Noninvasive biomarker related to endometrial periimplant window phase and application of noninvasive biomarker

Abstract

The invention discloses a noninvasive biomarker related to an endometrial periimplant window phase and application of the noninvasive biomarker. The biomarker comprises 150 miRNAs (micro Ribonucleic Acid), namely, hsa-miR-1290, hsa-miR-511-3p, hsa-miR-1246, hsa-miR-371b-5p, hsa-miR-887-3p, hsa-miR-874-3p, hsa-miR-181a-3p, hsa-miR-873-3p and the like, and is characterized in that the miRNAs can be used for preparing the biomarker. The marker disclosed by the invention can be used for non-invasively and accurately judging whether endometrial tissues have receptivity or not, and has important significance on whether an embryo is successfully transplanted or not.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology and relates to a non-invasive biomarker related to the peri-implantation window of the endometrium and its application. Background Technology

[0002] Pregnancy is a complex process involving embryo implantation in the uterine lining, placental formation, and delivery. Successful implantation requires a fully functional endometrium, a healthy embryo, and synchronized interaction between the embryo and maternal tissues. The receptivity of the endometrium for embryo implantation occurs in three phases: pre-receptivity, receptivity, and post-receptivity. Successful implantation only occurs when a developing embryo enters the receptive endometrium. During a woman's menstrual cycle, the endometrium is only receptive to embryos for a brief period; this critical period is known as the window of implantation (WOI).

[0003] Recurrent implantation failure (RIF) is generally defined as the inability to achieve clinical pregnancy after transferring at least three high-quality embryos in multiple in vitro fertilization cycles, accounting for 10%-20% of cases. Studies have shown that abnormal endometrial receptivity, rather than embryonic factors, is the main cause of implantation failure. However, traditional methods for assessing endometrial receptivity are mostly based on experience and lack molecular-level precision.

[0004] In 2011, Díaz-Gimeno and colleagues demonstrated the endometrial receptivity array (ERA) predictive tool for assessing endometrial receptivity. The ERA contains 238 genes differentially expressed during the transition from a non-receptive to a receptive state and uses an artificial intelligence algorithm to determine the optimal WOI (Waste-on-Implantation) period, with specificity and sensitivity of 0.8857 and 0.99758, respectively. As a predictive tool, the ERA has been improved by manufacturers several times in recent years. In frozen embryo transfer cycles, the ERA has been shown to improve clinical pregnancy rates. Given the hope given to clinicians by ERA test results, researchers developed a new molecular tool, ER map, in 2016. This technology tests 16 genes related to endometrial proliferation and immune responses using RT-PCR. The research group subsequently introduced 40 more genes for endometrial receptivity testing. However, all of these studies require invasive biopsies of endometrial tissue, causing significant discomfort for patients. Furthermore, the tested RNA is prone to degradation, leading to instability in the test results.

[0005] MicroRNAs (miRNAs), composed of 18-25 nucleotides, are ideal for non-invasive diagnostics in reproductive medicine due to their small size, high stability, and dynamic expression patterns. Furthermore, miRNAs play important roles in cell differentiation, immune regulation, hormone secretion, and the interaction between the embryo and the endometrium. For example, researchers have used PanelChip® technology to create a receptivity prediction model based on endometrial tissue miRNAs, achieving an accuracy of over 95% in distinguishing between receptive and non-receptive miRNAs. This model includes miRNAs such as hsa-miR-30b, hsa-miR-181, and hsa-miR-223-3p, which are mechanistically associated with hormone sensitivity and immune regulation.

[0006] miRNAs, as biomarkers, can be detected in various bodily fluids, including plasma, serum, uterine fluid, saliva, and even discarded embryo culture media. Currently, a few studies have used non-invasive methods to detect differences in miRNA expression in the bodily fluids of women with successful embryo implantation, implantation failure, and repeated implantation failure. However, there is currently insufficient data to demonstrate the origin of endometrial receptivity-related miRNAs in bodily fluids, or whether they can represent the expression patterns of miRNAs in endometrial tissue.

[0007] Therefore, there is an urgent need to provide a biomarker related to the periimplantation window of the endometrium for non-invasive and accurate determination of whether the endometrial tissue is receptive and whether the embryo has been successfully implanted. Summary of the Invention

[0008] To address the shortcomings of existing technologies and practical needs, this invention provides a non-invasive biomarker related to the peri-implantation window of the endometrium and its application. This invention performs principal component analysis on plasma miRNA, endometrial tissue miRNA, and uterine fluid miRNA, and finds that plasma miRNA and endometrial tissue miRNA have high similarity in expression patterns, ruling out the possibility of other non-invasive methods such as uterine fluid replacing endometrial biopsy.

[0009] To achieve this objective, the present invention adopts the following technical solution:

[0010] In a first aspect, the present invention provides a biomarker associated with the periimplantation window of the endometrium, the biomarker comprising: hsa-miR-1290, hsa-miR-511-3p, hsa-miR-1246, hsa-miR-371b-5p, hsa-miR-887-3p, hsa-miR-874-3p, hsa-miR-181a-3p, hsa-miR-873-3p, hsa-miR-4772-3p, hsa-miR-223-5p, hsa-miR-27a-5p, hsa-miR-223-3p, hsa-miR-193a-5p, and hsa-miR-346. , hsa-miR-146b-3p, hsa-miR-455-5p, hsa-miR-135a-5p, hsa-miR-671-5p, hsa-miR-34c-5p, hsa-miR-449c-5p, hsa-miR-483-3p, hsa-miR-326, hsa -miR-155-5p, hsa-miR-455-3p, hsa-miR-424-5p, hsa-miR-708-5p, hsa-miR-3690, hsa-miR-942-5p, hsa-miR-142-3p, hsa-miR-7976, hsa-miR-503- 5p, hsa-miR-1298-5p, hsa-miR-153-3p, hsa-miR-424-3p, hsa-miR-548ad-5p, hsa-miR-452-5p, hsa-miR-335-5p, hsa-miR-106b-3p, hsa-miR-193a -3p, hsa-miR-1224-5p, hsa-let-7g-3p, hsa-miR-212-3p, hsa-miR-23a-5p, hsa-miR-449a, hsa-miR-3133, hsa-miR-653-3p, hsa-miR-1180-3p, hsa -miR-183-3p, hsa-miR-30d-5p, hsa-let-7d-5p, hsa-miR-92b-3p, hsa-miR-877-5p, hsa-miR-21-5p, hsa-miR-27a-3p, hsa-miR-509-3-5p, hsa-miR -206, hsa-miR-509-5p, hsa-miR-190a-5p, hsa-miR-150-5p, hsa-miR-146a-5p, hsa-miR-142-5p, hsa-miR-551a, hsa-miR-33a-5p, hsa-miR-210-3p,hsa-miR-489-3p, hsa-miR-514a-3p, hsa-miR-548b-3p, hsa-miR-31-3p, hsa-miR-138-5p, hsa-miR-146b-5p, hsa-miR-3200-3p, hsa-miR-509-3p, h sa-miR-217-5p, hsa-miR-615-3p, hsa-miR-101-3p, hsa-miR-1185-2-3p, hsa-miR-30d-3p, hsa-miR-30b-5p, hsa-miR-9-5p, hsa-miR-675-5p, hsa-m iR-409-5p, hsa-miR-550a-3p, hsa-miR-28-3p, hsa-miR-577, hsa-miR-409-3p, hsa-miR-487a-3p, hsa-miR-1255a, hsa-miR-144-3p, hsa-miR-99a- 3p, hsa-miR-4474-3p, hsa-miR-133a-3p, hsa-miR-4732-3p, hsa-miR-15b-3p, hsa-miR-1-3p, hsa-miR-377-3p, hsa-miR-1277-3p, hsa-miR-136-5p hsa-miR-381-3p, hsa-miR-665, hsa-miR-4485-3p, hsa-miR-494-3p, hsa-miR-345-5p, hsa-miR-548ay-5p, hsa-miR-127-3p, hsa-miR-136-3p, hsa-miR-127-5p, hsa-miR-196b-3p, hsa-miR-199b-3p, hsa-miR-199a-3p, hsa-miR-214-5p, hsa-miR-656-3p, hsa-miR-654-5p, hsa-miR-337-5p, hsa-mi R-152-3p, hsa-miR-195-5p, hsa-miR-126-5p, hsa-miR-410-3p, hsa-miR-548d-5p, hsa-miR-195-3p, hsa-miR-134-5p, hsa-miR-5683, hsa-miR-497- 5p, hsa-miR-6500-3p, hsa-miR-548ae-5p, hsa-miR-143-5p, hsa-miR-214-3p, hsa-miR-126-3p, hsa-miR-451a, hsa-miR-483-5p, hsa-miR-3940-3phsa-miR-143-3p, hsa-miR-25-3p, hsa-miR-196a-5p, hsa-miR-152-5p, hsa-miR-485-5p, hsa- miR-145-3p, hsa-miR-1249-3p, hsa-miR-145-5p, hsa-miR-627-3p, hsa-miR-542-3p, hsa-miR- Any one or a combination of at least two of the following: 29a-3p, hsa-miR-668-3p, hsa-miR-27b-3p, hsa-miR-619-5p, hsa-miR-3613-3p, hsa-miR-378a-5p, hsa-miR-339-3p, hsa-miR-582-5p, hsa-miR-374b-3p, or hsa-miR-576-5p.

[0011] The markers of this invention can non-invasively and accurately determine whether endometrial tissue is receptive, which is of great significance for the success of embryo transfer.

[0012] Preferably, the biomarkers include hsa-miR-101-3p, hsa-miR-1277-3p, hsa-miR-381-3p, hsa-miR-127-5p, hsa-miR-374b-3p, hsa-miR-346, hsa-miR-455-5p, hsa-miR-449c-5p, hsa-miR-455-3p, hsa-let-7d-5p, hsa-miR-548b-3p, and hsa-miR-1 255a, hsa-miR-4485-3p, hsa-miR-31-3p, hsa-miR-4474-3p, hsa-miR-25-3p, hsa-miR-1249-3p, hsa-miR-190a -5p, hsa-miR-33a-5p, hsa-miR-656-3p, hsa-miR-410-3p, hsa-miR-143-3p, hsa-miR-145-3p and hsa-miR-145-5p.

[0013] In a second aspect, the present invention provides the application of the biomarkers and their detection reagents related to the peri-implantation window of the endometrium described in the first aspect in the preparation of products for analyzing the peri-implantation window of the endometrium.

[0014] Thirdly, the present invention provides a kit for analyzing the peri-implantation window of the endometrium, the kit comprising reagents for detecting the expression levels of the biomarkers described in the first aspect, such as T4 RNA ligase 1, T4 RNA ligase 2, ultra-fidelity DNA polymerase, and specific index.

[0015] Fourthly, the present invention provides the application of the biomarkers and their detection reagents related to the peri-implantation window of the endometrium described in the first aspect in the analysis of the peri-implantation window of the endometrium for non-disease diagnosis purposes.

[0016] Fifthly, the present invention provides a method for screening biomarkers related to the peri-implantation window of the endometrium as described in the first aspect, the screening method comprising the following steps:

[0017] (1) Endometrial tissue and peripheral blood samples were collected from women with successful embryo implantation during the peri-implantation window for miRNA sequencing and quantitative analysis. The peri-implantation window includes three periods: pre-implantation, during-implantation, and post-implantation. Pre-implantation is from day 1 to day 5 after the peak of luteinizing hormone (LH), during-implantation is from day 6 to day 7 after the peak of LH, and post-implantation is from day 8 to day 11 after the peak of LH.

[0018] (2) Differentially expressed miRNAs in tissues and plasma during the peri-implantation window were screened separately, and the intersection miRNAs were taken as the biomarkers screened in this invention.

[0019] Preferably, the collection of endometrial tissue and peripheral blood samples from women with successfully implanted embryos during the peri-implantation window for miRNA sequencing and quantification in step (1) includes:

[0020] miRNAs in endometrial tissue and peripheral blood samples were sequenced. Sequences containing 3' adapters, sequences with 3 or more NNN nucleotides, sequences with A, T, C or G homopolymers, sequences with a quality score below 10, and sequences with a post-adaptor length of less than 18 nt were removed, and duplicate sequences were deduplicated. The deduplicated sequences were mapped to the Rfam database to obtain valid sequences. The valid sequences were compared with the human reference genome hg38, and miRNAs were quantified using miRNA quantification software.

[0021] Preferably, the screening in step (2) includes: using differential analysis software to calculate the difference level of miRNA expression between different time points, and obtaining the differentially expressed miRNAs between samples at any two time points; the time points include: days 1 to 11 after the luteinizing hormone peak of women with successful embryo implantation (e.g., day 1, day 3, day 5, day 7 or day 9).

[0022] In a sixth aspect, the present invention provides an apparatus for analyzing endometrial receptivity, the apparatus comprising: a detection module and an analysis module;

[0023] The detection module is used to perform the following: sequencing and quantification of the biomarkers described in the first aspect in plasma samples at three periods: pre-reception, during reception, and post-reception; the pre-reception period is from day 1 to day 5 after the luteinizing hormone peak appears, the during reception period is from day 6 to day 7 after the luteinizing hormone peak appears, and the post-reception period is from day 8 to day 11 after the luteinizing hormone peak appears;

[0024] The analysis module is used to perform the following:

[0025] The receptivity of the endometrium can be determined by the expression level or expression pattern of the biomarker miRNA in plasma during the three stages of pre-receptivity, during-receptivity, and post-receptivity.

[0026] Preferably, the criterion for determining whether the endometrium is receptive is to meet any one of the following:

[0027] (1) Judgment based on the expression level of markers: Construct a prediction model with the input being the miRNA expression level in plasma samples and the output being three probability values ​​between 0 and 1 with a sum of 1, representing the probability that the plasma sample is in the pre-receptive, mid-receptive, or post-receptive stage of the endometrium. The largest number represents the highest probability. The largest of the three numbers is used to define the stage of the sample. If the sample is in the mid-receptive stage, it is judged that the endometrium is receptive. If the sample is in the pre-receptive or post-receptive stage, it is judged that the endometrium is non-receptive. (The core of converting expression level into probability is calculated by the Softmax function: The logistic regression model first uses the weights and biases learned during the training phase for the three categories of pre-receptive, mid-receptive, or post-receptive to linearly combine the input and calculate an original score for each category. The score reflects the degree of matching between the input feature and the category pattern. Then, these scores are substituted into the Softmax function—that is, the exponent of each score is taken to ensure that it is positive, and then divided by the sum of the exponent scores of all categories to achieve normalization, thereby calculating the specific probability of each category.)

[0028] In this invention, a subset of miRNAs with the most valuable and relevant features for predicting the target variable is selected through feature selection, and an artificial intelligence model of plasma miRNA expression levels at specific time points during the peri-implantation period of patients with successful embryo transfer is constructed. For example, representative miRNAs belonging to each day from the day of ovulation to the ninth day after ovulation are selected. Commonly used methods include filtering methods (variance selection, chi-square test, correlation coefficient, mutual information method, F test, etc.), wrapping methods (forward selection, backward elimination, recursive feature elimination, bidirectional search, etc.), and embedding methods (L1 regularization, SHAP-based feature contribution value method). In the process of constructing the prediction model, classic machine learning algorithms such as logistic regression, random forest, support vector machine, and generalized linear model can be used. A three-class classification model for pre-implantation, during-implantation, and post-implantation is constructed using a logistic regression machine learning model, and the model performance is evaluated. After the model is constructed, plasma can be collected during the peri-implantation period. For example, plasma miRNAs can be sequenced on the fifth day after ovulation (usually 1 / 2 days after the LH peak under physiological conditions). The expression level of miRNAs can be input into the model to calculate the probability of pre-receptivity, during-receptivity and post-receptivity, so as to better determine the endometrial receptivity status at the molecular level.

[0029] (2) Judgment based on expression pattern: When the number of markers that meet the same expression pattern in all four expression patterns is greater than 60%, the endometrium is judged to be receptive.

[0030] The four expression modes are as follows:

[0031] (a)Markers of the gradually decreasing expression pattern: hsa-miR-1290, hsa-miR-346, hsa-miR-146b-3p, hsa-miR-455-5p, hsa-miR-449c-5p, hsa-miR-483-3p, hsa-miR-155-5p, hsa-miR-455-3p, hsa-miR-449a, hsa-miR-30d-5p, hsa-let-7d-5p, hsa-miR-206, hsa-miR-548b-3p, hsa-miR-146b-5p, hsa-miR-30d-3p, hsa-miR-675-5p, hsa-miR-28-3p, hsa-miR-409-3p, hsa-miR-1255a, hsa-miR-99a-3p, hsa-miR-133a-3p, hsa-miR-1-3p, hsa-miR-665, hsa-miR-4485-3p, hsa-miR-152-3p, hsa-miR-6500-3p, hsa-miR-483-5p, hsa-miR-196a-5p, hsa-miR-152-5p, hsa-miR-485-5p, and hsa-miR-27b-3p;

[0032] (b)Markers with a gradually increasing expression pattern: hsa-miR-511-3p, hsa-miR-371b-5p, hsa-miR-27a-5p, hsa-miR-223-3p, hsa-miR-326, hsa-miR-424-5p, hsa-miR-3690, hsa-miR-142-3p, hsa-miR-1298-5p, hsa-miR-424-3p, hsa-miR-548ad-5p, hsa-miR-193a-3p, hsa-let-7g-3p, hsa-miR-3133, hsa-miR-92b-3p, hsa-miR-509-3-5p, hsa-miR-142-5p, hsa-miR-551a, hsa-miR-210-3p, hsa-miR-514a-3p, hsa-miR-509-3p, hsa-miR-101-3p, hsa-miR-550a-3p, hsa-miR-144-3p, hsa-miR-1277-3p, hsa-miR-136-5p, hsa-miR-381-3p, hsa-miR-548ay-5p, hsa-miR-127-5p, hsa-miR-196b-3p, hsa-miR-199b-3p, hsa-miR-199a-3p, hsa-miR-548d-5p, hsa-miR-548ae-5p, hsa-miR-143-5p, hsa-miR-627-3p, hsa-miR-542-3p, hsa-miR-3613-3p, hsa-miR-339-3p, hsa-miR-582-5p, hsa-miR-374b-3p, and hsa-miR-576-5p;

[0033] (c) Markers of an initial increase followed by a decrease in expression levels: hsa-miR-34c-5p, hsa-miR-942-5p, hsa-miR-7976, hsa-miR-503-5p, hsa-miR-153-3p, hsa-miR-106b-3p, hsa-miR-1224-5p, hsa-miR-1180-3p, hsa-miR-183-3p, hsa-miR-509-5p, hsa-miR-31-3p, hsa-miR-3200-3p , hsa-miR-409-5p, hsa-miR-4474-3p, hsa-miR-4732-3p, hsa-miR-15b-3p, hsa-miR-127-3p, hsa-miR-654-5p, hsa-m iR-134-5p, hsa-miR-214-3p, hsa-miR-451a, hsa-miR-3940-3p, hsa-miR-25-3p, hsa-miR-1249-3p and hsa-miR-668-3p;

[0034] (d) Markers of the expression level decreasing then increasing pattern: hsa-miR-1246, hsa-miR-887-3p, hsa-miR-874-3p, hsa-miR-181a-3p, hsa-miR-873-3p, hsa-miR-4772-3p, hsa-miR-223-5p, hsa-miR-193a-5p, hsa-miR-135a-5p, hsa-miR-671-5p, hsa-miR-708-5p, hsa-miR-452-5p, hsa-miR-335-5p, hsa-miR-212-3p, hsa-miR-23a-5p, hsa-miR-653-3p, hsa-miR-877-5p, hsa-miR-21-5p, hsa-miR-27a -3p, hsa-miR-190a-5p, hsa-miR-150-5p, hsa-miR-146a-5p, hsa-miR-33a-5p, hsa-miR-489-3p, hsa-miR-138-5p, hsa- miR-217-5p, hsa-miR-615-3p, hsa-miR-1185-2-3p, hsa-miR-30b-5p, hsa-miR-9-5p, hsa-miR-577, hsa-miR-487a-3p , hsa-miR-377-3p, hsa-miR-494-3p, hsa-miR-345-5p, hsa-miR-136-3p, hsa-miR-214-5p, hsa-miR-656-3p, hsa-miR-3 37-5p, hsa-miR-195-5p, hsa-miR-126-5p, hsa-miR-410-3p, hsa-miR-195-3p, hsa-miR-5683, hsa-miR-497-5p, hsa-mi R-126-3p, hsa-miR-143-3p, hsa-miR-145-3p, hsa-miR-145-5p, hsa-miR-29a-3p, hsa-miR-619-5p and hsa-miR-378a-5p.

[0035] In a seventh aspect, the present invention provides the application of the apparatus for analyzing endometrial receptivity as described in the sixth aspect in the preparation of products for analyzing the peri-implantation window of the endometrium.

[0036] Compared with the prior art, the present invention has the following beneficial effects:

[0037] (1) The present invention performs principal component analysis on plasma miRNA, endometrial tissue miRNA and uterine fluid miRNA and finds that plasma miRNA and endometrial tissue miRNA have a high degree of similarity in expression patterns, thus ruling out the possibility of other non-invasive methods such as uterine fluid replacing endometrial biopsy.

[0038] (2) This invention collects endometrial tissue and peripheral blood samples from women with successfully implanted embryos during the peri-implantation window for miRNA sequencing and quantitative analysis. The detection of the peri-implantation miRNA profile of the samples demonstrates that there is a high degree of consistency in the miRNA expression levels of the two types of samples.

[0039] (3) The present invention further screened differentially expressed miRNAs in tissues and plasma during the peri-implantation window, and took their intersection as important miRNAs. These miRNAs are important evidence for non-invasive peripheral blood markers and have greater potential for clinical translation.

[0040] (4) This invention compares and analyzes the consistency / inconsistency of expression patterns of important miRNAs in tissues and plasma, and performs correlation analysis between the screened biomarker miRNAs and the patient's clinical baseline data and hormone indicators, indicating that the biomarkers of this invention participate in the preparation process of endometrium.

[0041] (5) This invention compared the expression levels and patterns of miRNAs in women with successful embryo implantation and those with implantation failure, and found that there were differences in the expression levels and patterns of miRNAs, highlighting the importance and necessity of detecting the biomarkers described in this invention in embryo transfer patients during the peri-implantation window. Attached Figure Description

[0042] Figure 1 This is a schematic diagram of the miRNA collection process in Embodiment 1 of the present invention;

[0043] Figure 2 Figure 1 shows the results of dimensionality reduction analysis of miRNA expression in tissue, plasma, and uterine fluid samples.

[0044] Figure 3 Intersection diagram of differentially expressed miRNAs in tissue and plasma samples;

[0045] Figure 4 This is a profile of miRNA expression in plasma and tissues during the peri-implantation period;

[0046] Figure 5 A graph showing the correlation between miRNAs and patients' clinical indications;

[0047] Figure 6 A diagram showing miRNA expression patterns in successful and failed embryo transfer groups;

[0048] Figure 7The training result image for the training set;

[0049] Figure 8 This is a graph showing the training results for the test set. Detailed Implementation

[0050] To further illustrate the technical means and effects of this invention, the following description, in conjunction with embodiments and accompanying drawings, provides a further explanation of the invention. It is understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it.

[0051] Where specific techniques or conditions are not specified in the examples, they shall be performed in accordance with the techniques or conditions described in the literature in this field, or in accordance with the product instructions. Reagents or instruments whose manufacturers are not specified are all conventional products that can be purchased through legitimate channels.

[0052] This invention was funded by the National Key Research and Development Program of China (2024YFC2706900), and the project title is: Research on Early Identification and Precision Prevention and Control Technology for Impaired Fertility in Population.

[0053] Example 1

[0054] This embodiment screens for biomarkers related to the peri-implantation window of the endometrium.

[0055] In this embodiment, principal component analysis (PCA) was first performed on plasma miRNA data and miRNAs from endometrial tissue and uterine fluid. Figure 1 The clustering of plasma and tissue miRNA samples indicates that plasma miRNAs and endometrial tissue miRNAs have a high degree of similarity in expression patterns, while they differ significantly from uterine fluid in terms of principal component direction. This demonstrates that there is a high degree of consistency in the expression levels of miRNAs in endometrial tissue and plasma.

[0056] In this embodiment, endometrial tissue and peripheral blood samples were collected on the same day during the periimplantation period from patients whose embryos had successfully implanted. The collection procedure is as follows: Figure 2As shown in the figure. Tissue samples were placed in RNAlater solution and stored at -80℃. Peripheral blood samples required pretreatment to obtain plasma before storage at -80℃. After all samples were collected, miRNA was extracted, library constructed, and sequenced. To improve the integrity of sequencing data, a multi-step preprocessing workflow was adopted. First, adapter sequences and sequences containing 3 or more NNN nucleotides were deleted. Next, sequences with A, T, C, or G homopolymer fragments, quality scores below 10, and sequences with a post-adaptor length of less than 18 nt were deleted, and deduplication was performed. Then, the deduplicated sequences were mapped to the Rfam database to obtain valid sequences. The valid sequences were compared with the human reference genome (hg38) for sequencing data standardization and quantification. The results are shown in Table 1.

[0057] Table 1

[0058]

[0059] Table 1 shows that 2656 miRNAs were detected in both endometrial tissue and plasma, with a concordance rate of 100%. The miRNAs were sorted according to their expression levels, with the TOP100 referring to the top 100 miRNAs with the highest expression levels. Among these, 74 miRNAs were identical between tissue and plasma, representing a concordance rate of 74.0%. Similarly, the concordance rates were as follows: TOP200 (73.5%), TOP300 (75.7%), TOP400 (76.5%), and TOP500 (75.8%).

[0060] Based on the above research, this invention performs differential expression analysis on miRNAs in the peri-implantation window tissues and plasma of patients with successful embryo transfer, screens differentially expressed miRNAs, and uses the Benjamin-Hockberg method (BH method) for multiple hypothesis testing to correct p-values. Figure 3As shown, differential expression analysis of tissue miRNAs from patients with successful embryo transfer was performed on any two days after the luteinizing hormone peak (days 1-9, 3-5, 7-9, p < 0.05), identifying 301 differentially expressed miRNAs. Differential expression analysis of plasma miRNAs on any two days after the luteinizing hormone peak (days 1-9, 3-5, 7-7, 8-9, p < 0.05) identified 560 differentially expressed miRNAs. The intersection of these two types yielded 150 miRNAs. These miRNAs are important indicators of non-invasive peripheral blood biomarkers and have significant clinical translational potential. The 150 miRNAs are hsa-miR-1290, hsa-miR-511-3p, hsa-miR-1246, hsa-miR-371b-5p, hsa-miR-887-3p, hsa-miR -874-3p, hsa-miR-181a-3p, hsa-miR-873-3p, hsa-miR-4772-3p, hsa-miR-223-5p, hsa-miR-27a-5p, hsa-miR- 223-3p, hsa-miR-193a-5p, hsa-miR-346, hsa-miR-146b-3p, hsa-miR-455-5p, hsa-miR-135a-5p, hsa-miR-671 -5p, hsa-miR-34c-5p, hsa-miR-449c-5p, hsa-miR-483-3p, hsa-miR-326, hsa-miR-155-5p, hsa-miR-455-3p, h sa-miR-424-5p, hsa-miR-708-5p, hsa-miR-3690, hsa-miR-942-5p, hsa-miR-142-3p, hsa-miR-7976, hsa-miR- 503-5p, hsa-miR-1298-5p, hsa-miR-153-3p, hsa-miR-424-3p, hsa-miR-548ad-5p, hsa-miR-452-5p, hsa-miR- 335-5p, hsa-miR-106b-3p, hsa-miR-193a-3p, hsa-miR-1224-5p, hsa-let-7g-3p, hsa-miR-212-3p, hsa-miR-2 3a-5p, hsa-miR-449a, hsa-miR-3133, hsa-miR-653-3p, hsa-miR-1180-3p, hsa-miR-183-3p, hsa-miR-30d-5p,hsa-let-7d-5p, hsa-miR-92b-3p, hsa-miR-877-5p, hsa-miR-21-5p, hsa-miR-27a-3p, hsa-miR-509-3-5p, hsa-miR-206, hsa-miR-509-5p, hsa-miR-190a-5p, hsa-miR-150-5p, hsa-miR-146a-5p, hsa-miR-142-5p, hsa-miR-551a, hsa-miR-33a-5p, hsa-miR-210-3p, hsa-miR-489-3p, hsa-miR-514 a-3p, hsa-miR-548b-3p, hsa-miR-31-3p, hsa-miR-138-5p, hsa-miR-146b-5p, hsa-miR-3200-3p, hsa-miR-509-3p, hsa-miR-217-5p, hsa-miR-615- 3p, hsa-miR-101-3p, hsa-miR-1185-2-3p, hsa-miR-30d-3p, hsa-miR-30b-5p, hsa-miR-9-5p, hsa-miR-675-5p, hsa-miR-409-5p, hsa-miR-550a-3p hsa-miR-28-3p hsa-miR-577 hsa-miR-409-3p hsa-miR-487a-3p hsa-miR-1255a hsa-miR-144-3p hsa-miR-99a-3p hsa-miR-4474-3p hsa-mi R-133a-3p, hsa-miR-4732-3p, hsa-miR-15b-3p, hsa-miR-1-3p, hsa-miR-377-3p, hsa-miR-1277-3p, hsa-miR-136-5p, hsa-miR-381-3p, hsa-miR-6 65, hsa-miR-4485-3p, hsa-miR-494-3p, hsa-miR-345-5p, hsa-miR-548ay-5p, hsa-miR-127-3p, hsa-miR-136-3p, hsa-miR-127-5p, hsa-miR-196b- 3p, hsa-miR-199b-3p, hsa-miR-199a-3p, hsa-miR-214-5p, hsa-miR-656-3p, hsa-miR-654-5p, hsa-miR-337-5p, hsa-miR-152-3p, hsa-miR-195-5phsa-miR-126-5p, hsa-miR-410-3p, hsa-miR-548d-5p, hsa-miR-195-3p, hsa-miR-134-5p, hsa-miR-5683, hsa-miR-497-5p, hsa-miR-6500-3p, hsa-miR-548a e-5p, hsa-miR-143-5p, hsa-miR-214-3p, hsa-miR-126-3p, hsa-miR-451a, hsa-miR-483-5p, hsa-miR-3940-3p, hsa-miR-143-3p, hsa-miR-25-3p, hsa-miR-19 6a-5p, hsa-miR-152-5p, hsa-miR-485-5p, hsa-miR-145-3p, hsa-miR-1249-3p, hsa-miR-145-5p, hsa-miR-627-3p, hsa-miR-542-3p, hsa-miR-29a-3p, hsa-m iR-668-3p, hsa-miR-27b-3p, hsa-miR-619-5p, hsa-miR-3613-3p, hsa-miR-37 8a-5p, hsa-miR-339-3p, hsa-miR-582-5p, hsa-miR-374b-3p and hsa-miR-576-5p. ,

[0061] The nucleic acid sequences of these miRNAs are shown in SEQ ID NO.1-SEQ ID NO.150.

[0062] The sequence of hsa-let-7d-5p is SEQ ID NO.1: AGAGGUAGUAGGUUGCAUAGUU.

[0063] The sequence of hsa-let-7g-3p is SEQ ID NO.2: CUGUACAGGCCACUGCCUUGC.

[0064] The sequence of hsa-miR-101-3p is SEQ ID NO.3: UACAGUACUGUGAUAACUGAA.

[0065] The sequence of hsa-miR-106b-3p is SEQ ID NO.4: CCGCACUGUGGGUACUUGCUGC.

[0066] The sequence of hsa-miR-1180-3p is SEQ ID NO.5: UUUCCGGCUCGCGUGGGUGUGU.

[0067] The sequence of hsa-miR-1185-2-3p is SEQ ID NO.6: AUAUACAGGGGGAGACUCUCAU.

[0068] The sequence of hsa-miR-1224-5p is SEQ ID NO.7: GUGAGGACUCGGGAGGUGG.

[0069] The sequence of hsa-miR-1246 is SEQ ID NO.8: AAUGGAUUUUUGGAGCAGG.

[0070] The sequence of hsa-miR-1249-3p is SEQ ID NO.9: ACGCCCUUCCCCCCCUUCUUCA.

[0071] The sequence of hsa-miR-1255a is SEQ ID NO.10: AGGAUGAGCAAAGAAAGUAGAUU.

[0072] The sequence of hsa-miR-126-3p is SEQ ID NO.11: UCGUACCGUGAGUAAUAAUGCG.

[0073] The sequence of hsa-miR-126-5p is SEQ ID NO.12: CAUUAUUACUUUUGGUACGCG.

[0074] The sequence of hsa-miR-127-3p is SEQ ID NO.13: UCGGAUCCGUCUGAGCUUGGCU.

[0075] The sequence of hsa-miR-127-5p is SEQ ID NO.14: CUGAAGCUCAGAGGGCUCUGAU.

[0076] The sequence of hsa-miR-1277-3p is SEQ ID NO.15: UACGAGAUAUAUAUGUAUUUU.

[0077] The sequence of hsa-miR-1290 is SEQ ID NO. 16: UGGAUUUUUGGAUCAGGGA.

[0078] The sequence of hsa-miR-1298-5p is SEQ ID NO.17: UUCAUUCGGCUGUCCAGAUGUA.

[0079] The sequence of hsa-miR-133a-3p is SEQ ID NO.18: UUUGGUCCCCUUCAACCAGCUG.

[0080] The sequence of hsa-miR-134-5p is SEQ ID NO. 19: UGUGACUGGUUGACCAGAGGGG.

[0081] The sequence of hsa-miR-135a-5p is SEQ ID NO. 20: UAUGGCUUUUUAUUCCU AUGUGA.

[0082] The sequence of hsa-miR-136-3p is SEQ ID NO.21: CAUCAUCGUCUCAAAUGAGUCU.

[0083] The sequence of hsa-miR-136-5p is SEQ ID NO. 22: ACUCCAUUUGUUUUGAUG AUGGA.

[0084] The sequence of hsa-miR-138-5p is SEQ ID NO.23: AGCUGGUGUUGUGAAUCA GGCCG.

[0085] The sequence of hsa-miR-1-3p is SEQ ID NO.24: UGGAAUGUAAAGAAGUAUGUAU.

[0086] The sequence of hsa-miR-142-3p is SEQ ID NO.25: UGUAGUGUUUCCUACUUUA UGGA.

[0087] The sequence of hsa-miR-142-5p is SEQ ID NO.26: CAUAAAGUAGAAAGCACUACU.

[0088] The sequence of hsa-miR-143-3p is SEQ ID NO.27: UGAGAUGAAGCACUGUAGCUC.

[0089] The sequence of hsa-miR-143-5p is SEQ ID NO.28: GGUGCAGUGCUGCAUCUCUGGU.

[0090] The sequence of hsa-miR-144-3p is SEQ ID NO.29: UACAGUAUAGAUGAUGUACU.

[0091] The sequence of hsa-miR-145-3p is SEQ ID NO.30: GGAUUCCUGGAAAUACUGUUCU.

[0092] The sequence of hsa-miR-145-5p is SEQ ID NO. 31: GUCCAGUUUUCCCAGGAAUCCCU.

[0093] The sequence of hsa-miR-146a-5p is SEQ ID NO.32: UGAGAACUGAAUUCCAUGGGUU.

[0094] The sequence of hsa-miR-146b-3p is SEQ ID NO.33: GCCUGUGGACUCAGUUCUGGU.

[0095] The sequence of hsa-miR-146b-5p is SEQ ID NO.34: UGAGAACUGAAUUCCAUAG GCUG.

[0096] The sequence of hsa-miR-150-5p is SEQ ID NO.35: UCUCCCAACCCUUGUACCAGUG.

[0097] The sequence of hsa-miR-152-3p is SEQ ID NO.36: UCAGUGCAUGACAGAACUUGG.

[0098] The sequence of hsa-miR-152-5p is SEQ ID NO.37: AGGUUCUGUGAUACACUCCGACU.

[0099] The sequence of hsa-miR-153-3p is SEQ ID NO.38: UUGCAUAGUCACAAAAGUGAUC.

[0100] The sequence of hsa-miR-155-5p is SEQ ID NO.39: UUAAUGCUAAUCGUGAUAGGGGUU.

[0101] The sequence of hsa-miR-15b-3p is SEQ ID NO.40: CGAAUCAUUAUUUGCUGCUCUA.

[0102] The sequence of hsa-miR-181a-3p is SEQ ID NO.41: ACCAUGCGACCGUUGAUUGUACC.

[0103] The sequence of hsa-miR-183-3p is SEQ ID NO.42: GUGAAUUACCGAAGGGCCAUAA.

[0104] The sequence of hsa-miR-190a-5p is SEQ ID NO.43: UGAUAUGUUUGAUAUAUUAGGU.

[0105] The sequence of hsa-miR-193a-3p is SEQ ID NO.44: AACUGGCCUACAAAGUCCCAGU.

[0106] The sequence of hsa-miR-193a-5p is SEQ ID NO. 45: UGGGUCUUUGCGGGCGA GAUGA.

[0107] The sequence of hsa-miR-195-3p is SEQ ID NO.46: CCAAUAUUGGCUGUGCUGCUCC.

[0108] The sequence of hsa-miR-195-5p is SEQ ID NO.47: UAGCAGCACAGAAAUAUUGGC.

[0109] The sequence of hsa-miR-196a-5p is SEQ ID NO.48: UAGGUAGUUUCAUGUU GUUGGG.

[0110] The sequence of hsa-miR-196b-3p is SEQ ID NO.49: UCGACAGCACGACACUGCCUUC.

[0111] The sequence of hsa-miR-199a-3p is SEQ ID NO.50: ACAGUAGUCUGCACAUUG GUUA.

[0112] The sequence of hsa-miR-199b-3p is SEQ ID NO.51: ACAGUAGUCUGCACAUUGGUUA.

[0113] The sequence of hsa-miR-206 is SEQ ID NO. 52: UGGAAUGUAAGGAAGUGUGUGG.

[0114] The sequence of hsa-miR-210-3p is SEQ ID NO.53: CUGUGCGUGUGACAGCGGCUGA.

[0115] The sequence of hsa-miR-212-3p is SEQ ID NO.54: UAACAGUCUCCAGUCACGGCC.

[0116] The sequence of hsa-miR-214-3p is SEQ ID NO. 55: ACAGCAGGCACAGACAGGCAGU.

[0117] The sequence of hsa-miR-214-5p is SEQ ID NO.56: UGCCUGUCUACACUUGCUGUGC.

[0118] The sequence of hsa-miR-21-5p is SEQ ID NO.57: UAGCUUAUCAGACUGAUGUUGA.

[0119] The sequence of hsa-miR-217-5p is SEQ ID NO.58: UACUGCAUCAGGAACUGAUUGGA.

[0120] The sequence of hsa-miR-223-3p is SEQ ID NO.59: UGUCAGUUUGUCAAAUACCCCA.

[0121] The sequence of hsa-miR-223-5p is SEQ ID NO.60: CGUGUAUUUGACAAGCUGAGUU.

[0122] The sequence of hsa-miR-23a-5p is SEQ ID NO. 61: GGGGUUCCUGGGAUGGGAUUU.

[0123] The sequence of hsa-miR-25-3p is SEQ ID NO.62: CAUUGCACUUGUCUCGGUCUGA.

[0124] The sequence of hsa-miR-27a-3p is SEQ ID NO.63: UUCACAGUGGCUAAGUUCCGC.

[0125] The sequence of hsa-miR-27a-5p is SEQ ID NO.64: AGGGCUUAGCUGCUUGUGAGCA.

[0126] The sequence of hsa-miR-27b-3p is SEQ ID NO.65: UUCACAGUGGCUAAGUUCUGC.

[0127] The sequence of hsa-miR-28-3p is SEQ ID NO.66: CACUAGAUUGUGAGCUCCUGGA.

[0128] The sequence of hsa-miR-29a-3p is SEQ ID NO.67: UAGCCACCAUCUGAAAUCGGUUA.

[0129] The sequence of hsa-miR-30b-5p is SEQ ID NO.68: UUGUAAACAUCCUACACUCAGCU.

[0130] The sequence of hsa-miR-30d-3p is SEQ ID NO.69: CUUUCAGUCAGAUGUUUGCUGC.

[0131] The sequence of hsa-miR-30d-5p is SEQ ID NO.70: UUGUAAACAUCCCCGACUGGAAG.

[0132] The sequence of hsa-miR-3133 is SEQ ID NO.71: UAAAGAACUCUUAAAACCCAAU.

[0133] The sequence of hsa-miR-31-3p is SEQ ID NO.72: UGCUAUGCCAACAUAUUGCCAU.

[0134] The sequence of hsa-miR-3200-3p is SEQ ID NO.73: CACCUUGCGCUACUCAGGUCUG.

[0135] The sequence of hsa-miR-326 is SEQ ID NO.74: CCUCUGGGCCCUUCCUCCAG.

[0136] The sequence of hsa-miR-335-5p is SEQ ID NO.75: UCAAGAGCAAUAACGAAAAAUGU.

[0137] The sequence of hsa-miR-337-5p is SEQ ID NO.76: GAACGGCUUCAUACAGGAGUU.

[0138] The sequence of hsa-miR-339-3p is SEQ ID NO.77: UGAGCGCCUCGACGACAGAGCCG.

[0139] The sequence of hsa-miR-33a-5p is SEQ ID NO.78: GUGCAUUGUAGUUGCAUUGCA.

[0140] The sequence of hsa-miR-345-5p is SEQ ID NO.79: GCGACUCCUAGUCCAGGGCUC.

[0141] The sequence of hsa-miR-346 is SEQ ID NO.80: UGUCUGCCCGCAUGCCUGCCUCU.

[0142] The sequence of hsa-miR-34c-5p is SEQ ID NO.81: AGGCAGUGUAGUUAGCUG AUUGC.

[0143] The sequence of hsa-miR-3613-3p is SEQ ID NO.82: ACAAAAAAAAAAGCCCAACCCUUC.

[0144] The sequence of hsa-miR-3690 is SEQ ID NO.83: ACCUGACCCAGCGUAGACAAAG.

[0145] The sequence of hsa-miR-371b-5p is SEQ ID NO.84: ACUCAAAAGAUGGCGGCACUUU.

[0146] The sequence of hsa-miR-374b-3p is SEQ ID NO.85: CUUAGCAGGUUGUAUUAUCAUU.

[0147] The sequence of hsa-miR-377-3p is SEQ ID NO.86: AUCACACAAAGGCAACUUUUGU.

[0148] The sequence of hsa-miR-378a-5p is SEQ ID NO.87: CUCCUGACUCCAGGUCCUGUGU.

[0149] The sequence of hsa-miR-381-3p is SEQ ID NO.88: UUACAAGGGCAAGCUCUCUGU.

[0150] The sequence of hsa-miR-3940-3p is SEQ ID NO.89: CAGCCCGGAUCCCAGCCCACUU.

[0151] The sequence of hsa-miR-409-3p is SEQ ID NO.90: GAAUGUUGCUCGGUGAACCCCU.

[0152] The sequence of hsa-miR-409-5p is SEQ ID NO.91: AGGUUACCCGAGCAACUUUGCAU.

[0153] The sequence of hsa-miR-410-3p is SEQ ID NO.92: AAUAUAACACAGAUGGCCUGU.

[0154] The sequence of hsa-miR-424-3p is SEQ ID NO.93: CAAAACGUGAGGCGCUGCUAU.

[0155] The sequence of hsa-miR-424-5p is SEQ ID NO.94: CAGCAGCAAUUCAUGUUUUGAA.

[0156] The sequence of hsa-miR-4474-3p is SEQ ID NO.95: UUGUGGCUGGUCAUGAGGC UAA.

[0157] The sequence of hsa-miR-4485-3p is SEQ ID NO.96: UACGGCCGCGGUACCCUAA.

[0158] The sequence of hsa-miR-449a is SEQ ID NO.97: UGGCAGUGUAUUGUUAGCUGGU.

[0159] The sequence of hsa-miR-449c-5p is SEQ ID NO.98: UAGGCAGUGUAUUGCUAG CGGCUGU.

[0160] The sequence of hsa-miR-451a is SEQ ID NO.99: AAACCGUUACCAUUACUGAGUU.

[0161] The sequence of hsa-miR-452-5p is SEQ ID NO. 100: AACUGUUUGCAGAGGAAA CUGA.

[0162] The sequence of hsa-miR-455-3p is SEQ ID NO.101: GCAGUCCAUGGGCAUAUACAC.

[0163] The sequence of hsa-miR-455-5p is SEQ ID NO.102: UAUUGUGCCUUUGGACUACA UCG.

[0164] The sequence of hsa-miR-4732-3p, SEQ ID NO.103: GCCCUGACCUGUCCUGUUCUG.

[0165] The sequence of hsa-miR-4772-3p, SEQ ID NO.104: CCUGCAACUUUGCCUGA UCAGA.

[0166] The sequence of hsa-miR-483-3p, SEQ ID NO.105: UCACUCCUCUCCUCCCGUCUU.

[0167] The sequence of hsa-miR-483-5p, SEQ ID NO.106: AAGACGGGAGGAAAGAAGGGAG.

[0168] The sequence of hsa-miR-485-5p, SEQ ID NO.107: AGAGGCUGGCCGUGAUGAAUUC.

[0169] The sequence of hsa-miR-487a-3p, SEQ ID NO.108: AAUCAUACAGGGACAUCCAGUU.

[0170] The sequence of hsa-miR-489-3p, SEQ ID NO.109: GUGACAUCACAUAUACG GCAGC.

[0171] The sequence of hsa-miR-494-3p, SEQ ID NO.110: UGAAACAUACACGGGAA ACCUC.

[0172] The sequence of hsa-miR-497-5p, SEQ ID NO.111: CAGCAGCACACUGUGGUUUGU.

[0173] The sequence of hsa-miR-503-5p, SEQ ID NO.112: UAGCAGCGGGAACAGUUCU GCAG.

[0174] The sequence of hsa-miR-509-3-5p, SEQ ID NO.113: UACUGCAGACGUGGCAAU CAUG.

[0175] The sequence of hsa-miR-509-3p, SEQ ID NO.114: UGAUUGGUACGUCUGUGG GUAG.

[0176] The sequence of hsa-miR-509-5p is SEQ ID NO.115: UACUGCAGACAGUGGCAAUCA.

[0177] The sequence of hsa-miR-511-3p is SEQ ID NO.116: AAUGUGUAGCAAAAGACAGA.

[0178] The sequence of hsa-miR-514a-3p is SEQ ID NO.117: AUGACACUUCUGUGAGUAGA.

[0179] The sequence of hsa-miR-542-3p is SEQ ID NO.118: UGUGACAGAUUGAUAACUGAAA.

[0180] The sequence of hsa-miR-548ad-5p is SEQ ID NO.119: AAAAGUAAUUGUGGUUUUUG.

[0181] The sequence of hsa-miR-548ae-5p is SEQ ID NO.120: AAAAGUAAUUGUGGUUUUUG.

[0182] The sequence of hsa-miR-548ay-5p is SEQ ID NO.121: AAAAGUAAUUGUGGUUUUUGC.

[0183] The sequence of hsa-miR-548b-3p is SEQ ID NO.122: CAAGAACCUCAGUUGCUUUUGU.

[0184] The sequence of hsa-miR-548d-5p is SEQ ID NO.123: AAAAGUAAUUGUGGUUUUUGCC.

[0185] The sequence of hsa-miR-550a-3p is SEQ ID NO.124: UGUCUUACUCCCUCAGGCACAU.

[0186] The sequence of hsa-miR-551a is SEQ ID NO. 125: GCGACCCACUCUUGGUUUCCA.

[0187] The sequence of hsa-miR-5683 is SEQ ID NO.126: UACAGAUGCAGAUUCUCU GACUUC.

[0188] The sequence of hsa-miR-576-5p is SEQ ID NO.127: AUUCUAAUUUCUCCACGUCUUU.

[0189] The sequence of hsa-miR-577 is SEQ ID NO.128: UAGAUAAAAUAUUGGUACCUG.

[0190] The sequence of hsa-miR-582-5p is SEQ ID NO.129: UUACAGUUGUUCAACCAGUUACU.

[0191] The sequence of hsa-miR-615-3p is SEQ ID NO.130: UCCGAGCCUGGGUCUCCCUCUU.

[0192] The sequence of hsa-miR-619-5p is SEQ ID NO.131: GCUGGAUUACAGGCAUGAGCC.

[0193] The sequence of hsa-miR-627-3p is SEQ ID NO.132: UCUUUUCUUUGAGACUCACU.

[0194] The sequence of hsa-miR-6500-3p is SEQ ID NO.133: ACACUUGUUGGGAUGACCUGC.

[0195] The sequence of hsa-miR-653-3p is SEQ ID NO.134: UUCACUGGAGUUUGUUUCAAUA.

[0196] The sequence of hsa-miR-654-5p is SEQ ID NO.135: UGGUGGGCCGCAGAACAUGUGC.

[0197] The sequence of hsa-miR-656-3p is SEQ ID NO.136: AAUAUUAUACAGUCAACCUCU.

[0198] The sequence of hsa-miR-665 is SEQ ID NO. 137: ACCAGGAGGCUGAGGCCCCU.

[0199] The sequence of hsa-miR-668-3p is SEQ ID NO.138: UGUCACUCGGCUCGGCCCACUAC.

[0200] The sequence of hsa-miR-671-5p is SEQ ID NO.139: AGGAAGCCCUGGAGGGGCUGGAG.

[0201] The sequence of hsa-miR-675-5p is SEQ ID NO. 140: UGGUGCGAGAGGGCCCACAGUG.

[0202] The sequence of hsa-miR-708-5p is SEQ ID NO.141: AAGGAGCUUACAAUCUAGCUGGG.

[0203] The sequence of hsa-miR-7976 is SEQ ID NO.142: UGCCCUGAGACUUUUGCUC.

[0204] The sequence of hsa-miR-873-3p is SEQ ID NO.143: GGAGACUGAUGAGUUCCC GGGA.

[0205] The sequence of hsa-miR-874-3p is SEQ ID NO.144: CUGCCCUGGCCCGAGGGACCGA.

[0206] The sequence of hsa-miR-877-5p is SEQ ID NO.145: GUAGAGGAGAUGGCGCAGGG.

[0207] The sequence of hsa-miR-887-3p is SEQ ID NO.146: GUGAACGGGCGCCAUCCCGAGG.

[0208] The sequence of hsa-miR-92b-3p is SEQ ID NO.147: UAUUGCACUCGUCCCGGCCUCC.

[0209] The sequence of hsa-miR-942-5p is SEQ ID NO.148: UCUUCUCUGUUUUGGCCAUGUG.

[0210] The sequence of hsa-miR-9-5p is SEQ ID NO.149: UCUUUGGUUAUCUAGCUGUAUGA.

[0211] The sequence of hsa-miR-99a-3p is SEQ ID NO.150: CAAGCUCGCUUCUAUGGGUCUG.

[0212] Example 2

[0213] This embodiment analyzes the expression patterns of miRNAs in the endometrial tissue and plasma of patients with successful embryo implantation during the peri-implantation window.

[0214] This invention uses differential analysis software to investigate the expression patterns of biomarkers screened in Example 1 in the endometrial tissue and plasma of 105 patients with successful embryo implantation during the peri-implantation window (pre-implantation, mid-implantation, and post-implantation). miRNAs with similar expression patterns were grouped into the same cluster, and the results are as follows: Figure 4As shown, plasma miRNAs exhibited four distinct expression patterns during the pre-receptor phase (day 3 after the luteinizing hormone peak), the mid-receptor phase (day 7 after the luteinizing hormone peak), and the post-receptor phase (day 9 after the luteinizing hormone peak). Expression pattern 1, characterized by a gradual decrease in expression levels, involved 31 miRNAs: hsa-miR-1290, hsa-miR-346, hsa-miR-146b-3p, hsa-miR-455-5p, hsa-miR-449c-5p, hsa-miR-483-3p, hsa-miR-155-5p, hsa-miR-455-3p, hsa-miR-449a, hsa-miR-30d-5p, hsa-let-7d-5p, hsa-miR-206, hsa-miR-548b-3p, hsa... -miR-146b-5p, hsa-miR-30d-3p, hsa-miR-675-5p, hsa-miR-28-3p, hsa-miR-409-3p, hsa- miR-1255a, hsa-miR-99a-3p, hsa-miR-133a-3p, hsa-miR-1-3p, hsa-miR-665, hsa-miR-448 The expression patterns were: hsa-miR-152-3p, hsa-miR-6500-3p, hsa-miR-483-5p, hsa-miR-196a-5p, hsa-miR-152-5p, hsa-miR-485-5p, and hsa-miR-27b-3p. Expression pattern 2 showed an initial increase followed by a decrease, with peak expression during the receptive phase, involving a total of 25 miRNAs.They are hsa-miR-34c-5p, hsa-miR-942-5p, hsa-miR-7976, hsa-miR-503-5p, hsa-miR-153-3p, hsa-miR-106b-3p, hsa-miR-12 24-5p, hsa-miR-1180-3p, hsa-miR-183-3p, hsa-miR-509-5p, hsa-miR-31-3p, hsa-miR-3200-3p, hsa-miR-409-5p, hsa-m The expression patterns included iR-4474-3p, hsa-miR-4732-3p, hsa-miR-15b-3p, hsa-miR-127-3p, hsa-miR-654-5p, hsa-miR-134-5p, hsa-miR-214-3p, hsa-miR-451a, hsa-miR-3940-3p, hsa-miR-25-3p, hsa-miR-1249-3p, and hsa-miR-668-3p; expression mode 3 showed an elevated expression pattern, involving a total of 42 miRNAs.They are hsa-miR-511-3p, hsa-miR-371b-5p, hsa-miR-27a-5p, hsa-miR-223-3p, hsa-miR-326, hsa-miR- 424-5p, hsa-miR-3690, hsa-miR-142-3p, hsa-miR-1298-5p, hsa-miR-424-3p, hsa-miR-548ad-5p, h sa-miR-193a-3p, hsa-let-7g-3p, hsa-miR-3133, hsa-miR-92b-3p, hsa-miR-509-3-5p, hsa-miR-14 2-5p, hsa-miR-551a, hsa-miR-210-3p, hsa-miR-514a-3p, hsa-miR-509-3p, hsa-miR-101-3p, hsa-m iR-550a-3p, hsa-miR-144-3p, hsa-miR-1277-3p, hsa-miR-136-5p, hsa-miR-381-3p, hsa-miR-548a y-5p, hsa-miR-127-5p, hsa-miR-196b-3p, hsa-miR-199b-3p, hsa-miR-199a-3p, hsa-miR-548d-5p, hsa-miR-548ae-5p, hsa-miR-143-5p, hsa-miR-627-3p, hsa-miR-542-3p, hsa-miR-3613-3p, hsa-miR-339-3p, hsa-miR-582-5p, hsa-miR-374b-3p, hsa-miR-576-5p; expression pattern 4 showed a pattern of initial decrease followed by increase, involving a total of 52 miRNAs.They are hsa-miR-1246, hsa-miR-887-3p, hsa-miR-874-3p, hsa-miR-181a-3p, hsa-miR-873-3p, hsa-miR-4772-3p, hsa-m iR-223-5p, hsa-miR-193a-5p, hsa-miR-135a-5p, hsa-miR-671-5p, hsa-miR-708-5p, hsa-miR-452-5p, hsa-miR-335 -5p, hsa-miR-212-3p, hsa-miR-23a-5p, hsa-miR-653-3p, hsa-miR-877-5p, hsa-miR-21-5p, hsa-miR-27a-3p, hsa-m iR-190a-5p, hsa-miR-150-5p, hsa-miR-146a-5p, hsa-miR-33a-5p, hsa-miR-489-3p, hsa-miR-138-5p, hsa-miR-217 -5p, hsa-miR-615-3p, hsa-miR-1185-2-3p, hsa-miR-30b-5p, hsa-miR-9-5p, hsa-miR-577, hsa-miR-487a-3p, hsa-m iR-377-3p, hsa-miR-494-3p, hsa-miR-345-5p, hsa-miR-136-3p, hsa-miR-214-5p, hsa-miR-656-3p, hsa-miR-337-5 p, hsa-miR-195-5p, hsa-miR-126-5p, hsa-miR-410-3p, hsa-miR-195-3p, hsa-miR-5683, hsa-miR-497-5p, hsa-miR-126-3p, hsa-miR-143-3p, hsa-miR-145-3p, hsa-miR-145-5p, hsa-miR-29a-3p, hsa-miR-619-5p, hsa-miR-378a-5p. Endometrial tissue miRNAs also exhibit four different expression patterns during pre-reception, mid-reception, and late-reception stages: Expression pattern 1 shows a gradually decreasing expression level, involving a total of 45 miRNAs.hsa-miR-887-3p, hsa-miR-874-3p, hsa-miR-346, hsa-miR-455-5p, hsa-miR-135a-5p, hsa-miR-671-5p, hsa-miR-449c-5p, hsa-miR-455-3p, hsa-miR-424-5p, hsa-miR-708-5p, hsa-miR-942-5p, hsa-miR-7976, hsa-miR-503-5p, hsa-miR-1298-5p, hsa-miR-153-3p, hsa-miR-424-3p, hsa-miR-335-5p, hsa-miR-106b-3p, hsa-miR-1224-5p, hsa-miR-3133, hsa-miR-653-3p, hsa-miR-1180-3p, hsa-miR-183-3p, hsa-let-7d-5p, hsa-miR-92b-3p, hsa-miR-877-5p, hsa-miR-509-3-5p, hsa-miR-509-5p, hsa-miR-489-3p, hsa-miR-514a-3p, hsa-miR-548b-3p, hsa-miR-138-5p, hsa-miR-3200-3p, hsa-miR-509-3p, hsa-miR-550a-3p, hsa-miR-577, hsa-miR-1255a, hsa-miR-144-3p, hsa-miR-4732-3p, hsa-miR-15b-3p, hsa-miR-4485-3p, hsa-miR-345-5p, hsa-miR-451a, hsa-miR-3940-3p, and hsa-miR-627-3p; Expression pattern 2 shows an increased expression pattern and involves a total of 42 miRNAs,hsa-miR-873-3p, hsa-miR-146b-3p, hsa-miR-483-3p, hsa-miR-452-5p, hsa-miR-30d-5p, hsa-miR-21-5p, hsa-miR-146b-5p, hsa-miR-217-5p, hsa-miR-615-3p, hsa-miR-101-3p, hsa-miR-1185-2-3p, hsa-miR-30d-3p, hsa-miR-30b-5p, hsa-miR-9-5p, hsa-miR-675-5p, hsa-miR-409-5p, hsa-miR-409-3p, hsa-miR-487a-3p, hsa-miR-1-3p, hsa-miR-377-3p, hsa-miR-1277-3p, hsa-miR-381-3p, hsa-miR-665, hsa-miR-494-3p, hsa-miR-127-3p, hsa-miR-136-3p, hsa-miR-127-5p, hsa-miR-214-5p, hsa-miR-654-5p, hsa-miR-337-5p, hsa-miR-152-3p, hsa-miR-195-5p, hsa-miR-126-5p, hsa-miR-195-3p, hsa-miR-134-5p, hsa-miR-5683, hsa-miR-497-5p, hsa-miR-126-3p, hsa-miR-152-5p, hsa-miR-485-5p, hsa-miR-668-3p, and hsa-miR-374b-3p; Expression pattern 3 shows a pattern of first increasing and then decreasing expression levels, involving a total of 42 miRNAs,hsa-miR-1290, hsa-miR-1246, hsa-miR-371b-5p, hsa-miR-181a-3p, hsa-miR-4772-3p, hsa-miR-223-5p, hsa-miR-27a-5p, hsa-miR-223-3p, hsa-miR-193a-5p, hsa-miR-326, hsa-miR-155-5p, hsa-miR-3690, hsa-miR-142-3p, hsa-miR-548ad-5p, hsa-miR-193a-3p, hsa-let-7g-3p, hsa-miR-212-3p, hsa-miR-23a-5p, hsa-miR-27a-3p, hsa-miR-206, hsa-miR-150-5p, hsa-miR-146a-5p, hsa-miR-142-5p, hsa-miR-551a, hsa-miR-210-3p, hsa-miR-31-3p, hsa-miR-28-3p, hsa-miR-99a-3p, hsa-miR-4474-3p, hsa-miR-133a-3p, hsa-miR-548ay-5p, hsa-miR-548d-5p, hsa-miR-548ae-5p, hsa-miR-25-3p, hsa-miR-1249-3p, hsa-miR-29a-3p, hsa-miR-619-5p, hsa-miR-3613-3p, hsa-miR-378a-5p, hsa-miR-339-3p, hsa-miR-582-5p and hsa-miR-576-5p; Expression pattern 4 shows a pattern of first decreasing and then increasing expression levels, and a total of 21 miRNAs are involved,hsa-miR-511-3p, hsa-miR-34c-5p, hsa-miR-449a, hsa-miR-190a-5p, hsa-miR-33a-5p, hsa-m iR-136-5p, hsa-miR-196b-3p, hsa-miR-199b-3p, hsa-miR-199a-3p, hsa-miR-656-3p, hsa-miR -410-3p, hsa-miR-6500-3p, hsa-miR-143-5p, hsa-miR-214-3p, hsa-miR-483-5p, hsa-miR-143 -3p, hsa-miR-196a-5p, hsa-miR-145-3p, hsa-miR-145-5p, hsa-miR-542-3p and hsa-miR-27b-3p. The expression patterns of the same miRNAs in endometrial tissue and plasma were compared one by one, and 24 miRNAs with completely consistent expression patterns in both endometrial tissue and plasma were finally screened. Specifically, the following were identified: 5 miRNAs showed an increasing expression pattern, including hsa-miR-101-3p, hsa-miR-1277-3p, hsa-miR-381-3p, hsa-miR-127-5p, and hsa-miR-374b-3p; and 8 miRNAs showed a decreasing expression pattern, including hsa-miR-346, hsa-miR-455-5p, hsa-miR-449c-5p, hsa-miR-455-3p, and hsa-let-7d-5p. The expression levels of four miRNAs, hsa-miR-548b-3p, hsa-miR-1255a, and hsa-miR-4485-3p, showed an initial increase followed by a decrease. Four miRNAs exhibited an expression pattern of first increasing and then decreasing, including hsa-miR-31-3p, hsa-miR-4474-3p, hsa-miR-25-3p, and hsa-miR-1249-3p. Seven miRNAs exhibited an expression pattern of first decreasing and then increasing, including hsa-miR-190a-5p, hsa-miR-33a-5p, hsa-miR-656-3p, hsa-miR-410-3p, hsa-miR-143-3p, hsa-miR-145-3p, and hsa-miR-145-5p.

[0215] Example 3

[0216] This embodiment performed Pearson correlation analysis on the 24 miRNAs screened in Example 2 and clinical indicators of patients with successful embryo transfer, including age, BMI (body mass index), follicle-stimulating hormone (FSH), luteinizing hormone (LH), estradiol (E2), prolactin (PRL), testosterone (T), anti-Müllerian hormone (AMH), antral follicle count (AFC), endometrial thickness on the day of ovulation (D0_ET), estradiol on the day of ovulation (D0_E2), and progesterone on the day of ovulation (D0_P). A correlation coefficient matrix was obtained and visualized (blue represents negative correlation, red represents positive correlation; the intensity of the color and the size of the circle are proportional to the strength of the correlation). Figure 5 As shown, 24 miRNAs exhibited varying degrees of positive / negative correlation with clinical indicators. For example, hsa-miR-145-5p showed a significant negative correlation with BMI, and hsa-miR-4474-3p showed a significant negative correlation with PRL; hsa-miR-25-3p showed a significant positive correlation with E2 and D0_ET, and hsa-miR-449c-5p showed a significant positive correlation with LH, T, and D0_P. These results indicate that miRNAs participate in the cyclical regulation of the endometrium.

[0217] Example 4

[0218] This embodiment analyzes the expression patterns of miRNAs in endometrial tissue and plasma during the peri-implantation window in women with successful and failed embryo transfers.

[0219] This invention uses differential analysis software to investigate the expression patterns of 24 biomarker miRNAs screened in Example 2 during the periimplantation window (day 3 after the luteinizing hormone peak in the pre-reception phase, day 7 after the luteinizing hormone peak in the mid-reception phase, and day 9 after the luteinizing hormone peak in the late-reception phase) in women with successful and failed embryo transfers. miRNAs with similar expression patterns were grouped together, and the results are as follows: Figure 6As shown, hsa-miR-548-3p, hsa-miR-190a-5p, and hsa-miR-143-3p exhibit similar expression patterns in the successful and failed groups, but their expression levels differ at each specific time point. hsa-let-7d-5p, hsa-miR-381-3p, and hsa-miR-145-5p show different expression patterns in the successful and failed groups, and their expression levels also differ at each specific time point. For example, hsa-let-7d-5p shows a decreasing expression pattern in the successful group during the pre-acceptance, mid-acceptance, and late-acceptance phases, while its expression level increases in the failed group. Among the 24 miRNAs with completely consistent expression patterns in tissues and plasma, hsa-miR-346, hsa-miR-455-5p, hsa-miR-455-3p, hsa-miR-548b-3p, hsa-miR-190a-5p, and hsa-miR-143-3p showed the same expression patterns in both the successful and failed groups; hsa-let-7d-5p, hsa-miR-4485-3p, hsa-miR-4474-3p, hsa-miR-25-3p, hsa-miR-33a-5p, and hsa hsa-miR-1277-3p, hsa-miR-31-3p, hsa-miR-1249-3p, hsa-miR-145-3p, hsa-miR-145-5p, hsa-miR-101-3p, hsa-miR-127-5p, hsa-miR-374b-3p, hsa-miR-1255a, hsa-miR-381-3p, hsa-miR-449c-5p, hsa-miR-656-3p, and hsa-miR-410-3p exhibit different expression patterns in the success and failure groups. By detecting the expression levels of miRNAs during the peri-implantation period in women with successful and failed embryo transfers, the outcome of embryo transfer can be predicted. This can be achieved by defining the expression levels of miRNAs: in the successful embryo transfer group, the expression levels of hsa-miR-548b-3p, hsa-miR-190a-5p, hsa-miR-143-3p, hsa-let-7d-5p, and hsa-miR-145-5p were lower than those in the failed group during the pre- and mid-receptivity phases; while the expression level of hsa-miR-381-3p was higher than that in the failed group during the pre-, mid-, and late-receptivity phases.

[0220] Example 5

[0221] This embodiment included plasma miRNA expression data from 83 patients who successfully underwent embryo transfer, from day 1 to day 11 after the luteinizing hormone peak. The logistic regression learning model used 23 miRNAs selected in this invention. 63 patients were classified as the training set, and the remaining 20 as the test set. Plasma samples from each patient were labeled as pre-receptive, from day 7 post-receptive as intra-receptive, and from day 9 post-receptive as post-receptive. Results are as follows: Figure 7 and Figure 8 As shown: the AUC of the training set is 0.91 and the accuracy is 0.79; the AUC of the test set is 0.74 and the accuracy is 0.65.

[0222] In summary, the markers of this invention can non-invasively and accurately determine whether endometrial tissue is receptive, which is of great significance for the success of embryo transfer.

[0223] The applicant declares that the detailed method of the present invention is illustrated by the above embodiments, but the present invention is not limited to the above detailed method, that is, it does not mean that the present invention must rely on the above detailed method to be implemented. Those skilled in the art should understand that any improvements to the present invention, equivalent substitutions of the raw materials of the product of the present invention, addition of auxiliary components, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

Claims

1. A biomarker associated with the periimplantation window of the endometrium, characterized in that, The biomarkers include: hsa-miR-1290, hsa-miR-511-3p, hsa-miR-1246, hsa-miR-371b-5p, hsa-miR-887-3p, hsa-miR-874-3p, hsa-miR-181a-3p, hsa-miR-873-3p, hsa-miR-4772-3p, hsa-miR-223-5p, hsa-miR-27a-5p, hsa-miR-223-3p, hsa-miR-193a-5p, hsa-miR-346, hsa-miR-146b-3p, hsa-miR-455-5p, hsa-miR-135a-5p, hsa-miR-671-5p, hsa-miR-34c-5p, hsa-miR-449c-5p, hsa-miR-483-3p, hsa-miR-326, hsa-miR-155-5p, hsa-miR-455-3p, hsa-miR-424-5p, hsa-miR-708-5p, hsa-miR-3690, hsa-miR-942-5p, hsa-miR-142-3p, hsa-miR-7976, hsa-miR-503-5p, hsa-miR-1298-5p, hsa-miR-153-3p, hsa-miR-424-3p, hsa-miR-548ad-5p, hsa-miR-452-5p, hsa-miR-335-5p, hsa-miR-106b-3p, hsa-miR-193a-3p, hsa-miR-1224-5p, hsa-let-7g-3p, hsa-miR-212-3p, hsa-miR-23a-5p, hsa-miR-449a, hsa-miR-3133, hsa-miR-653-3p, hsa-miR-1180-3p, hsa-miR-183-3p, hsa-miR-30d-5p, hsa-let-7d-5p, hsa-miR-92b-3p, hsa-miR-877-5p, hsa-miR-21-5p, hsa-miR-27a-3p, hsa-miR-509-3-5p, hsa-miR-206, hsa-miR-509-5p, hsa-miR-190a-5p, hsa-miR-150-5p, hsa-miR-146a-5p, hsa-miR-142-5p, hsa-miR-551a, hsa-miR-33a-5p, hsa-miR-210-3p, hsa-miR-489-3p, hsa-miR-514a-3phsa-miR-548b-3p, hsa-miR-31-3p, hsa-miR-138-5p, hsa-miR-146b-5p, hsa-miR-3200-3p, hsa-miR-509-3p, hsa-miR-217-5p, hsa-miR-615-3p, hs a-miR-101-3p、hsa-miR-1185-2-3p、hsa-miR-30d-3p、hsa-miR-30b-5p、h sa-miR-9-5p、hsa-miR-675-5p、hsa-miR-409-5p、hsa-miR-550a-3p、hsa- miR-28-3p, hsa-miR-577, hsa-miR-409-3p, hsa-miR-487a-3p, hsa-miR-1255a, hsa-miR-144-3p, hsa-miR-99a-3p, hsa-miR-4474-3p, hsa-miR-133 a-3p, hsa-miR-4732-3p, hsa-miR-15b-3p, hsa-miR-1-3p, hsa-miR-377-3p, hsa-miR-1277-3p, hsa-miR-136-5p, hsa-miR-381-3p, hsa-miR-665, hsa -miR-4485-3p, hsa-miR-494-3p, hsa-miR-345-5p, hsa-miR-548ay-5p, hsa-miR-127-3p, hsa-miR-136-3p, hsa-miR-127-5p, hsa-miR-196b-3p, hsa -miR-199b-3p、hsa-miR-199a-3p、hsa-miR-214-5p、hsa-miR-656-3p、hsa-miR-654-5p、hsa-miR-337-5p、hsa-miR-152-3p、hsa-miR-195-5p、hsa-mi R-126-5p, hsa-miR-410-3p, hsa-miR-548d-5p, hsa-miR-195-3p, hsa-miR-134-5p, hsa-miR-5683, hsa-miR-497-5p, hsa-miR-6500-3p, hsa-miR-54 8ae-5p, hsa-miR-143-5p, hsa-miR-214-3p, hsa-miR-126-3p, hsa-miR-451a, hsa-miR-483-5p, hsa-miR-3940-3p, hsa-miR-143-3p, hsa-miR-25-3pAny one or a combination of at least two of the following: hsa-miR-196a-5p, hsa-miR-152-5p, hsa-miR-485-5p, hsa-miR-145-3p, hsa-miR-1249-3p, hsa-miR-145-5p, hsa-miR-627-3p, hsa-miR-542-3p, hsa-miR-29a-3p, hsa-miR-668-3p, hsa-miR-27b-3p, hsa-miR-619-5p, hsa-miR-3613-3p, hsa-miR-378a-5p, hsa-miR-339-3p, hsa-miR-582-5p, hsa-miR-374b-3p, or hsa-miR-576-5p. , 2. The biomarker related to the peri-implantation window of the endometrium according to claim 1, characterized in that, The biomarkers include hsa-miR-101-3p, hsa-miR-1277-3p, hsa-miR-381-3p, hsa-miR-127-5p, hsa-miR-374b-3p, hsa-miR-346, hsa-miR-455-5p, hsa-miR-449c-5p, hsa-miR-455-3p, hsa-let-7d-5p, hsa-miR-548b-3p, and hsa-miR-125. 5a, hsa-miR-4485-3p, hsa-miR-31-3p, hsa-miR-4474-3p, hsa-miR-25-3p, hsa-miR-1249-3p, hsa-miR-190a- 5p, hsa-miR-33a-5p, hsa-miR-656-3p, hsa-miR-410-3p, hsa-miR-143-3p, hsa-miR-145-3p and hsa-miR-145-5p.

3. The use of the biomarkers and their detection reagents related to the peri-implantation window of the endometrium as described in claim 1 or 2 in the preparation of products for analyzing the peri-implantation window of the endometrium.

4. A kit for analyzing the peri-implantation window of the endometrium, characterized in that, The kit includes reagents for detecting the expression level of the biomarker as described in claim 1 or 2.

5. The application of the biomarkers and their detection reagents related to the peri-implantation window of the endometrium as described in claim 1 or 2 in the analysis of the peri-implantation window of the endometrium for non-disease diagnosis purposes.

6. A method for screening biomarkers related to the peri-implantation window of the endometrium as described in claim 1 or 2, characterized in that, The screening method includes the following steps: (1) Endometrial tissue and peripheral blood samples were collected from women with successful embryo implantation during the peri-implantation window for miRNA sequencing and quantitative analysis. The peri-implantation window includes three periods: pre-implantation, during-implantation, and post-implantation. Pre-implantation is from day 1 to day 5 after the peak of luteinizing hormone (LH), during-implantation is from day 6 to day 7 after the peak of LH, and post-implantation is from day 8 to day 11 after the peak of LH. (2) Differentially expressed miRNAs in tissues and plasma during the peri-implantation window were screened separately, and the intersection miRNAs were taken as the biomarkers screened in this invention.

7. The method for screening biomarkers related to the peri-implantation window of the endometrium according to claim 6, characterized in that, The miRNA sequencing and quantification analysis of endometrial tissue and peripheral blood samples collected from women with successfully implanted embryos during the peri-implantation window, as described in step (1), includes: miRNAs in endometrial tissue and peripheral blood samples were sequenced. Sequences containing 3' adapters, sequences with 3 or more NNN nucleotides, sequences with A, T, C or G homopolymers, sequences with a quality score below 10, and sequences with a post-adaptor length of less than 18 nt were removed, and duplicate sequences were also removed. The deduplicated sequences were mapped to the Rfam database to obtain valid sequences. The valid sequences were compared with the human reference genome hg38, and miRNAs were quantified using miRNA quantification software. The screening in step (2) includes: using differential analysis software to calculate the difference in miRNA expression levels between different time points, and obtaining the differentially expressed miRNAs between samples at any two time points; the time points include: day 1 to day 11 after the luteinizing hormone peak of women with successful embryo implantation.

8. An apparatus for analyzing endometrial receptivity, characterized in that, The device includes: a detection module and an analysis module; The detection module is used to perform the following: sequencing and quantification of the biomarkers of claim 1 or 2 in plasma samples at three periods: pre-reception, during reception, and post-reception; the pre-reception period is from day 1 to day 5 after the luteinizing hormone peak appears, the during reception period is from day 6 to day 7 after the luteinizing hormone peak appears, and the post-reception period is from day 8 to day 11 after the luteinizing hormone peak appears; The analysis module is used to perform the following: The receptivity of the endometrium can be determined by the expression level or expression pattern of the biomarker miRNA in plasma during the three stages of pre-receptivity, during-receptivity, and post-receptivity.

9. The apparatus for analyzing endometrial receptivity according to claim 8, characterized in that, The criterion for determining whether the endometrium is receptive is to meet any one of the following: (1) Judgment based on the expression level of biomarker miRNA: Construct a prediction model with the input being the miRNA expression level in plasma samples and the output being three probability values ​​between 0 and 1 with a sum of 1, representing the possibility that the plasma sample is in the pre-receptive, receptive, or post-receptive stage of the endometrium. The largest number represents the highest probability. The largest of the three numbers is used to define the stage of the sample. If the sample is in the receptive stage, it is judged that the endometrium is receptive. If the sample is in the pre-receptive or post-receptive stage, it is judged that the endometrium is non-receptive. (2) Judgment based on expression pattern: When the number of biomarker miRNAs that meet the same expression pattern in all four expression patterns is greater than 60%, it is judged that the endometrium has receptivity; The four expression modes are as follows: (a)Markers with a gradually decreasing expression pattern: hsa-miR-1290, hsa-miR-346, hsa-miR-146b-3p, hsa-miR-455-5p, hsa-miR-449c-5p, hsa-miR-483-3p, hsa-miR-155-5p, hsa-miR-455-3p, hsa-miR-449a, hsa-miR-30d-5p, hsa-let-7d-5p, hsa-miR-206, hsa-miR-548b-3p, hsa-miR-146b-5p, hsa-miR-30d-3p, hsa-miR-675-5p, hsa-miR-28-3p, hsa-miR-409-3p, hsa-miR-1255a, hsa-miR-99a-3p, hsa-miR-133a-3p, hsa-miR-1-3p, hsa-miR-665, hsa-miR-4485-3p, hsa-miR-152-3p, hsa-miR-6500-3p, hsa-miR-483-5p, hsa-miR-196a-5p, hsa-miR-152-5p, hsa-miR-485-5p, and hsa-miR-27b-3p; (b)Markers with a gradually increasing expression pattern: hsa-miR-511-3p, hsa-miR-371b-5p, hsa-miR-27a-5p, hsa-miR-223-3p, hsa-miR-326, hsa-miR-424-5p, hsa-miR-3690, hsa-miR-142-3p, hsa-miR-1298-5p, hsa-miR-424-3p, hsa-miR-548ad-5p, hsa-miR-193a-3p, hsa-let-7g-3p, hsa-miR-3133, hsa-miR-92b-3p, hsa-miR-509-3-5p, hsa-miR-142-5p, hsa-miR-551a, hsa-miR-210-3p, hsa-miR-514a-3p, hsa-miR-509-3p, hsa-miR-101-3p, hsa-miR-550a-3p, hsa-miR-144-3p, hsa-miR-1277-3p, hsa-miR-136-5p, hsa-miR-381-3p, hsa-miR-548ay-5p, hsa-miR-127-5p, hsa-miR-196b-3p, hsa-miR-199b-3p, hsa-miR-199a-3p, hsa-miR-548d-5p, hsa-miR-548ae-5p, hsa-miR-143-5p, hsa-miR-627-3p, hsa-miR-542-3p, hsa-miR-3613-3p, hsa-miR-339-3p, hsa-miR-582-5p, hsa-miR-374b-3p, and hsa-miR-576-5p; (c) Markers of an initial increase followed by a decrease in expression levels: hsa-miR-34c-5p, hsa-miR-942-5p, hsa-miR-7976, hsa-miR-503-5p, hsa-miR-153-3p, hsa-miR-106b-3p, hsa-miR-1224-5p, hsa-miR-1180-3p, hsa-miR-183-3p, hsa-miR-509-5p, hsa-miR-31-3p, hsa-miR-3200-3p , hsa-miR-409-5p, hsa-miR-4474-3p, hsa-miR-4732-3p, hsa-miR-15b-3p, hsa-miR-127-3p, hsa-miR-654-5p, hsa-m iR-134-5p, hsa-miR-214-3p, hsa-miR-451a, hsa-miR-3940-3p, hsa-miR-25-3p, hsa-miR-1249-3p and hsa-miR-668-3p; (d) Markers of the expression level decreasing then increasing pattern: hsa-miR-1246, hsa-miR-887-3p, hsa-miR-874-3p, hsa-miR-181a-3p, hsa-miR-873-3p, hsa-miR-4772-3p, hsa-miR-223-5p, hsa-miR-193a-5p, hsa-miR-135a-5p, hsa-miR-671-5p, hsa-miR-708-5p, hsa-miR-452-5p, hsa-miR-335-5p, hsa-miR-212-3p, hsa-miR-23a-5p, hsa-miR-653-3p, hsa-miR-877-5p, hsa-miR-21-5p, hsa-miR-27a -3p, hsa-miR-190a-5p, hsa-miR-150-5p, hsa-miR-146a-5p, hsa-miR-33a-5p, hsa-miR-489-3p, hsa-miR-138-5p, hsa- miR-217-5p, hsa-miR-615-3p, hsa-miR-1185-2-3p, hsa-miR-30b-5p, hsa-miR-9-5p, hsa-miR-577, hsa-miR-487a-3p , hsa-miR-377-3p, hsa-miR-494-3p, hsa-miR-345-5p, hsa-miR-136-3p, hsa-miR-214-5p, hsa-miR-656-3p, hsa-miR-3 37-5p, hsa-miR-195-5p, hsa-miR-126-5p, hsa-miR-410-3p, hsa-miR-195-3p, hsa-miR-5683, hsa-miR-497-5p, hsa-mi R-126-3p, hsa-miR-143-3p, hsa-miR-145-3p, hsa-miR-145-5p, hsa-miR-29a-3p, hsa-miR-619-5p and hsa-miR-378a-5p.

10. The use of the apparatus for analyzing endometrial receptivity as described in claim 8 or 9 in the preparation of products for analyzing the peri-implantation window of the endometrium.

Images