Use of a dual aav system based on high performance a3f-be4max in the treatment of pancreatic cancer

By targeting the KRAS and MYC genes with the high-performance A3F-BE4max dual AAV system, the problem of drug resistance in pancreatic cancer has been solved, achieving efficient gene editing and tumor suppression, and prolonging patient survival.

CN121294546BActive Publication Date: 2026-05-29TIANJIN TUMOR HOSPITAL
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511870561.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-12-12
Publication Date
2026-05-29
Estimated Expiration
2045-12-12

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The application discloses application of a double-AAV system based on high-performance A3F-BE4max in treatment of pancreatic cancer, and relates to the technical field of biotechnology, and provides a double-AAV carrier system for treating pancreatic cancer, which is used for delivering a base editing system targeting KRAS genes and MYC genes, and the base editing system comprises a base editor (SEQ ID NO:3), gRNA1 (targeting KRAS, and the target sequence is SEQ ID NO:5) and gRNA2 (targeting MYC, and the target sequence is SEQ ID NO:6). The application successfully realizes KRAS and MYC silencing in an in-vitro PDAC cell line and an organoid model, and effectively realizes gene editing in an in-vivo PDO orthotopic transplantation model through AAV system delivery, and the tumor inhibition effect is obvious, and the survival period of mice is prolonged.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, specifically to the application of a high-performance A3F-BE4max dual AAV system in the treatment of pancreatic cancer. Background Technology

[0002] In the clinical treatment of pancreatic ductal adenocarcinoma (PDAC), KRAS G12D Breakthroughs in targeted therapy once brought hope to patients; however, the emergence of drug resistance has become an insurmountable obstacle, severely limiting the sustained effectiveness of treatments [Singhal, A., Styers, HC, Rub, J., Li, Z., Torborg, SR, Kim, JY, Grbovic-Huezo, O., Feng, H., Tarcan, ZC, Sahin Ozkan, H., et al. (2024). A Classical Epithylial State Drives Acute Resistance to KRAS Inhibition in Pancreatic Cancer. Cancer Discov 14 , 2122-2134. 10.1158 / 2159-8290.Cd-24-0740. Dilly, J., Hoffman, MT, Abbassi, L., Li, Z., Paradiso, F., Parent, BD, hynnessey, CJ, Jordan, AC, Morgado, M., Dasgupta, S., et al. (2024).Mechanisms of Resistance to Oncogenic KRAS Inhibition in Pancreatic Cancer.Cancer Discov 14 [2135-2161.]. This drug resistance is not the result of a single factor, but rather an adaptive response evolved by tumor cells through multiple complex mechanisms under long-term drug stress. Some patients receiving KRAS... G12D In the early stages of inhibitor therapy, tumor lesions will shrink significantly and the levels of various tumor markers will also decrease significantly. However, after several months or even less, the tumor may progress rapidly again. At this time, the drugs often fail to exert their inhibitory effect, which brings great trouble to clinical treatment.

[0003] MYC, as an oncogenic factor often co-activated with KRAS mutations, leads to drug resistance through multiple mechanisms, including promoting tumor cell survival and genomic instability [Ala, M. (2022). Target c-Myc to treat pancreatic cancer. Cancer Biol Thyr 23, 34-50. 10.1080 / 15384047.2021.2017223.]. Targeting MYC can restore the sensitivity of tumor cells to KRAS inhibitors by modulating the MAPK / ERK signaling pathway or disrupting the PLK1 / MYC axis [Vaseva, AV, Blake, DR, Gilbert, TSK, Ng, S., Hostetter, G., Azam, SH, Ozkan-Dagliyan, I., Gautam, P., Bryant, KL, Pearce, KH, et al. (2018). KRAS Suppression-Induced Degradation of MYC Is Antagonized by a MEK5-ERK5 Compensatory Mechanism. Cancer Cell 34, 807-822.e807. Wang, Y., Yao, M., Li, C., Yang, K., Qin, X., Xu, L., Shi, S., Yu, C., Meng, X., and Xie, C. (2023). Targeting ST8SIA6-AS1 counteracts KRAS(G12C) inhibitor resistance through abolishing thy reciprocal activation of PLK1 / c-Myc signaling. Exphymatol Oncol 12, 105.].

[0004] The significant inhibitory effects of targeting KRAS or MYC alone on PDAC progression [Singhal, A., Li, BT, and O'Reilly, EM (2024). Targeting KRAS in cancer. Nat Med 30, 969-983. Ala, M. (2022). Target c-Myc to treat pancreatic cancer. Cancer BiolThyr 23, 34-50.] provide strong experimental evidence for a synergistic therapeutic strategy that simultaneously targets these two oncogenic drivers. Theoretically, simultaneous inhibition of KRAS... G12D MYC can block tumor cell survival and proliferation signals at multiple stages, preventing drug resistance caused by compensatory activation of tumor cells through other pathways due to single-target inhibition. For example, when KRAS... G12D When tumor cells are suppressed, they may survive by overactivating MYC. Simultaneously inhibiting MYC can effectively block this compensatory mechanism, thereby enhancing the therapeutic effect. This synergistic effect may not only improve the tumor suppression rate but also prolong patients' progression-free survival and overall survival.

[0005] However, there are currently no approved direct-targeting therapies for MYC or KRAS in clinical practice. G12D The current state of affairs regarding treatment methods underscores the urgent need for innovative therapeutic strategies. MYC, as a difficult-to-drug target, lacks the typical small-molecule binding pocket in its protein structure, posing a significant challenge to drug development. KRAS... G12D Although some targeted drugs have entered clinical trials, many problems remain regarding efficacy stability and drug resistance control. Therefore, researchers are actively exploring new treatment approaches, such as developing bispecific antibodies that simultaneously target KRAS. G12D And MYC, or use gene editing technology to specifically knock out KRAS G12D Including the MYC gene, and enhancing the effectiveness of targeted therapy through combination immunotherapy, these innovative strategies hold promise for new breakthroughs in the treatment of PDAC and improved patient prognosis. Summary of the Invention

[0006] The purpose of this invention is to provide the application of a high-performance dual AAV system based on A3F-BE4max in the treatment of pancreatic cancer.

[0007] In a first aspect, the present invention claims a dual AAV vector system for the treatment of pancreatic cancer.

[0008] The present invention claims a dual AAV vector system for treating pancreatic cancer, which is used to deliver a base editing system targeting the KRAS and MYC genes.

[0009] The base editing system may include: base editors hyA3F-BE4max, gRNA1, and gRNA2.

[0010] The base editor hyA3F-BE4max comprises a cytosine deaminase variant and an nCas9 protein. The amino acid sequence of the cytosine deaminase variant is obtained by replacing amino acid W with D, amino acid S with T, and amino acid H with D at position 127 of SEQ ID NO:1 (the C-terminal domain of wild-type APOBEC3F protein). gRNA1 targets the KRAS gene, and its target sequence is SEQ ID NO:5. gRNA2 targets the MYC gene, and its target sequence is SEQ ID NO:6.

[0011] Furthermore, the nCas9 protein may be the Cas9 (D10A) protein.

[0012] As needed, the base editor may also contain all or part of the following: nuclear localization signal, linker peptide, and uracil glycosylation inhibitor UGI.

[0013] Furthermore, the base editor may be a fusion protein formed from the N-terminus to the C-terminus by sequentially fusing the nuclear localization signal NLS (denoted as nuclear localization signal 1), the cytosine deaminase variant described in the first aspect above, the linker peptide (denoted as linker peptide 1), the Cas9 (D10A) protein, the linker peptide (denoted as linker peptide 2), the uracil glycosylase inhibitor UGI, the linker peptide (denoted as linker peptide 3), the uracil glycosylase inhibitor UGI, and the nuclear localization signal NLS (denoted as nuclear localization signal 2).

[0014] Wherein, the amino acid sequence of the nuclear localization signal 1 may be as shown in positions 1-19 of SEQ ID NO:3; the amino acid sequence of the linker peptide 1 may be as shown in positions 209-240 of SEQ ID NO:3; the amino acid sequence of the Cas9 (D10A) protein may be as shown in positions 241-1607 of SEQ ID NO:3; the amino acid sequence of the linker peptide 2 may be as shown in positions 1608-1617 of SEQ ID NO:3; the amino acid sequence of the uracil glycosylase inhibitor UGI may be as shown in positions 1618-1700 or 1711-1793 of SEQ ID NO:3; the amino acid sequence of the linker peptide 3 may be as shown in positions 1701-1710 of SEQ ID NO:3; and the amino acid sequence of the nuclear localization signal 2 may be as shown in positions 1794-1810 of SEQ ID NO:3.

[0015] In some embodiments of the present invention, the amino acid sequence of the base editor hyA3F-BE4max is SEQ ID NO:3.

[0016] The dual AAV carrier system includes a first AAV carrier and a second AAV carrier;

[0017] The first AAV vector contains a first nucleotide sequence; the first nucleotide sequence, from the 5' end to the 3' end, sequentially includes a 5' ITR, a CBH promoter, the coding sequence of the N-terminal portion of the base editor hyA3F-BE4max described in the first aspect above, the coding sequence of the N-terminal portion of the peptide Intein, a gene expression enhancement element WPRE, the inverse complementary sequence of the coding sequence of gRNA1 described in the first aspect above, expressed by the U6 promoter, and a 3' ITR. In some embodiments of the present invention, the first nucleotide sequence, from the 5' end to the 3' end, consists of a 5' ITR, a liner, a CBH promoter, a liner, the coding sequence of the N-terminal portion of the base editor hyA3F-BE4max described in the first aspect above, the coding sequence of the N-terminal portion of the peptide Intein, a nuclear localization signal coding sequence, a gene expression enhancement element WPRE, a liner, a bGH sequence, the inverse complementary sequence of the coding sequence of gRNA1 described in the first aspect above, expressed by the U6 promoter, a liner, and a 3' ITR.

[0018] The second AAV vector contains a second nucleotide sequence; the second nucleotide sequence, from the 5' end to the 3' end, sequentially includes a 5' ITR, a CBH promoter, a coding sequence for the C-terminal portion of the Intein peptide, a coding sequence for the C-terminal portion of the base editor hyA3F-BE4max described in the first aspect above, a gene expression enhancement element WPRE, an inverse complementary sequence of the coding sequence for gRNA2 described in the first aspect above, expressed by the U6 promoter, and a 3' ITR. In some embodiments of the present invention, the second nucleotide sequence, from the 5' end to the 3' end, consists of a 5' ITR, a linker, a CBH promoter, a linker, a nuclear localization signal coding sequence, a coding sequence for the C-terminal portion of the Intein peptide, a coding sequence for the C-terminal portion of the base editor hyA3F-BE4max described in the first aspect above, a gene expression enhancement element WPRE, a linker, a bGH sequence, an inverse complementary sequence of the coding sequence for gRNA2 described in the first aspect above, expressed by the U6 promoter, a linker, and a 3' ITR.

[0019] Furthermore, the amino acid sequence of the N-terminal portion of the base editor hyA3F-BE4max is positions 1-812 of SEQ ID NO:3; the amino acid sequence of the C-terminal portion of the base editor hyA3F-BE4max is positions 813-1810 of SEQ ID NO:3.

[0020] Furthermore, the amino acid sequence of the N-terminal portion of the inteptin is positions 1-116 of SEQ ID NO:9; the amino acid sequence of the C-terminal portion of the inteptin is positions 117-151 of SEQ ID NO:9.

[0021] In the first nucleotide sequence, the 5' ITR sequence may be positions 1-131 of SEQ ID NO:7; and / or, the nucleotide sequence of the CBH promoter may be positions 147-401 of SEQ ID NO:7; and / or, the coding sequence of the N-terminal portion of the base editor hyA3F-BE4max may be positions 419-2854 of SEQ ID NO:7; and / or, the coding sequence of the N-terminal portion of the inteptide Intein may be positions 2855-3202 of SEQ ID NO:7; and / or, the nucleotide sequence of the gene expression enhancement element WPRE may be positions 3257-3417 of SEQ ID NO:7; and / or, the reverse complementary sequence of the coding sequence of the gRNA1 expressed by the U6 promoter may be positions 3734-4091 of SEQ ID NO:7; and / or, the 3' ITR sequence may be positions 4100-4229 of SEQ ID NO:7.

[0022] In the second nucleotide sequence, the 5' ITR sequence may be positions 1-131 of SEQ ID NO:8; and / or, the CBH promoter nucleotide sequence may be positions 147-401 of SEQ ID NO:8; and / or, the coding sequence of the C-terminal portion of the inteptide Intein may be positions 476-580 of SEQ ID NO:8; and / or, the coding sequence of the C-terminal portion of the base editor hyA3F-BE4max may be positions 581-3574 of SEQ ID NO:8; and / or, the nucleotide sequence of the gene expression enhancement element WPRE may be positions 3578-3738 of SEQ ID NO:8; and / or, the reverse complementary sequence of the coding sequence of the gRNA2 expressed by the U6 promoter may be positions 4055-4412 of SEQ ID NO:8; and / or, the 3' ITR sequence may be positions 4421-4550 of SEQ ID NO:8.

[0023] In some embodiments of the present invention, the first nucleotide sequence is as shown in SEQ ID NO:7.

[0024] In some embodiments of the present invention, the second nucleotide sequence is as shown in SEQ ID NO:8.

[0025] In some embodiments of the present invention, both the first AAV vector and the second AAV vector are AAV8 serotype. Further, the AAV8 capsid is mutated by Y733F (to optimize pancreatic targeting).

[0026] Secondly, the present invention claims protection for a base editing system for targeting the KRAS and MYC genes, which is the base editing system described in the first aspect above.

[0027] Thirdly, the present invention claims protection for any of the following biological materials:

[0028] (A1) Nucleic acid molecules that encode the base editing system described in the second aspect above;

[0029] (A2) An expression cassette or recombinant vector or recombinant microorganism or recombinant cell containing the nucleic acid molecule described in (A1).

[0030] Fourthly, the present invention claims the use of the base editing system described in the second aspect above, the dual AAV carrier system described in the first aspect above, or the biomaterial described in the third aspect above in the preparation of a medicament for treating pancreatic cancer.

[0031] Fifthly, the present invention claims the use of the base editing system described in the second aspect above, the dual AAV carrier system described in the first aspect above, or the biomaterial described in the third aspect above in the preparation of products for inhibiting the growth and / or proliferation of pancreatic cancer cells.

[0032] Sixthly, the present invention claims protection for a drug for treating pancreatic cancer.

[0033] The medicament for treating pancreatic cancer claimed in this invention may contain the base editing system described in the second aspect above, the dual AAV carrier system described in the first aspect above, or the biomaterial and pharmaceutically acceptable carrier described in the third aspect above.

[0034] Among them, pharmaceutically acceptable carriers refer to excipients or excipients that are compatible with the active ingredients in the drug (such as base editing systems, dual AAV carrier systems or related biomaterials), are non-toxic and non-irritating to patients, and can assist the active ingredients in exerting their effects. Their core functions are to stabilize the active ingredients, promote drug delivery, regulate the drug release rate, improve the suitability of the route of administration, or reduce the potential side effects of the active ingredients. Considering the characteristics of pancreatic cancer treatment drugs (such as the potential involvement of gene delivery systems, the protection of gene editing tools, targeting and in vivo stability of the carrier need to be considered), pharmaceutically acceptable carriers may include the following categories: (1) Buffers, used to maintain the pH stability of the drug preparation, to prevent the active ingredients (especially nucleic acid substances, such as the DNA sequence in AAV carriers) from being degraded or structurally altered due to pH fluctuations. Such as phosphate buffer (PBS), citrate buffer, acetate buffer, etc. (2) Osmotic pressure regulators, to regulate the osmotic pressure of the drug preparation, so that it is close to the osmotic pressure of human body fluids (such as blood, tumor microenvironment tissue fluid), to avoid cell edema, rupture or dehydration due to osmotic pressure differences, and to reduce the local inflammatory response after administration. Examples include sodium chloride, mannitol, glucose, and sorbitol. (3) Stabilizers prevent active ingredients (such as AAV virus particles, base editing-related proteins, or nucleic acids) from denaturing, agglomerating, or degrading during storage, transportation, or in vivo delivery, thus prolonging the shelf life of the drug and maintaining its biological activity. Examples include protein stabilizers (sucrose, trehalose, bovine serum albumin, etc.) and nucleic acid stabilizers (EDTA, polyethylene glycol, etc.). (4) Excipients serve as the basic carriers for drug formulations, used to increase the volume of the drug (especially when the content of the active ingredient is extremely low), facilitating formulation forming (such as lyophilized formulations) or drug administration (such as flowability adjustment of injections). Examples include lactose, microcrystalline cellulose, starch, and calcium phosphate. (5) Surfactants reduce the surface tension of drug formulations, prevent the aggregation of active ingredients (especially proteins or virus particles), and improve their dispersibility in solution. Examples include polysorbate 80 (Tween 80), polyoxyethylene castor oil (Cremophor EL), and poloxamer 188. (6) Preservatives, used in multi-dose formulations to prevent microbial contamination and extend the shelf life of the drug (mainly applicable to formulations prepared in vitro or used multiple times). Examples include benzyl alcohol, parabens, and chlorobutanol.

[0035] In some embodiments of the present invention, the pancreatic cancer described above is pancreatic ductal adenocarcinoma.

[0036] In the aforementioned relevant aspects, the pancreatic cancer cells are KRAS-carrying cells. G12D Mutated pancreatic cancer cells. In some embodiments of the present invention, the pancreatic cancer cells are PANC-1 cells or SW1990 cells.

[0037] In the treatment of PDAC, this invention utilizes a dual AAV delivery system to mediate KRAS / MYC co-targeting, achieving synergistic tumor suppression in patient organoids (PDOs) and mouse orthotopic models: in vitro editing efficiencies reached 76% (KRAS) and 40% (MYC), with protein expression reduced by >80%; in vivo, editing efficiencies of only 22% (KRAS) and 10% (MYC) drove 78% tumor regression and extended the median survival of mice from 19 days to 23 days (P<0.001), providing a highly efficient and precise new strategy for targeting "undruggable" oncogenes.

[0038] In summary, this invention successfully achieved KRAS and MYC silencing in in vitro PDAC cell lines and organoid models, and obtained effective gene editing via AAV delivery in an in vivo PDO orthotopic transplantation model, demonstrating significant tumor suppression and prolonging mouse survival. These results lay the foundation for the feasibility of PDAC genetic therapy based on base editing. Attached Figure Description

[0039] Figure 1 This study aimed to screen potential hyA3F-gRNA combinations for efficient silencing of the KRAS and MYC genes in PDAC cells. Figure a shows a schematic diagram of CBE-mediated gene knockout sgRNA design, designed to introduce premature stop codons and disrupt key splicing sites in the KRAS and MYC genes. Figure b shows the efficiency of CT editing mediated by hyA3F, A3A, and CBE6b at KRAS and MYC loci in HEK293T cells, analyzed using Sanger sequencing.

[0040] Figure 2 The protein and proliferation capacity of hyA3F-BE4max in PANC-1 and SW1990 cells were analyzed. Specifically, a) shows the protein levels of KRAS and MYC in HEK293T cells after using different sgRNAs, as determined by Western blotting; b) shows the protein levels of KRAS and MYC in PANC-1 and SW1990 cells after using different sgRNAs, as determined by Western blotting; and c) shows the viability of PANC-1 and SW1990 cells after KRAS and / or MYC knockout treatment, analyzed by CCK-8 assay. Data are presented as mean ± standard deviation of n = 6 independent biological replicates.

[0041] Figure 3This study aimed to enhance PDAC gene therapy by using AAV-mediated hyA3F-BE4max and dual gRNA targeting MYC and KRAS. In the figures, a) shows the CT editing efficiency of hyA3F-BE4max at the KRAS and MYC loci in PDOs, analyzed by deep sequencing. b) shows the protein levels of KRAS and MYC after using different sgRNAs, detected by Western blotting. c) shows the activity of four PDO groups, quantitatively analyzed by ATP-dependent luciferase assay. Data are presented as mean ± standard deviation of n = 6 independent biological replicates.

[0042] Figure 4 The results of dual AAV treatment in mice are shown in Figure a. a schematic diagram of a dual AAV vector expressing split A3F-nCas9 and two sgRNAs targeting KRAS or MYC respectively. b. Analysis of AAV-mediated CT editing efficiency of hyA3F-BE4max at KRAS and MYC loci in tumor tissues using deep sequencing. c. PDAC tumor tissue weights in the four treatment groups. Data are presented as mean ± standard deviation of n=6 independent biological replicates. Statistical significance was assessed using a two-tailed Student's t-test. d. Evaluation of the efficacy of AAV treatment using Kaplan-Meier survival curves and log-rank test (n=8). Detailed Implementation

[0043] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0044] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0045] The amino acid sequences and corresponding coding nucleotide sequences of the various cytosine deaminases involved in the following examples are as follows:

[0046] The amino acid sequence of the C-terminal domain (CTD) of wild-type A3F is shown in SEQ ID NO:1.

[0047] The nucleotide sequence encoding the C-terminal domain (CTD) of wild-type A3F is shown in SEQ ID NO:2.

[0048] The base editor hyA3F-BE4max involved in the following embodiments is a cytosine base editor that significantly outperforms existing tools in editing performance, obtained based on ESM and structure-guided modification (see the same-date application of this invention). The amino acid sequence of the base editor hyA3F-BE4max (fusion protein) is shown in SEQ ID NO:3, and its corresponding encoding nucleotide sequence is shown in SEQ ID NO:4. The first 19 positions of SEQ ID NO:3 are the nuclear localization signal NLS (denoted as nuclear localization signal 1); positions 20-208 are hyA3F; positions 209-240 are the linker (denoted as linker peptide 1); positions 241-1607 are the Cas9 (D10A) protein; positions 1608-1617 are the linker (denoted as linker peptide 2); positions 1618-1700 are the amino acid sequence of the uracil glycosylase inhibitor UGI; positions 1701-1710 are the linker (denoted as linker peptide 3); positions 1711-1793 are the amino acid sequence of the uracil glycosylase inhibitor UGI; and positions 1794-1810 are the nuclear localization signal NLS (denoted as nuclear localization signal 2).

[0049] The specific gRNA sequences (target sequences) targeting each locus of each gene involved in the following examples are as follows (5'-3'):

[0050] The target sequence of gRNA1 targeting the KRAS gene is: ACAAGATTTACCTCTATTGT (SEQ ID NO:10).

[0051] The target sequence of gRNA2 targeting the KRAS gene is: GCTAATTCAGAATCATTTTG (SEQ ID NO:11).

[0052] The target sequence of gRNA3 targeting the KRAS gene is: AGGAAGCAAGTAGTAATTGA (SEQ ID NO:5);

[0053] The target sequence of gRNA4 targeting the KRAS gene is: GGACCAGTACATGAGGACTG (SEQ ID NO:12).

[0054] The target sequence of gRNA5 targeting the KRAS gene is: AGGGACCAGTACATGAGGAC (SEQ ID NO:13).

[0055] The target sequence of gRNA6 targeting the KRAS gene is: AGAACAAATTAAAAGAGTTA (SEQ ID NO:14).

[0056] The target sequence of gRNA1 targeting the MYC gene is: CACGGCCGACCAGCTGGAGA (SEQ ID NO:6).

[0057] The target sequence of gRNA2 targeting the MYC gene is: TCATCATCCAGGACTGTATG (SEQ ID NO:15).

[0058] The target sequence of gRNA3 targeting the MYC gene is: TCGCTTACCAGAGTCGCTGC (SEQ ID NO:16).

[0059] The target sequence of gRNA4 targeting the MYC gene is: AGAGGAGGAACAAGAAGATG (SEQ ID NO:17).

[0060] The target sequence of gRNA5 targeting the MYC gene is: AGAGGCAGGCTCCTGGCAAA (SEQ ID NO:18).

[0061] Guided by the aforementioned gRNAs, the base editor hyA3F-BE4max of this invention generates a stop codon by mutating C to T at a specific site, thereby achieving the knockout of the target gene (see [link to documentation]). Figure 1 (a)

[0062] Example 1: Application of a high-performance dual AAV system based on A3F-BE4max in the treatment of pancreatic cancer

[0063] I. Experimental Materials and Methods

[0064] 1. Cell Culture and Transfection

[0065] All cell lines used in this invention were derived from ATCC (USA). HEK293T, PANC-1, and SW1990 cells were cultured in DMEM medium supplemented with 10% fetal bovine serum (FBS) under a 37°C, 5% CO2 incubator. For transfection experiments, cells were seeded at appropriate densities in 24-well plates (Corning, USA) and transfected using polyethyleneimine (Polysciences, USA) according to the manufacturer's instructions. A simplified procedure was as follows: 600 ng of base editor (BE) plasmid and 300 ng of sgRNA expression plasmid were mixed with 50 μl of PEI-containing Opti-MEM (Gibco, USA) and transfected for 24 hours. After transfection, cells were cultured for 3 days in fresh medium containing 5 μg / mL puromycin (Merck, USA) for selection. Finally, genomic DNA was extracted using QuickExtract DNA extraction solution (Epicentre, USA). PCR amplification of the target genomic region of interest (200-300 bp) is used for high-throughput DNA sequencing analysis.

[0066] 2. Plasmid construction

[0067] The compact A3F system was synthesized by AZENTA. PCR products were purified by agarose gel electrophoresis, digested with DpnI restriction endonuclease (NEB, USA), and then assembled according to the manufacturer's instructions using the Gibson or Golden Gate method. All gRNA expression plasmids were assembled using the RNF2 sgRNA expression plasmid as a template via the Golden Gate method, with the protospacer sequence embedded in the primers. The specific construction methods for the relevant plasmids are as follows:

[0068] (1) Construction of sgRNA plasmid

[0069] The method for constructing the sgRNA described in this invention is as follows: The corresponding gene sequence of human hg38 was obtained from the NCBI genome database. The desired editing location was located using SnapGene software, and the editing site was determined. PAM motifs (NGG) conforming to the requirements of the spCas9 system were screened. Modification primers were then designed. If the 5' end of the target sequence did not start with G, a G base was added after the forward primer 5'-CACC-3', and a C base was simultaneously added to the reverse primer. BsmBI restriction sites were introduced at both ends of all primers (sgRNA primer sequences were synthesized by Suzhou Genewiz Biotechnology Co., Ltd., and the specific sequences are shown in Tables 1 and 2; the BsmBI sites are not shown in the tables). The sgRNA was cloned into the BsmBI-digested lentiGuide-Puro vector (addgene, #52963) backbone using the Golden Gate assembly method. Subsequently, the forward and reverse primers and T4 were mixed in proportion. DNA ligase buffer and ddH2O were used to anneal the cells at 95°C for 2 minutes and then allowed to cool naturally to 25°C to form double-stranded DNA adapters. The annealed product was then mixed with a linearized vector, BsmBI restriction enzyme, T4 DNA ligase, buffer, and BSA. The single-step enzyme digestion-ligation reaction was completed by 25 cycles of 37°C for 3 minutes and 25°C for 4 minutes. The reaction was terminated by heat treatment at 80°C for 5 minutes. The ligation product was then transformed into Trans-TI chemocompetent cells, incubated on ice for 30 minutes, followed by heat shock at 42°C for 45 seconds. After thawing on ice, the cells were plated on LB agar plates containing ampicillin and incubated at 37°C for 12-16 hours. Single colonies were picked, amplified, and sent for Sanger sequencing verification. Correct clones were then extracted using plasmids and preserved.

[0070] The specific gRNA sequences (target sequences) targeting each gene locus and the sgRNA construction primers involved in this invention are shown in Table 1.

[0071] Table 1. Primers for targeting sgRNAs of KRAS and MYC

[0072]

[0073] (2) Construction of editor plasmid

[0074] The editor plasmid of this invention is constructed using seamless cloning technology. The lentiCas9-Blast vector (addgene, #52962) is used as a template to replace the Cas9-nuclear localization sequence-flag-P2A-BSD sequence on the original template with the encoding gene (SEQ ID NO:4) of the exogenous fragment base editor hyA3F-BE4max (fusion protein), thus obtaining the expression plasmid of the base editor hyA3F-BE4max. The specific method is as follows: Specific primers for the target fragment were designed using Diva software, and the primer annealing temperature and fragment length were recorded. Using the lentiCas9-Blast vector (addgene, #52962) and the encoding gene (SEQ ID NO:4) of the exogenous fragment base editor hyA3F-BE4max (fusion protein) as templates, a PCR reaction system containing the corresponding primers and DMSO was prepared using PrimeSTAR Max DNA Polymerase for amplification. The resulting lentiCas9-Blast vector backbone sequence without the Cas9-nuclear localization sequence-flag-P2A-BSD sequence and the encoding gene (SEQ ID NO:4) of the exogenous fragment base editor hyA3F-BE4max (fusion protein) were obtained. The reaction procedure included pre-denaturation at 95°C for 3 minutes, followed by 35 cycles of 95°C for 30 seconds, 65°C for 30 seconds, and 72°C for 60 seconds, with a final extension at 72°C for 5 minutes. The PCR products were separated by 1% TAE agarose gel electrophoresis, and the target band was excised under UV light and purified using a SanPrep column DNA gel extraction kit. DpnI restriction enzyme was added to the gel-extracted product, and the mixture was digested at 37°C for 60 minutes to remove the original template. The product concentration was then measured. Based on the number of inserted fragments, the required amount was calculated according to the principle that the optimal amount per fragment is 0.02 × fragment base pairs. The lentiCas9-Blast vector backbone sequence without the Cas9-nuclear localization sequence-flag-P2A-BSD sequence and the encoding gene (SEQ ID NO:4) of the exogenous fragment base editor hyA3F-BE4max (fusion protein) were mixed with SuperFusion Cloning Mix and reacted at 50℃ for 60 minutes to complete seamless cloning and ligation. Finally, the ligation product was transformed with bacteria, plated on antibiotic plates, single colonies were picked and cultured, and verified by Sanger sequencing to obtain the correct editor plasmid.

[0075] In the final expression plasmid of the base editor hyA3F-BE4max, the structure of the gene encoding the base editor hyA3F-BE4max from the 5' end to the 3' end is as follows: NLS coding sequence - coding sequence of the CTD variant (W310 / S216T / H198D) of cytosine deaminase APOBEC3F - linker peptide coding sequence - Cas9 (D10A) protein coding sequence - linker peptide coding sequence - uracil glycosylase inhibitor UGI coding sequence - linker peptide coding sequence - uracil glycosylase inhibitor UGI coding sequence - NLS coding sequence. The amino acid sequence of the base editor hyA3F-BE4max (fusion protein) is shown in SEQ ID NO:3, and its corresponding coding nucleotide sequence is shown in SEQ ID NO:4.

[0076] 3. Strains and culture conditions

[0077] *Escherichia coli* Trans5α was used as the cloning host and cultured in lysozyme (LB; containing 1% (w / v) tryptone, 0.5% (w / v) yeast extract and 1% (w / v) NaCl) at 37°C. To screen plasmids, ampicillin (Sigma-Aldrich, USA) was added to the medium to a final concentration of 100 mg / L to identify positive clones.

[0078] 4. High-throughput sequencing and data analysis of genomic DNA samples

[0079] The construction and analysis of next-generation sequencing libraries followed the previously described methodology [Yang, L., Huo, Y., Wang, M., Zhang, D., Zhang, T., Wu, H., Rao, X., Meng, H., Yin, S., Mei, J., et al. (2024). Engineering APOBEC3A deaminase for highly accurate and efficient baseediting. Nat Chem Biol 20 [1176-1187.]. The simplified procedure is as follows: Purified PCR fragments underwent end repair, 5' phosphorylation, and dA tailing in a single reaction using End PrepEnzyme Mix. This was followed by a TA ligation reaction to attach adapters to both ends of the fragments. The resulting PCR products were purified, quantified, and sequenced on the Illumina HiSeq platform according to the manufacturer's protocol.

[0080] Amplicon sequencing data were analyzed using batch processing mode of CRISPResso2 (v2.0.45) with window parameters set to -wc 10 -w 20. Base transition frequencies were extracted from the output file “Nucleotide_percentage_summary.txt”, while indel frequencies were obtained from “CRISPRessoBatch_quantification_of_editing_frequency.txt” for base editor experiments. Information on all genomic loci and deep sequencing primers used for sgRNA is provided in Table 1.

[0081] 5. RNA editing analysis

[0082] Transcriptome-wide CU RNA editing analysis was performed using the previously described method [Su, J., Han, C., Zhou, Y., Shan, J., Zhou, X., and Yuan, F. (2024). SaProt: Protein Language Modeling with Structure-aware Vocabulary. bioRxiv, 2023.2010.2001.560349.] with slight modifications. HEK293T cells were transfected with either the base editor construct or the nCas9 (D10A) control editor (with deaminase removed) and cultured for 48 hours. Total RNA was extracted and RNA was sequenced. Raw FASTQ files were processed using Fastp to remove adapter sequences, low-quality bases (Q<20), and unpaired reads were discarded. Cleaned reads were aligned to the human reference genome (hg38, UCSC) using STARv2.7.11b with default parameters. SAM files were sorted and indexed using SAMtools.

[0083] To identify and quantify RNA editing events, we analyzed aligned reads using REDItools2, with the parameter -s 2 specifying strand specificity. Only cytosine on the sense strand and guanine on the antisense strand were considered potential CU editing sites. Sites with coverage <20 or a mapping / reads quality score <30 were excluded to reduce false positives. For each sample, the percentage of editing was calculated by dividing the number of cytosine (or guanine) converted to uracil (or adenine) by the total number of cytosine (or guanine) remaining after filtration. Data are presented as mean ± standard deviation of three independent biological replicates.

[0084] 6. Construct a dual AAV system

[0085] A dual AAV vector splitting strategy was employed: the base editor hyA3F-BE4max shown in SEQ ID NO:3 was split into an N-terminal (1-812aa) and a C-terminal (813-1810aa), and the corresponding coding genes were cloned into the Cbh_v5 AAV-CBE N-terminal vector (Addgene, #137175) and the Cbh_v5 AAV-CBE C-terminal vector (Addgene, #137176), respectively, to obtain recombinant vector 1 and recombinant vector 2. Recombinant vector 1 carries the N-terminal +KRAS-sgRNA3 of the base editor hyA3F-BE4max (target sequence is SEQ ID NO:5), and recombinant vector 2 carries the C-terminal +MYC-sgRNA1 of the base editor hyA3F-BE4max (target sequence is SEQ ID NO:6).

[0086] Recombinant vector 1 is specifically a recombinant plasmid obtained by replacing the APOBEC-1 and CAS9(N) fragments of the Cbh_v5 AAV-CBE N-termina vector with the N-terminal coding gene of the base editor hyA3F-BE4max. Recombinant vector 1 contains SEQ ID NO:7. Positions 1-131 of SEQ ID NO:7 are the 5' ITR, positions 132-146 are the liner, positions 147-401 are the CBH promoter, positions 402-418 are the linker, positions 419-2854 are the coding sequence of the N-terminal portion of the base editor hyA3F-BE4max, and positions 2855-3202 are the coding sequence of the N-terminal portion of the peptide Intein (encoding SEQ ID NO:7). NO:9 (positions 1-116), positions 3203-3253 are the coding sequence for the nuclear localization signal, positions 3254-3256 are the stop codon TAA, positions 3257-3417 are the gene expression enhancement element WPRE, positions 3418-3505 are the linker, positions 3506-3733 are the bGH sequence, positions 3734-4091 are the reverse complementary sequence to the coding sequence of gRNA3 targeting the KRAS gene expressed by the U6 promoter, and positions 4100-4229 are the 3' end ITR.

[0087] Recombinant vector 2 is specifically a recombinant plasmid obtained by replacing the CAS9(C) position and UGI fragment of the Cbh_v5 AAV-CBE C-termina vector with the C-terminus of the base editor hyA3F-BE4max. Recombinant vector 2 contains SEQ ID NO:8. Positions 1-131 of SEQ ID NO:8 are the 5' ITR, positions 132-146 are the linker, positions 147-401 are the CBH promoter, positions 402-418 are the linker, positions 419-475 are the nuclear localization signal coding sequence, and positions 476-580 are the coding sequence for the C-terminal portion of the peptide Intein (encoding SEQ ID NO:8). NO:9, positions 117-151), positions 581-3574 are the coding sequence of the C-terminal portion of the base editor hyA3F-BE4max, positions 3575-3577 are the stop codon TAA, positions 3578-3738 are the gene expression enhancement element WPRE, positions 3739-3826 are the linker, positions 3827-4054 ​​are the bGH sequence, positions 4055-4412 are the reverse complementary sequence of the coding sequence of gRNA1 targeting the MYC gene expressed by the U6 promoter, positions 4413-4420 are the linker, and positions 4421-4550 are the 3' end ITR.

[0088] 7. Establishment and culture of patient-derived organoids (PDOs)

[0089] The establishment and culture of PDOs were performed according to previously reported methods [Xie, Y., Zhou, T., Li, X., Zhao, K., Bai, W., Hou, X., Liu, Z., Ni, B., Zhang, Z., Yan, J., et al. (2024). Targeting ESE3 / EHF With Nifurtimox Inhibits CXCR2(+) Neutrophil Infiltration and Overcomes Pancreatic Cancer Resistance to Chemotherapy and Immunotherapy. Gastroenterology 167, 281-297.]. A brief procedure was followed: Fresh PDAC specimens were washed three times with cold PBS containing 10% penicillin-streptomycin. The specimens were then cut into pieces less than 1 mm using a sterile blade. 3Small pieces of organoids were then digested with a mixture of 5 mg / mL collagenase II, 5 mg / mL collagenase IV, and 5 mg / mL collagenase XI at 37°C with vigorous shaking for 30 minutes. Digestion was terminated by adding 7.5% BSA to advanced DMEM / F12 medium (Gibco, USA). Tumor cells were collected by centrifugation at 400×g for 5 minutes, then embedded in Matrigel (Corning, USA) and cultured in Human Complete Feeding Medium (HCPLT). The organoid medium was changed every 2 days according to growth status, and the cells were passaged every 14–20 days.

[0090] 8. Lentiviral infection and base editing of MYC and KRAS in PDAC cells and PDOs

[0091] Lentiviral production was performed according to a pre-established protocol [Yang, C., Ma, Z., Wang, K., Dong, X., Huang, M., Li, Y., Zhu, X., Li, J., Cheng, Z., Bi, C., and Zhang, X. (2023). HMGN1 enhances CRISPR-directed dual-function A-to-G and C-to-G base editing. NatCommun 14, 2430.]. A simplified procedure was as follows: HEK293T cells were co-transfected with a construction vector containing the base editor (BE) system and the targeting gRNA (see step 2) along with psPAX2 and pMD2.G packaging plasmids. Viral supernatant was collected 48 hours after transfection, filtered through a 0.45 μm filter, and concentrated by ultracentrifugation (100,000 × g, 4°C, 2 hours). The concentrated viral particles were used to infect 5 × 10⁵ cells. 5 PANC-1 / SW1990 cells or PDOs with a confluence of 20-30% (MOI = 20) were infected with 5 μg / mL polybrene (Solarbio, China). Transduced cells were selected for 5 days with 2 μg / mL blastomycin (Solarbio, China). Genomic DNA from the cells was collected and analyzed by Sanger sequencing to quantify editing efficiency.

[0092] The experiment also included a non-targeting sgRNA (sequence: AGTAGGCCACCGTGCGAATC, SEQ ID NO:41) as a control, corresponding to the "blank control sgRNA" mentioned later.

[0093] 9. Cloning experiment

[0094] Cells were seeded in triplet wells in 6-well plates at a seeding density of 1000 cells per well for both PANC-1 and SW1990 cells. Infection was performed using the lentiviruses described in step 8, including four treatments: blank control sgRNA, KRAS-sgRNA3, MYC-sgRNA1, and co-infection with both. After 10–14 days of culture, cell clones were washed with phosphate-buffered saline (PBS), fixed with methanol, stained with 0.1% crystal violet, and counted. Plating efficiency was calculated as the ratio of clone number to seeded cell number, and the survival fraction was calculated as: plating efficiency of edited cells / plating efficiency of unedited control cells.

[0095] 10. CCK-8 Experiment

[0096] Cell viability was determined using the Cell Counting Kit-8 (Shandong Sparkjade Biotechnology Co., Ltd.) according to the manufacturer's instructions. A simplified procedure was as follows: Cells (2000 cells per well) were seeded into 96-well plates and infected with the lentiviruses described in step 8, including four treatments: blank control sgRNA, KRAS-sgRNA3, MYC-sgRNA1, and simultaneous infection with both. After culturing for 3 days, a final concentration of 10% CCK8 reagent was added to each well, and the plates were incubated in the dark for 2 hours. Absorbance at 450 nm was measured using a microplate reader (BioTek, Winooski, USA).

[0097] 11. Western blot analysis

[0098] Whole-cell extracts were prepared by lysing cells with SDS protein lysis buffer containing a mixture of protease inhibitors (Bimake, B14001). Proteins in the lysates were separated by SDS-PAGE and subsequently detected by Western blotting with anti-KRAS (ab275885) and anti-MYC (ab314108) antibodies. β-actin was used as a loading control. Anti-rabbit secondary antibody was diluted 1:5000 (Abmart).

[0099] 12. Organoid proliferation analysis

[0100] Organoids were seeded into 96-well cell culture plates, and microscopic verification confirmed the formation of uniformly distributed cell clusters. Systematic morphological monitoring was performed every 48 hours using phase-contrast microscopy with digital image acquisition. After photographing, an equal volume of CellTiter-Glo 3D cell viability reagent (G9683, Promega, USA) was added to each well of culture medium. The plates were protected from light and shaken on a horizontal track shaker at 300 rpm for 5 minutes to ensure complete lysis, followed by incubation at 37°C / 5% CO2 for 15 minutes. The luminescence signal was quantified using a PerkinElmer EnSight multi-mode microplate reader, and the luminescence intensity was used as a quantitative indicator of organoid metabolic activity via ATP bioluminescence measurement.

[0101] 13. Orthotopic mouse model and AAV treatment

[0102] NSG (NOD-scid-IL2Rγc- / -) mice were randomly assigned to different groups and injected orally with three-dimensional organoids. Observers and recorders in the study were blinded to group assignments and recorded mouse survival. After preparing a cell suspension from pancreatic cancer organoids, half the volume of Matrigel was added, thoroughly mixed, and kept on ice to maintain cell viability. The cell concentration was adjusted to 200,000 cells per 40 μl suspension, which was used as the injection dose per mouse. After orally injecting into the pancreas of NSG mice, treatment was administered using a mixed AAV8 serotype (commercially produced by VectorBuilder) with two vectors (see step 6). The two AAVs were mixed in a 1:1 ratio and injected intraperitoneally at a dose of 1 × 10⁻⁶ per mouse. 11 Genome copies were injected three times, every three days. This dual AAV system can reconstruct functional hyA3F in vivo and deliver two sgRNAs simultaneously. Tumor progression and survival outcomes were monitored in a blinded manner in the experimental group.

[0103] 14. Statistical Analysis and Repeatability

[0104] Unless otherwise specified, all experimental data are presented as mean ± standard deviation of three biological replicates. Statistical comparisons between the control and experimental groups were performed using Student's t-test or log-rank test (GraphPad Prism 8). A p-value < 0.05 was considered statistically significant.

[0105] II. Results and Analysis

[0106] 1. Screening for highly effective hyA3F-gRNA combinations that silence KRAS and MYC for use in PDAC cells.

[0107] This invention attempts to use A3F-mediated precise editing (i.e., the base editor hyA3F-BE4max of this invention) to simultaneously silence KRAS and MYC as a novel strategy to suppress PDAC growth.

[0108] Therefore, we first screened a series of candidate gRNAs targeting KRAS and MYC sites in HEK293T cells co-transfected with hyA3F-BE4max. Figure 1 (a). Using Sanger sequencing to evaluate the editing efficiency of different editors for different gRNAs, we identified KRAS_gRNA-3# and 5#, and MYC_gRNA-1# and 5# as the most effective combinations. Figure 1 (b) These results were further validated by Western blot analysis. Ultimately, we selected KRAS_gRNA-3 and MYC_gRNA-1 for subsequent experiments, primarily based on their precise localization near the 5' exon (reducing the risk of generating loss-of-function truncated proteins) and their efficient silencing ability (…). Figure 2 (a) Next, we evaluated the functional effects of these gRNAs in a PDAC cell model. This was achieved through lentiviral delivery of hyA3F-BE4max and selected gRNAs to KRAS. G12D In mutant PANC-1 and SW1990 cells, we observed effective inhibition of target gene expression, consistent with results in HEK293T cells. Figure 2 (b) Functional experiments showed that disruption of KRAS or MYC alone significantly inhibited cell proliferation, while dual targeting produced a stronger synergistic anti-proliferative effect. Figure 2 (c). These important results highlight the therapeutic potential of A3F-mediated base editing (i.e., the base editor hyA3F-BE4max of this invention) in simultaneously silencing KRAS and MYC, and in significantly inhibiting PDAC cell growth in vitro.

[0109] 2. AAV-mediated hyA3F-BE4max and dual gRNAs targeting MYC and KRAS to enhance PDAC gene therapy

[0110] Encouraged by the in vitro experimental results, this invention further evaluated the therapeutic efficacy of hyA3F-BE4max-mediated editing in a more clinically relevant model. Patient-derived organoids (PDOs) were transduced for five days using lentiviral constructs encoding hyA3F-BE4max and single gRNAs. Targeted sequencing confirmed highly efficient editing of both KRAS and MYC sites, with editing efficiencies as high as 53% and 40%, respectively. Figure 3 (a). Correspondingly, Western blot analysis showed that, compared with the untargeted control, the expression of KRAS and MYC proteins in the edited PDOs was significantly reduced ( Figure 3 (b) Furthermore, single gene editing can significantly inhibit organoid growth, while dual targeting leads to a further decrease in proliferative capacity ( Figure 3 (c). To evaluate in vivo efficacy, we developed a dual AAV system [Levy, JM, Yeh, WH, Pendse, N., Davis, JR, Hennessey, E., Butcher, R., Koblan, LW, Comander, J., Liu, Q., and Liu, DR (2020). Cytosine and adenine base editing of the brain, liver, retina, heart and skeletal muscle of mice via adeno-associated viruses. Nat Biomed Eng 4, 97-110.] for the systemic delivery of hyA3F-BE4max and dual gRNAs targeting KRAS and MYC. Figure 4 (a) By orthotopically transplanting edited PDOs into the pancreas of nude mice, followed by intraperitoneal injection of AAV every three days (for a total of three doses), the results showed that mice receiving targeted KRAS or MYC AAVs exhibited significant tumor regression and prolonged survival compared to the control group. Figure 4 (middle CD). It is worth noting that simultaneously targeting two oncogenes produced a synergistic anti-tumor effect, resulting in a greater survival benefit than single-gene targeting. Figure 4 (d). Tumor tissue targeted sequencing on day 38 in the combination therapy group showed that the targeted editing efficiencies of KRAS and MYC were 22% and 10%, respectively. Figure 4 (b) These important findings collectively demonstrate that systemic delivery of hyA3F-BE4max and selected gRNAs can efficiently edit KRAS and MYC in patient-derived PDAC models, achieving significant tumor suppression and survival benefits.

[0111] In summary, this invention fully validates the therapeutic potential of the base editor hyA3F-BE4max combined with highly efficient gRNA: KRAS and MYC silencing were successfully achieved in in vitro PDAC cell lines and organoid models, and effective gene editing was obtained through delivery via the AAV system in an in vivo PDO orthotopic transplantation model, demonstrating significant tumor suppression and prolonging mouse survival. These results lay the foundation for the feasibility of PDAC genetic therapy based on base editing.

[0112] The present invention has been described in detail above. Those skilled in the art will recognize that the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. While specific embodiments have been provided, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein.

Claims

1. A dual AAV vector system for treating pancreatic cancer, characterized in that: The dual AAV vector system is used to deliver a base editing system targeting the KRAS and MYC genes; The base editing system includes: base editor hyA3F-BE4max, gRNA1, and gRNA2; The base editor hyA3F-BE4max includes a cytosine deaminase variant and an nCas9 protein; the amino acid sequence of the cytosine deaminase variant is obtained by replacing the 127th amino acid of SEQ ID NO:1 with W instead of D, the 33rd amino acid with S instead of T, and the 15th amino acid with H instead of D. The gRNA1 targets the KRAS gene, and its target sequence is SEQ ID NO:5; The gRNA2 targets the MYC gene, and its target sequence is SEQ ID NO:6; The dual AAV carrier system includes a first AAV carrier and a second AAV carrier; The first AAV vector contains a first nucleotide sequence; the first nucleotide sequence includes, from the 5' end to the 3' end, a 5' ITR, a CBH promoter, a coding sequence for the N-terminal portion of the base editor hyA3F-BE4max, a coding sequence for the N-terminal portion of the peptide Intein, a gene expression enhancement element WPRE, an inverse complementary sequence to the coding sequence of gRNA1 expressed by the U6 promoter, and a 3' ITR. The second AAV vector contains a second nucleotide sequence; the second nucleotide sequence includes, from the 5' end to the 3' end, a 5' ITR, a CBH promoter, a coding sequence for the C-terminal portion of the peptide Intein, a coding sequence for the C-terminal portion of the base editor hyA3F-BE4max, a gene expression enhancement element WPRE, an inverse complementary sequence to the coding sequence of gRNA2 expressed by the U6 promoter, and a 3' ITR.

2. The dual AAV carrier system according to claim 1, characterized in that: The amino acid sequence of the base editor hyA3F-BE4max is SEQ ID NO:

3.

3. The dual AAV carrier system according to claim 1, characterized in that: The amino acid sequence of the N-terminal portion of the base editor hyA3F-BE4max is positions 1-812 of SEQ ID NO:3; the amino acid sequence of the C-terminal portion of the base editor hyA3F-BE4max is positions 813-1810 of SEQ ID NO:3; and / or The amino acid sequence of the N-terminal portion of the inteptin is positions 1-116 of SEQ ID NO:9; the amino acid sequence of the C-terminal portion of the inteptin is positions 117-151 of SEQ ID NO:

9.

4. The dual AAV carrier system according to claim 1, characterized in that: The first nucleotide sequence is as shown in SEQ ID NO:7; and / or The second nucleotide sequence is shown in SEQ ID NO:

8.

5. The dual AAV carrier system according to any one of claims 1-4, characterized in that: Both the first AAV vector and the second AAV vector are AAV8 serotype.

6. A base editing system targeting the KRAS and MYC genes, characterized in that: The base editing system is the base editing system described in claim 1 or 2.

7. A biomaterial, characterized in that: The biomaterial is either (A1) or (A2): (A1) Encoding the nucleic acid molecule of the base editing system of claim 6; (A2) An expression cassette or recombinant vector or recombinant microorganism or recombinant cell containing the nucleic acid molecule described in (A1).

8. The use of the base editing system of claim 6, the dual AAV carrier system of any one of claims 1-5, or the biomaterial of claim 7 in the preparation of a medicament for treating pancreatic cancer.

9. A drug, characterized in that: The drug contains the base editing system of claim 6, or the dual AAV carrier system of any one of claims 1-5, or the biomaterial and pharmaceutically acceptable carrier of claim 7; The drug has any of the following functions: (B1) Treatment of pancreatic cancer; (B2) Inhibits the growth and / or proliferation of pancreatic cancer cells.

Citation Information

Patent Citations

  • Nucleobase editors and uses thereof

    US20170121693A1

  • Target genes in MYC-driven neoplasia

    US20190328732A1