypochlorite solution for 1 min, and immediately washed 6 times with ddH2O. The disinfected transgenic Arabidopsis thaliana T0 generation seeds were then evenly spread on MS solid medium (containing 5 mg L / L) -1 The Basta herbicide was placed in a petri dish and vernalized in a 4°C refrigerator for 2 days in the dark. Then, it was transferred to a 22°C incubator with 16 hours of light and 8 hours of darkness for about 12 days. The healthy Arabidopsis seedlings were then transferred to seedling boxes containing vermiculite and nutrient soil in a ratio of 1:1 (v / v) for further cultivation. Leaves from transgenic Arabidopsis thaliana plants grown for approximately 3 weeks were collected, ground with liquid nitrogen, and 0.1 g of the sample was weighed and placed in a 1.5 mL centrifuge tube. 1 mL of CTAB lysis buffer (containing 2% β-mercaptoethanol) was added, and the mixture was heated at 65°C for 2 h (15 min / time, mixing thoroughly). Then, 500 µL of chloroform was added, the mixture was shaken at room temperature for 1 min, allowed to stand for 5 min, and then centrifuged at 12000 rpm for 10 min. The upper aqueous phase was transferred to a new 1.5 mL centrifuge tube, and the same volume of isopropanol was added and mixed thoroughly. The tube was placed at -80°C for 10 min, centrifuged at 12000 rpm for 10 min, and the supernatant was removed, retaining only the precipitate. 1 mL of 75% ethanol was added, the mixture was mixed, and the tube was centrifuged at 10000 rpm for 5 min. The precipitate was retained, briefly centrifuged, and the remaining liquid was removed. 30 µL of RNase-free ddH2O was added, and the mixture was pipetted to obtain the DNA sample. design SgPAPhy_a Detection primers ( SgPAPhy_a -F:ATGGGTGTGTTTCTGTGC (SEQ ID NO: 11); SgPAPhy_a -R:TTAAATATCGTTACTGGAGCCATATC (SEQ ID NO: 12)), SgPAPhy_b Detection primers ( SgPAPhy_b -F:ATGGGTTCTGTTTATGTGCA (SEQ ID NO: 13); SgPAPhy_b -R: TCAAGCATCCTTTGGCTTGA (SEQ ID NO: 14) and AtEF-1α internal reference gene detection primers (AtEF-1α-F: GTCGATTTGGAAAGTCGACC (SEQ ID NO: 15); AtEF-1α-R: AATTGTCAATGGTGATACCACGC (SEQ ID NO: 16)), using extracted transgenic Arabidopsis leaf DNA as a template, the target gene was detected by PCR. The PCR reaction system was the same as in Example 1. Positive seedlings of transgenic Arabidopsis thaliana were selected based on PCR results and cultured until seed harvesting was possible. Individual plants were then harvested to obtain T1 generation seeds. The same identification process was then performed on the T1 generation seeds, and individual plants were harvested to obtain T2 generation seeds. Subsequently, the T2 generation seeds were sown in a solution containing 5 mg / L... -1 Transgenic lines with a resistance ratio of 3:1 were selected and planted on MS solid medium containing Basta herbicide to harvest T3 generation seeds.

[0027] PCR identification results as follows Figure 3 As shown, Figure 3 A, Figure 3 B are respectively SgPAPhy_a and SgPAPhy_b Electrophoresis results of PCR products from transgenic Arabidopsis thaliana (WT: wild-type Arabidopsis thaliana; OE1, OE2: two independent strains). SgPAPhy_a / SgPAPhy_b Overexpression transgenic lines; AtEF-1α (Arabidopsis thaliana internal reference gene), heterologous overexpression compared to WT. SgPAPhy_a Genes and SgPAPhy_b Specific bands were amplified in the transgenic Arabidopsis thaliana lines OE1 and OE2, indicating that these lines each carry the gene. SgPAPhy_a Genes and SgPAPhy_b Gene fragments. Arabidopsis housekeeping genes were amplified in both WT and heterologous overexpression lines. AtEF-1α The specific fragments indicate that the sample is reliable.

[0028] Example 4: Heterologous ExpressionSgPAPhy_a and SgPAPhy_b Effects of genes on the aluminum toxicity tolerance of transgenic Arabidopsis thaliana 1. Heterologous expression SgPAPhy_a and SgPAPhy_b Analysis of aluminum toxicity tolerance in transgenic Arabidopsis thaliana Wild-type Arabidopsis thaliana and transgenic Arabidopsis thaliana seeds were vernalized at 4℃, and then cultured separately on 1 / 6 strength MS medium containing 250 μM AlCl3 (culture temperature 22 ± 1℃, 16 h light / 8 h dark). The specific culture medium formulation was: macroelements: 316.67 mg L / L. -1 KNO3, 550 mg / L -1 NH4NO3, 123.33 mg / L -1 MgSO4·7H2O, 73.33 mg / L -1 CaCl2·2H2O; Trace elements: 0.14 mg / L -1 KI, 1.03 mg / L -1 H3BO3, 3.72 mg / L - 1 MnSO4·4H2O, 1.43 mg / L -1 ZnSO4·7H2O, 0.04 mg / L -1 Na₂MoO₄·2H₂O, 0.004 mg / L -1 CuSO4·5H2O, 0.004 mg / L -1 CoCl2; Iron salt: 6.22 mg / L -1 Fe-EDTA; Inorganic phosphorus source: 28.33 mg / L -1 KH2PO4; Vitamin: 1.67 mg / L -1 VB1, 0.17 mg / L -1 VB5, 0.17 mg / L -1 VB6, containing 1% (w / v) sucrose, was used to adjust the pH to 4.3 and solidified using 1% (w / v) agar. Heterologous expression was obtained after 10 days of culture. SgPAPhy_a and SgPAPhy_b Transgenic Arabidopsis thaliana was photographed phenotypically, its fresh weight was measured, and its taproot length was measured.

[0029] The results are as follows Figure 4 As shown ( Figure 4 A: Heterologous expression SgPAPhy_a and SgPAPhy_b Phenotypic diagram of transgenic Arabidopsis thaliana on aluminum toxicity-treated culture medium; Figure 4 B: Statistical chart of taproot length of various transgenic Arabidopsis thaliana lines subjected to aluminum toxicity stress; Figure 4C: Fresh weight statistics of transgenic Arabidopsis thaliana strains subjected to aluminum toxicity stress; WT: Wild-type Arabidopsis thaliana; SgPAPhy_a -OE1 / OE2: Heterologous expression SgPAPhy_a Two independent transgenic Arabidopsis thaliana lines; SgPAPhy_b -OE1 / OE2: Heterologous expression SgPAPhy_b Two independent transgenic Arabidopsis lines; different letters in the figure represent WT and SgPAPhy_a -OE1 / OE2, SgPAPhy_b The difference between OE1 and OE2 was significant (One-Way ANOVA). P <0.05), under aluminum toxicity stress treatment, the average fresh weight of WT was 1.35 mg. SgPAPhy_a -OE1 had an average fresh weight of 2.70 mg, which was 99.75% higher than WT; SgPAPhy_ a The average fresh weight of -OE2 was 2.77 mg, which was 104.43% higher than that of WT. SgPAPhy_b -OE1 had an average fresh weight of 2.81 mg, which was 107.39% higher than WT; SgPAPhy_b The average fresh weight of -OE2 was 2.84 mg, an increase of 110.10% compared to WT. The average taproot length of WT was 1.97 cm. SgPAPhy_a The average taproot length of -OE1 was 3.36 cm, which was 70.52% longer than that of WT. SgPAPhy_a The average taproot length of -OE2 was 3.50 cm, which was 77.87% longer than that of WT. SgPAPhy_b The average taproot length of -OE1 was 3.34 cm, which was 69.61% higher than that of WT; SgPAPhy_b The average primary root length of -OE2 was 3.42 cm, which was 73.42% higher than that of WT. These results indicate that heterologous expression... SgPAPhy_a and SgPAPhy_b It can enhance the tolerance of transgenic Arabidopsis to aluminum toxicity stress.

[0030] 2. Heterologous expression SgPAPhy_a and SgPAPhy_b Effects of genes on acid phosphatase activity and ascorbic acid content in transgenic Arabidopsis thaliana SgPAPhy_a and SgPAPhy_b This gene encodes phytase, an acid phosphatase. Highly active acid phosphatases in plants enhance their ability to utilize organic phosphorus in the soil, improving their phosphorus nutrition status. Increased ascorbic acid content strengthens the plant's resistance to stresses such as aluminum toxicity and heavy metals, reducing the damage to cell structure and physiological metabolism caused by adverse conditions. Therefore, the acid phosphatase activity and ascorbic acid content of transgenic Arabidopsis thaliana were measured.

[0031] Weigh out 0.1 g of the above Arabidopsis thaliana samples (heterologous expression). SgPAPhy_a Transgenic Arabidopsis and SgPAPhy_b The transgenic Arabidopsis thaliana was placed in a mortar and ground thoroughly with 1.2 mL of pre-cooled 50 mM sodium acetate buffer (pH adjusted to 5.6 with glacial acetic acid). The sample mixture was then poured into a 1.5 mL centrifuge tube and centrifuged at 14,000 rpm for 20 min at 4°C. The supernatant was collected in a new 1.5 mL centrifuge tube.

[0032] Using bovine serum albumin as a standard, the content of soluble protein in the supernatant was determined by the Coomassie brilliant blue method. 2 mM solutions were prepared using 50 mM sodium acetate buffer (pH=5.6) as the solvent. p NPP substrate buffer. Pipette 0.2 mL of the plant sample supernatant into a centrifuge tube, add 0.6 mL of NPP substrate buffer. p Mix the NPP substrate buffer thoroughly and use it as the experimental group. Pipette 0.8 mL... p NPP substrate was added to centrifuge tubes as a blank control. 0 mM, 0.05 mM, 0.10 mM, 0.15 mM, 0.20 mM, and 0.25 mM solutions of p-nitrophenol were prepared using ddH2O. p NP) solution, take 0.2 mL of each of different concentrations. p Pour the NP solution into a centrifuge tube and add 0.6 mL of [unspecified ingredient]. p The NPP substrate was thoroughly mixed and used as the standard curve group.

[0033] The experimental group, blank group, and standard curve group were placed at 37°C and reacted for 15 min. After the reaction, 0.8 mL of 0.5 M sodium hydroxide solution was added to terminate the enzyme activity reaction. 200 µL of the terminated reaction solution was added to each microplate, and the OD value at 405 nm was measured using an Infinite M200 Pro multi-sensor microplate reader (TECAN, Switzerland). A standard curve was plotted with the OD value of the standard curve group as the x-axis and the concentration of p-nitrophenol as the y-axis. Then, the enzyme activity was calculated based on the standard curve. p NPP is released after hydrolysis p The NP content was used to calculate the acid phosphatase activity according to formula (2). The enzyme activity unit is U mg. - 1 Protein, where 1 U is defined as the release of 1 μmol per minute. p NP.

[0034] (2) Take the above Arabidopsis thaliana samples and determine the ascorbic acid content using an ascorbic acid content kit (A009-1-1, Nanjing Jiancheng). Refer to the product instructions for the operation steps.

[0035] The results are as follows Figure 5 As shown ( Figure 5 A: Acid phosphatase activity; Figure 5 B: Ascorbic acid content; WT: Wild-type Arabidopsis thaliana; OE1, OE2: Heterologous expression SgPAPhy_a and SgPAPhy_b Transgenic Arabidopsis thaliana lines; FW: fresh weight; different letters in the figure represent significant differences between WT and OE1, OE2 (One-Way ANOVA). P <0.05), the average acid phosphatase activity of WT was 0.66 U mg. -1 , SgPAPhy_a The average acid phosphatase activity of -OE1 is 1.80 U mg. -1 It is 1.73 times higher than WT; SgPAPhy_a The average acid phosphatase activity of -OE2 was 1.96 U mg. -1 It is 1.98 times higher than WT; SgPAPhy_b The average acid phosphatase activity of -OE1 was 2.98 U mg. -1 It is 3.53 times higher than WT; SgPAPhy_b The average acid phosphatase activity of -OE2 was 3.24 U mg. -1 This represents a 3.92-fold increase compared to WT. The average ascorbic acid content of WT is 99.39 μg / g. -1 , SgPAPhy_a The average ascorbic acid content of -OE1 is 164.22 μg g. -1 This represents a 65.22% improvement compared to WT. SgPAPhy_ a The average ascorbic acid content of -OE2 was 178.63 μg g. -1 This represents a 79.72% improvement compared to WT. SgPAPhy_b The average ascorbic acid content of -OE1 is 245.70 μg g. -1 This represents a 147.20% improvement compared to WT. SgPAPhy_b The average ascorbic acid content of -OE2 was 263.34 μg g. -1 This represents a 164.95% improvement compared to WT. These results indicate that heterologous expression... SgPAPhy_a and SgPAPhy_ b It can increase the acid phosphatase activity and ascorbic acid content in transgenic Arabidopsis thaliana, thereby enhancing the plant's tolerance to low phosphorus stress and its ability to resist oxidative damage.

[0036] In conclusion, SgPAPhy_a Genes and SgPAPhy_b These genes are important functional genes that regulate the traits of aluminum toxicity stress in plants, providing key gene resources for improving aluminum tolerance in crops. In agricultural production, these two genes can be integrated into the genomes of staple or cash crops such as maize, soybeans, and rice using mature transgenic technology to directionally improve the crops' tolerance to aluminum toxicity stress. Especially in the large areas of acidic soil in southern my country, the application of these two genes can effectively overcome the limitations of aluminum toxicity on crop growth. This has important guiding significance and practical value for the subsequent breeding of new crop germplasm suitable for planting in acidic soils and possessing stable aluminum toxicity stress tolerance, and for promoting the efficient utilization of acidic soil resources.

[0037] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A gene of a purple acid phosphatase of Stylidium sp. capable of enhancing plant tolerance to aluminum toxicity stress, characterized in that, The purple acid phosphatase gene capable of enhancing plant tolerance to aluminum toxicity stress is SgPAPhy_a gene or SgPAPhy_b gene, the SgPAPhy_a nucleotide sequence of the gene is shown as SEQ ID NO: 1, the SgPAPhy_b nucleotide sequence of the gene is shown as SEQ ID NO:

2.

2. The gene of the purple acid phosphatase of the genus Lupinus capable of enhancing the tolerance of plants to aluminum toxicity stress according to claim 1, characterized by, The SgPAPhy_a The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO: 3; The SgPAPhy_b The amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO:

4.

3. The use of the gene of the purple acid phosphatase of the genus Lotus of claim 1, capable of enhancing the tolerance of plants to aluminum toxicity stress, for increasing the tolerance of plants to aluminum toxicity stress, characterized by, Overexpression of the gene in Arabidopsis thaliana SgPAPhy_a The gene or SgPAPhy_ b The gene is capable of enhancing the ability of plants to tolerate aluminum toxicity stress.

4. Use according to claim 3, characterized in that, Overexpression in Arabidopsis SgPAPhy_a Gene or SgPAPhy_b The gene-based approach involves constructing overexpression structures using transgenic technology. SgPAPhy_a Gene or SgPAPhy_b Genes were prepared into recombinant plant expression vectors, which were then transferred into plants using Agrobacterium-mediated transformation.

Images