EP300 detection preparation and application of EP300 in product for treating rheumatoid arthritis
By synthesizing the Si-EP300 sequence of a specific small interfering gene and regulating H3K18 lactation, the problems of target generalization and drug resistance in the treatment of rheumatoid arthritis have been solved, providing an effective molecular targeted therapy tool for the diagnosis and treatment of rheumatoid arthritis.
Patent Information
- Application Number
- CN202511461401.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-10-14
- Publication Date
- 2026-01-09
AI Technical Summary
Existing drugs for the treatment of rheumatoid arthritis mostly target single inflammatory factors or immune cells, which have problems such as target generalization and easy development of drug resistance, and lack innovative drug targets and mechanisms.
We designed and synthesized the Si-EP300 sequence, a specific small interfering gene, which inhibits the proliferation of human monocytes/macrophages and synovial fibroblasts and the expression of pathological markers in rheumatoid arthritis by regulating H3K18 lactation, and provides EP300 detection agents and therapeutic products.
Significantly reducing the expression of inflammatory markers MMP3 and Fibronectin in synovial cells, decreasing synovial cell proliferation, and increasing apoptosis rate, it has become a molecular targeted therapy tool for rheumatoid arthritis, used for early diagnosis, targeted therapy, and prognostic assessment.
Smart Images

Figure CN121294640A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, specifically to an EP300 detection reagent and the application of EP300 in products for treating rheumatoid arthritis. Background Technology
[0002] Rheumatoid arthritis (RA) is an autoimmune disease characterized by chronic, symmetrical, polyarticular joint inflammation. It not only affects joint function and quality of life but can also impact multiple organ systems throughout the body, leading to serious complications. The pathogenesis of rheumatoid arthritis is complex, involving the interaction of genetic, environmental, and immune factors. Its core pathological features are synovial inflammation and joint destruction, which can ultimately lead to joint deformities and loss of function.
[0003] Existing drugs for treating rheumatoid arthritis mostly target single inflammatory factors or immune cells, which have problems such as target generalization and easy development of drug resistance.
[0004] Therefore, the innovative discovery of new drug targets and the elucidation of new mechanisms are of great significance for the clinical management of RA. Summary of the Invention
[0005] To address the shortcomings of existing technologies, this invention provides an EP300 detection preparation and the application of EP300 in products for treating rheumatoid arthritis. This invention designs and synthesizes a Si-EP300 sequence of a specific small interfering gene, which can significantly inhibit the proliferation of human monocytes / macrophages-synovial fibroblasts and the expression of pathological markers of rheumatoid arthritis by regulating H3K18 lactation, and can become a molecular targeted therapy tool for rheumatoid arthritis.
[0006] To achieve the above objectives, the present invention provides the following technical solution: A formulation for detecting EP300, said formulation being capable of detecting EP300 gene expression levels; The formulation consists of: 10 μL 2×Universal SYBR qPCR Mix, 1 μL cDNA, 0.5 μL each of primers at a concentration of 10 μmol / L, and ddH2O to a final volume of 20 μL. The sequence of the primers is as follows: EP300 Forward:GACACCTACACCACCAACAACAC; EP300 Reverse:GCTGCTGTGCTCTGCTTGTG.
[0007] The application of the above-mentioned preparations in the preparation of tools for diagnosing rheumatoid arthritis.
[0008] Preferably, the tool is any one of a reagent kit, a chip, or a nucleic acid membrane strip.
[0009] The application of EP300 in products for treating rheumatoid arthritis, wherein the EP300 inhibitor is one of the following EP300 gene-specific small interfering RNAs: Si-EP300-1955: hP300-1955-s: GGGAGUAAAUGGAGGUGUATT; hP300-1955-a:UACACCUCCAUUUACUCCCTT; Si-EP300-4900: hP300-4900-s: AGGAGGAAGAAGAGAGAAATT; hP300-4900-a:UUUCCUCUCUUCUUCCCUCTT; Si-EP300-2333: hP300-2333-s: CCAGAAAGAACUAGAAGAATT; hP300-2333-a:UUCUUCUAGUUCUUUCUGGTT.
[0010] This invention provides an EP300 detection preparation and the application of EP300 in products for treating rheumatoid arthritis, which has the following advantages compared with the prior art: Knocking down EP300 in human THP-1-derived macrophages and co-culturing them with synovial cells resulted in decreased expression of inflammatory markers MMP3 and Fibronectin in synovial cells (detected by immunofluorescence), reduced synovial cell proliferation (detected by scratch assay), and increased synovial cell apoptosis rate (detected by flow cytometry) compared to the non-knocking group. Therefore, the EP300 gene can be used to prepare adjuvant therapy or prognostic agents for rheumatoid arthritis. This invention also designs and synthesizes the Si-EP300 sequence, a specific small interfering gene, which can significantly inhibit the proliferation of human monocyte-macrophage-synovial fibroblasts and the expression of pathological markers in rheumatoid arthritis by regulating H3K18 lactation. This could serve as a molecularly targeted therapeutic tool for rheumatoid arthritis, offering hope for the development of novel biomarkers for early diagnosis, targeted therapy, and prognostic assessment of rheumatoid arthritis. Attached Figure Description
[0011] Figure 1 The graph shows the status of the normal group and the model group of mice; Figure 2 A graph showing the serum expression levels of EP300 and RA clinical markers in mice; Figure 3 To detect the expression levels of macrophage M0 and macrophage M1 markers by RT-qPCR; Figure 4 To detect the knockdown efficiency of each EP300 knockdown sequence using RT-qPCR; Figure 5 To detect the expression level of H3K18 lactation in macrophages of each group using Western blotting; Figure 6 Immunofluorescence was used to detect the levels of MMP3 and Fibronectin in synovial cells of each group after co-culturing human THP-1-derived macrophages and human synovial cells. Figure 7 The migration level of synovial cells in each group was detected by scratch assay after co-culturing human THP-1-derived macrophages and human synovial cells. Figure 8 The apoptosis rate of synovial cells in each group was detected by flow cytometry after co-culturing human THP-1-derived macrophages and human synovial cells. Figure 9 To detect the levels of MMP3 and Fibronectin in CIA mice after injection of the P300 inhibitor C646 by immunohistochemistry. Detailed Implementation
[0012] To make the objectives, technical solutions, and advantages of the embodiments of the present invention clearer, the technical solutions of the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0013] Example 1: Correlation analysis of EP300 with clinical markers of RA in mouse serum: 1. Drug preparation for mouse models Acetic acid (50mM): Add 10ul of glacial acetic acid to 3.49ml of pure water and mix well. Chicken type II collagen (2 mg / ml): Mix 2 mg of chicken type II collagen with 1 ml of 50 mM acetic acid. Complete Freund's adjuvant mixture: Mix 1 ml of complete Freund's adjuvant with 1 ml of chicken type II collagen in equal volume, and grind on ice for 15-30 minutes until completely emulsified.
[0014] 2. Preparation of CIA mouse model Male C57BL / 6 animals aged 7-8 weeks were provided by Hangzhou Ziyuan Experimental Animal Technology Co., Ltd. (SCXK2024-0004).
[0015] All mice were fed in an SPF (Self-Free) environment. After one week of acclimatization, chicken type II collagen was mixed with an equal volume of complete Freund's adjuvant using an ice bath method with high-speed stirring to prepare a milky white water-in-oil emulsion. Mice were injected with 0.1 mL of the emulsion at the base of the tail and the left hind paw. A second immunization was performed 21 days later using the same method. The animal welfare ethics review of this experiment was approved by the Animal Ethics Committee of Anhui University of Traditional Chinese Medicine (AHUCM-mouse-2024156, September 28, 2024). (The mouse model is as follows...) Figure 1 (As shown).
[0016] 3. Mouse serum extraction Anesthetized mice are placed supine and fixed on the operating table. The left thumb and forefinger gently pinch both sides of the mouse's head to stabilize the eyeballs. Using sterilized ophthalmic forceps in the right hand, the base of the eyeball is quickly grasped from behind (near the inner eyelid) and gently pulled upwards to dislodge the eyeball from its orbit. Once dislodged, the centrifuge tube is immediately placed near the bleeding site, allowing the blood to flow naturally into the tube (avoiding contact with wound tissue to prevent hemolysis). The centrifuge tube containing the collected blood is left at room temperature for 45 minutes to allow the blood to clot naturally. The clotted blood is then centrifuged at 3500 rpm for 13 minutes. The supernatant serum is gently aspirated using a sterile pipette and transferred to a new centrifuge tube, avoiding the aspiration of the lower red blood cells or blood clots.
[0017] 4. ELISA was used to detect the serum expression levels of EP300 and RA clinical indicators in mice of each group. The serum expression levels of EP300, rheumatoid factor (RF), glucose-6-phosphate isomerase (GPI), anti-cyclic citrulline antibody (CCP), and anti-keratin antibody (AKA) in mice in each group were detected by ELISA.
[0018] The standard solutions were diluted to establish a standard curve. The concentrations after dilution were 640, 320, 160, 80, 40, and 20 ng / ml (Zhanxin Biotechnology). Blank and sample wells were prepared, and samples were added, along with the enzyme-labeled reagent (Zhanxin Biotechnology) except for the blank wells. The mixture was incubated, washed, and developed in the dark. The reaction was then carried out, followed by the addition of stop solution. OD values were measured using an enzyme-labeled instrument, with three samples per group and three replicates.
[0019] like Figure 2 As shown, the serum expression levels of CIA model mice were higher than those of the normal group, and EP300 was significantly correlated with RA clinical indicators.
[0020] Example 2: RT-qPCR detection of macrophage M0 and M1 marker expression levels: THP-1 cells (Shangen Biotechnology) at 80% density were incubated with 100 nM ferrous sulfate (Sigma-Aldrich) for 24 h, followed by 24 h of culture in 1640 complete medium with 10% serum to achieve stable maturation into M0 macrophages. THP-1-induced M0 macrophages at 70% density were incubated with 20 ng / mL IFN-γ (PeproTech) and 100 ng / mL LPS (Biosharp) for 48 h to achieve stable maturation into M1 macrophages.
[0021] RT-qPCR was used to detect the expression level of CD11b, a marker of M0 macrophages; RT-qPCR was used to detect the expression levels of M1 macrophage markers IL-1β, IL-6, and CD86; The steps are as follows: 1. RNA extraction: After irreversibly denaturing RNase with Trizol reagent (Invitrogen), total RNA was precipitated with isopropanol. Pre-cooled 75% ethanol was added at 4°C, centrifuged, and then dissolved in DEPC water.
[0022] 2. Reverse transcription (see Table 1 below): Prepare a 13 μL total reaction system, vortex centrifuge for 5 s, and reverse transcribe to obtain cDNA. Specific parameters are as follows: 25℃ for 10 min, 55℃ for 15 min, and 85℃ for 5 min.
[0023] Table 1 3. Quantitative real-time PCR reaction (see Table 2 below): Table 2 4. Primer setting (see Table 3 below): Table 3 5. Amplification reaction procedure (see Table 4 below): Table 4 Experimental results are as follows Figure 3 As shown, human THP-1 cells were successfully induced into macrophages. The expression level of CD11b, a marker of M0 macrophages, was higher than that of human THP-1 cells, and the expression levels of IL-1β, IL-6, and CD86, markers of M1 macrophages, were significantly higher than those of M0 macrophages.
[0024] Example 3: RT-qPCR was used to detect the knockdown efficiency of each EP300 knockdown sequence: EP300 formulation (see Table 5 below): Table 5 1. Human THP-1 cells were induced into M1 macrophages in six-well plates, and the cell density was controlled at 70%-80% (method as above). 2. Take 5 μL of each of the three knockdown sequences at a concentration of 20 µM (as shown in Table 6), dissolve them in 250 μL of Opti-MEM (gibco), mix gently, and let stand at room temperature for 5 min. Table 6 3. Dissolve 10 μL of LipoHigh in 250 μL of Opti-MEM, mix gently, and let stand at room temperature for 5 min; 4. Mix the solution containing LipoHigh from the previous step with the plasmid DNA (Sangon Biotech) containing the knockdown of the EP300 sequence, and let it stand at room temperature for 15 minutes to obtain the transfection mixture.
[0025] 5. Add the above transfection mixture dropwise into macrophage M1 cells, mix gently, and then incubate at 37°C in a 5% CO2 incubator.
[0026] 6. After 6 hours, replace with fresh culture medium and continue culturing. 7. 24 hours after transfection, RNA was extracted and reverse transcribed. (The steps are the same as those in Example 2 for RNA extraction and reverse transcription.) 8. RT-qPCR was performed using EP300 reagent to detect the knockdown efficiency of the three sequences compared with the negative control group Si-NC and M0 and M1 without target gene-specific siRNA.
[0027] like Figure 4 As shown, the sequence numbered Si-EP300-1955 has the highest knockdown efficiency.
[0028] Example 4: Immunoblotting analysis of H3K18la expression levels in macrophages of each group: Macrophages from each group were washed twice with PBS, the culture medium was discarded, and cell lysis buffer (Beyotime) was added to lyse the cells. Proteins were separated by SDS-PAGE, gel-cut, and transferred to PVDF membranes, which were then blocked with 2.5% BSA solution. The PVDF membranes were incubated overnight at 4°C in H3K18la antibody dilution buffer, followed by incubation with secondary antibody at room temperature for 1 hour. The antibody was diluted 1:1000 according to the H3K18la antibody instructions. Finally, the results were detected using an ECL chemiluminescence assay kit (Thermo Scientific), and grayscale analysis was performed using ImageJ software.
[0029] like Figure 5As shown, after EP300 was knocked down, the expression level of H3K18la was significantly reduced compared with that without knockdown.
[0030] Example 5: Immunofluorescence assays were performed on the levels of MMP3 and Fibronectin in synovial cells of different groups after co-culturing human THP-1-derived macrophages and human synovial cells. 1. Immunofluorescence detection of MMP3 expression levels in synovial cells of each group: Human THP-1 cells were induced into macrophages in 0.4 µm pore size cell culture chambers (LABGIC), knocked down with Si-EP300-1955, and co-cultured with approximately 70% density of normal human synovial cells for two days. Cells were then washed three times with PBS and fixed with 4% paraformaldehyde for 15 min. Permeabilization with 0.1% Triton X-100 was performed at room temperature for 10 min, followed by three washes with PBS. Blocking with 5% BSA at room temperature for 30 min was performed. MMP3 primary antibody dilution buffer was added, and incubation was carried out overnight at 4°C. Cells were washed three times with PBS for 5 min each time. Fluorescently labeled rabbit secondary antibody was added, and incubation was carried out at room temperature in the dark for 1 h. Cells were washed three times with PBS for 5 min each time. DAPI was added, and staining was carried out at room temperature in the dark for 5 min. Cells were washed three times with PBS for 5 min each time. Observation and imaging were performed using a fluorescence microscope (LEICA DM18).
[0031] Immunofluorescence assay was used to detect the expression level of Fibronectin in synovial cells of each group (using the same method as for MMP3 detection). like Figure 6 As shown, knocking down EP300 significantly reduced the levels of MMP3 and Fibronectin, pathological markers of rheumatoid arthritis.
[0032] Example 6: The migration level of synovial cells in each group was detected by scratch assay after co-culturing human THP-1-derived macrophages and human synovial cells. After co-culturing with macrophages, the cells were cultured at a rate of 1×10⁻⁶. 6 Cells were seeded at a density per well in six-well plates and cultured until 100% confluence. Using a 200 μL pipette tip, straight lines were drawn on the cell layer to create uniform scratches, ensuring consistent scratch width. Cells were gently washed three times with PBS to remove cell debris from the scratches. An appropriate amount of serum-free DMEM was added, and the cells were incubated at 37°C with 5% CO2. The scratched areas were observed under a microscope at 0 h and 24 h, and cell migration was recorded by photograph.
[0033] like Figure 7 As shown, compared with the M1-FLS group, knockdown of EP300 significantly reduced the migration ability of synovial cells.
[0034] Example 7: The apoptosis rate of synovial cells in each group was detected by flow cytometry after co-culturing human THP-1-derived macrophages and human synovial cells. After co-culturing macrophages and synovial cells for 48 hours, the apoptosis of FLS cells was detected using a flow cytometry kit.
[0035] like Figure 8 As shown, compared with the model group (the model FLS cells were extracted from the same material as shown in Example 1, Section 2. CIA mouse model preparation), knocking down EP300 reduced the apoptosis rate of FLS cells.
[0036] Example 8: Immunohistochemical detection of changes in MMP3 and Fibronectin levels in CIA mice after injection of the P300 inhibitor C646. CIA mice were injected with C646 at a dose of 20 mg / kg once daily for 2 days. The synovial membranes of the mice in each group were then collected, and the expression levels of MMP3 and Fibronectin in the synovial membranes of each group were detected by immunohistochemistry.
[0037] Specific steps for immunohistochemistry: (1) Sampling and fixation: Cells were fixed with 4% paraformaldehyde, embedded in paraffin or frozen sectioned.
[0038] (2) Antigen retrieval: Paraffin sections are dewaxed and subjected to high-pressure heat retrieval or enzyme digestion.
[0039] (3) Blocking: 3% BSA blocking.
[0040] (4) Primary antibody incubation: Add MMP3 and Fibronectin antibody and incubate overnight at 4°C.
[0041] (5) Secondary antibody labeling: HRP-labeled secondary antibody incubation (45 min).
[0042] (6) Color development: DAB color development and observation.
[0043] (7) Counterstaining and mounting: Counterstain the nucleus with hematoxylin, mount the slide, and examine under a microscope.
[0044] like Figure 9 As shown, intraperitoneal injection of the EP300 inhibitor C646 into mice significantly reduced the expression levels of MMP3 and Fibronectin.
[0045] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A formulation for detecting EP300, characterized in that, The formulation can detect the expression level of the EP300 gene; The formulation is: 10 μL 2×Universal SYBR qPCR Mix, 1 μL cDNA, 0.5 μL primers at a concentration of 10 μmol / L, and ddH2O to bring the total volume to 20 μL; The sequence of the primers is as follows: EP300 Forward:GACACCTACACCACCAACAACAC; EP300 Reverse:GCTGCTGTGCTCTGCTTGTG.
2. The use of the formulation as described in claim 1 in the preparation of a diagnostic tool for rheumatoid arthritis.
3. The application according to claim 2, characterized in that: The tool can be any one of a reagent kit, a chip, or a nucleic acid membrane strip.
4. The application of EP300 in products for treating rheumatoid arthritis, characterized in that, The EP300 inhibitor is one of the following EP300 gene-specific small interfering RNAs: Si-EP300-1955: hP300-1955-s: GGGAGUAAAUGGAGGUGUATT; hP300-1955-a:UACACCUCCAUUUACUCCCTT; Si-EP300-4900: hP300-4900-s: AGGAGGAAGAAGAGAGAAATT; hP300-4900-a:UUUCCUCUCUUCUUCCCUCTT; Si-EP300-2333: hP300-2333-s: CCAGAAAGAACUAGAAGAATT; hP300-2333-a:UUCUUCUAGUUCUUUCUGGTT.
Citation Information
Patent Citations
Derivatives of aminobenzoic acids, process for their preparation and pharmaceutical compositions containing them.
EP0000174A1