Bradyrhizobium sp. Hainan A21, growth promoting microbial inoculant, method and application
By using Hainan Rhizobium A21 as a growth-promoting agent, the problem of unstable content of active ingredients in Salvia miltiorrhiza was solved, the accumulation of key active ingredients in the hairy roots of Salvia miltiorrhiza was significantly improved, and the quality and stability of Salvia miltiorrhiza were enhanced.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- INSTITUTE OF CHINESE MATERIA MEDICA CHINA ACADEMY OF CHINESE MEDICAL SCIENCES
- Filing Date
- 2025-12-15
- Publication Date
- 2026-06-12
AI Technical Summary
The content of active ingredients in Salvia miltiorrhiza varies considerably, affecting the quality of the medicinal material. Existing research is relatively scarce, especially regarding the correlation between rhizosphere microorganisms and the quality of the medicinal material, which has not been fully explored.
Hainan Rhizobium A21 was used as a growth-promoting agent. By inoculating it into the culture medium and preparing a bacterial suspension, it was applied to the Salvia miltiorrhiza planting environment to promote the accumulation of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, lithospermic acid and salvianolic acid A in the hairy roots of Salvia miltiorrhiza.
It significantly increases the content of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, lithospermic acid and salvianolic acid A in the hairy roots of Salvia miltiorrhiza, thereby improving the quality stability and active ingredient accumulation efficiency of Salvia miltiorrhiza.
Smart Images

Figure CN121343844B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of microbial technology, specifically relating to a strain of Hainan rhizobium A21, a growth-promoting agent, a method, and its application. Background Technology
[0002] Salvia miltiorrhiza is a commonly used bulk medicinal herb in clinical practice, with a large cultivation area and wide distribution, cultivated in provinces such as Shandong, Sichuan, Anhui, and Henan. In recent years, the unstable quality of Salvia miltiorrhiza has been a persistent obstacle to the high-quality development of the industry. Due to differences in seedling sources and production environments in different regions, the content of active ingredients in Salvia miltiorrhiza from different producing areas varies significantly. The accumulation of active ingredients in Salvia miltiorrhiza is not only influenced by genetic factors and cultivation conditions but may also be closely related to the rhizosphere microecological environment. However, current research on the rhizosphere microorganisms of Salvia miltiorrhiza and their correlation with the quality of the medicinal material remains relatively scarce. Summary of the Invention
[0003] This invention provides a strain of Hainan rhizobium A21, a growth-promoting agent, a method, and applications. The Hainan rhizobium A21 of this invention can increase the content of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, lithospermic acid, and salvianolic acid A in Salvia miltiorrhiza.
[0004] To solve the above-mentioned technical problems, the following technical solution is proposed: a strain of Hainan rhizobium ( Rhizobium hainanense A21, with accession number CGMCC No.34687.
[0005] This invention provides a growth-promoting bacterial agent, including the Hainan Rhizobium A21 described in the above scheme.
[0006] As a preferred embodiment, the viable count of Hainan Rhizobium A21 in the growth-promoting agent is ≥5×10⁻⁶. 8 CFU / mL or ≥5×10 8 CFU / g.
[0007] As a preferred method, the Hainan Rhizobium A21 can be used in the form of bacterial suspension.
[0008] As a preferred method, the preparation method of the bacterial suspension includes the following steps: inoculating the Hainan rhizobium A21 into a culture medium for cultivation to obtain the bacterial suspension.
[0009] The present invention also provides the application of Hainan rhizobium A21 or the growth-promoting agent described above in improving the phenolic acid content of plants.
[0010] As a preferred embodiment, the plant includes Salvia miltiorrhiza.
[0011] As a preferred embodiment, the danshen includes danshen hairy roots.
[0012] As a preferred embodiment, the phenolic acid components include one or more of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, lithospermic acid, and salvianolic acid A.
[0013] The present invention also provides a method for increasing the phenolic acid content of plants, comprising the following steps: applying the Hainan rhizobium A21 or the growth-promoting agent described in the above scheme to the plant or the planting environment for cultivation.
[0014] The beneficial effects of this invention are as follows: This invention provides a strain of *Rhizobium hainanense* A21, with the preservation number CGMCC No. 34687. *Rhizobium hainanense* A21 was isolated from the rhizosphere soil of *Salvia miltiorrhiza*. Rhizosphere growth-promoting bacteria can promote the biosynthesis of medicinal components and increase the accumulation efficiency of secondary metabolites. Using *Rhizobium hainanense* A21 as an inducer to culture the hairy roots of *Salvia miltiorrhiza*, this invention can increase the content of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, shikonin, and salvianolic acid A. Attached Figure Description
[0015] Figure 1 Phylogenetic tree of Rhizobium hainanense A21;
[0016] Figure 2 The effect of each group on the content of salvianolic acid B in the hairy roots of Salvia miltiorrhiza in Example 2;
[0017] Figure 3 The effect of each group on the rosmarinic acid content of the hairy roots of Salvia miltiorrhiza in Example 2;
[0018] Figure 4 The effect of each group on the content of salvianolic acid Y in the hairy roots of Salvia miltiorrhiza in Example 2;
[0019] Figure 5 The effect of each group on the tanshinone content in the hairy roots of Salvia miltiorrhiza is shown in Example 2.
[0020] Figure 6 The effect of each group on the content of shikonin in the hairy roots of Salvia miltiorrhiza is shown in Example 2.
[0021] Figure 7 The effect of each group on the content of salvianolic acid A in the hairy roots of Salvia miltiorrhiza in Example 2;
[0022] Figure 8 The effect of each group on the total salvianolic acid content of the hairy roots of Salvia miltiorrhiza in Example 2.
[0023] Biological Preservation Instructions
[0024] Strain A21, classified as Hainan Rhizobium Rhizobium hainanenseIt was deposited on May 27, 2025, at the China General Microbiological Culture Collection Center (CGMCC), at No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC No. 34687. Detailed Implementation
[0025] This invention provides a strain of Hainan rhizobium ( Rhizobiumhainanense The Hainan Rhizobium strain A21, with accession number CGMCC No. 34687, has the 16S rDNA sequence shown in SEQ ID No. 1.
[0026] This invention uses rhizosphere soil from healthy Salvia miltiorrhiza plants as raw material to isolate a strain of Rhizobium hainanense A21. Rhizobium hainanense A21 can increase the content of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, shikonin, salvianolic acid A, and total phenolic acids in the hairy roots of Salvia miltiorrhiza. Total phenolic acids are the sum of the contents of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, shikonin, and salvianolic acid A. Using the 16S rRNA sequence of Rhizobium hainanense A21, a BLAST homology sequence search was performed in NCBI. A phylogenetic tree was constructed using the sequences with high homology obtained, confirming strain A21 as Rhizobium hainanense (…). Rhizobium hainanense ).
[0027] This invention provides a growth-promoting microbial agent, comprising *Rhizobium hainanense* A21 as described in the above-mentioned technical solution. As an optional embodiment, the viable count of *Rhizobium hainanense* A21 in the growth-promoting microbial agent is ≥5 × 10⁻⁶. 8 CFU / mL or ≥5×10 8 CFU / g.
[0028] As an optional implementation, the Hainan Rhizobium A21 of the present invention is used in the form of a bacterial suspension. As an optional implementation, the preparation method of the bacterial suspension of the present invention includes the following steps: inoculating the Hainan Rhizobium A21 into a culture medium for cultivation to obtain a bacterial suspension.
[0029] As another optional implementation, the inoculation form of *Rhizobium hainanense* A21 includes one or more of single colony inoculation, seed culture, and cryopreservation solution. This invention does not specifically limit the inoculation method; conventional methods are acceptable. As an optional implementation, the culture temperature of this invention is 25℃~32℃, more preferably 30℃; in specific embodiments of this invention, the culture temperature is 25, 28, 30, 31, or 32℃. The culture time is 43~53 hours, or 45~50 hours, more preferably 48 hours. In specific embodiments of this invention, the culture time is 44, 46, 48, 50, 52, or 53 hours. The culture is aerobic. As an optional implementation, the culture rotation speed of this invention is 190~210 rpm; in specific embodiments of this invention, the culture rotation speed is 190, 200, or 210 rpm. The setting of the culture temperature, time, and rotation speed of this invention can promote the growth of *Rhizobium hainanense* A21 and increase its growth rate.
[0030] As an optional implementation, the culture medium used for the culture includes LB liquid medium. The LB liquid medium comprises 10.0 g / L peptone, 5.0 g / L yeast extract, and 10.0 g / L sodium chloride, with a pH of 7.2 ± 0.1. As an optional implementation, after the culture is completed, a culture solution is obtained. The culture solution is centrifuged to obtain a bacterial cell precipitate. The bacterial cell precipitate is washed and resuspended to obtain a bacterial suspension. The OD of the bacterial suspension is... 600 The concentration is 0.4~0.6, more preferably 0.5. The solvent used for washing and resuspension is sterile water. The effective viable count of Hainan Rhizobium A21 in the bacterial suspension of the present invention is ≥5×10⁻⁶. 8 CFU / mL.
[0031] This invention provides the application of Hainan rhizobium A21 or the growth-promoting agent described in the above-mentioned technical solutions in improving the phenolic acid content of plants.
[0032] As an optional implementation, the plant described in this invention includes Salvia miltiorrhiza; the Salvia miltiorrhiza includes Salvia miltiorrhiza hairy roots.
[0033] As an optional implementation, the phenolic acid components of this invention include one or more of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, shikonin, and salvianolic acid A. In this invention, the total content of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, shikonin, and salvianolic acid A is denoted as the total phenolic acid content. This invention isolates Hainan rhizobium A21 from the rhizosphere soil of *Salvia miltiorrhiza* and uses it as an inducer to culture the hairy roots of *Salvia miltiorrhiza*, which can increase the content of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, shikonin, salvianolic acid A, and the total phenolic acid content in the hairy roots of *Salvia miltiorrhiza*.
[0034] This invention provides a method for increasing the phenolic acid content of plants, comprising the following steps: mixing Hainan rhizobium A21 or the growth-promoting agent described in the above technical solution with the plant to be improved, and then inducing culture.
[0035] As an optional implementation, the present invention does not specifically limit the mixing method; conventional methods can be used. In this invention, the mixing method includes: inoculating the Hainan rhizobium A21 into a culture medium to obtain a culture medium containing Hainan rhizobium A21; and mixing the culture medium containing Hainan rhizobium A21 with the plant to be improved to obtain a mixture.
[0036] As an optional implementation, the viable count of Hainan Rhizobium A21 in the mixture of the present invention is ≥5×10⁻⁶. 8 CFU / mL.
[0037] This invention does not specifically limit the type or variety of the culture medium; any culture medium in which *Rhizobium hainanense* A21 can grow normally is acceptable. In a specific embodiment of this invention, *Rhizobium hainanense* A21 is inoculated in MS medium.
[0038] As an optional implementation, the induction culture method of the present invention includes dark culture; the induction culture time can be 4-7 days or 5-6 days. The rotation speed of the induction culture is 80-100 rpm, and in specific embodiments of the present invention, the rotation speed is 80, 90, or 100 rpm. The induction culture temperature can be 23-30℃ or 24-28℃, more preferably 25℃.
[0039] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but these should not be construed as limiting the scope of protection of the present invention.
[0040] The culture medium formulation used in this embodiment of the invention is as follows:
[0041] Tryptone soybean agar (TSA), LB solid medium (LB), nutrient broth (NB), and R2A agar medium (R2A) were all purchased from Qingdao Haibo Biotechnology Co., Ltd., Qingdao High-tech Industrial Park. Specific components are as follows:
[0042] (1) The composition of tryptone soybean agar (TSA) is: 15.0 g / L tryptone, 5.0 g / L soybean, 5.0 g / L sodium chloride and 15.0 g / L agar. The pH of the prepared culture medium was measured to be 7.3±0.2 at 25℃. Weigh 40.0 g of commercially available TSA, heat and stir to dissolve in 1000 mL of distilled water, dispense into Erlenmeyer flasks, and autoclave at 121℃ for 15 min for later use.
[0043] (2) The composition of LB solid medium (LB) is: 10.0 g / L peptone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride and 20.0 g / L agar. The pH of the prepared medium was measured to be 7.2±0.1 at 25℃. Weigh 45.0 g of commercially available LB product, heat and stir to dissolve in 1000 mL of distilled water, dispense into containers, and autoclave at 121℃ for 20 min for later use.
[0044] (3) The nutrient broth (NB) consisted of 10.0 g / L peptone, 3.0 g / L beef extract, and 5.0 g / L sodium chloride. The pH of the prepared culture medium was measured to be 7.2 ± 0.2 at 25°C. 18.0 g of commercially available NB was weighed, heated and dissolved in 1000 mL of distilled water, 20 g of agar was added, and the mixture was autoclaved at 121°C for 15 min.
[0045] (4) The composition of R2A agar medium (R2A) is as follows: yeast extract 0.5 g / L, peptone 0.5 g / L, casein hydrolysate 0.5 g / L, glucose 0.5 g / L, soluble starch 0.5 g / L, dipotassium hydrogen phosphate 0.3 g / L, anhydrous magnesium sulfate 0.024 g / L, sodium pyruvate 0.3 g / L, and agar 15.0 g / L. The pH of the prepared medium was measured to be 7.2±0.2 at 25℃. Weigh 18.18 g of commercially available R2A, heat and dissolve it in 1000 mL of purified water, dispense into Erlenmeyer flasks, and autoclave at 121℃ for 15 min for later use.
[0046] Example 1: Cultivation and Preservation of the Strains
[0047] 1. Obtaining Bacterium A21
[0048] (1) Strains were isolated: Three healthy Salvia miltiorrhiza plants were randomly collected in Laiwu, Shandong Province and transported back to the laboratory at 4°C for further processing. Specifically, the Salvia miltiorrhiza plants were removed, large clumps of soil were removed from their roots, and soil tightly attached to the root surface was collected by shaking the roots as rhizosphere soil. The soil was passed through a 2 mm mesh sieve, placed in sterile centrifuge tubes, and stored at 4°C for later use.
[0049] (2) Weigh 1 g of fresh rhizosphere soil from step (1) and, under aseptic conditions, add it to a 50 mL centrifuge tube containing 9 mL of sterile water. Shake well and place in a shaker at 30°C and 200 rpm for 30 min. Transfer to a clean bench and extract 100 μL of the soil suspension into 900 μL of sterile water as a dilution factor of 10. -1 The soil suspension was shaken thoroughly. A 100% dilution was prepared using the same method. -2 10 -3 10 -4 10 -5 10 -6 Soil suspension.
[0050] Take 10 respectively -4 10 -5 10 -6 Three gradient soil suspensions (100 μL each) were spread onto TSA, LB, R2A, and NB solid media, respectively, with three replicates for each sample and concentration gradient. The plates were incubated upside down at 30°C for 2 days. Single colonies exhibiting distinct color and morphology were selected and inoculated onto TSA solid media plates using the streak plating method. These colonies were then incubated upside down at 30°C for 2 days. This purification process was repeated multiple times until a single, contamination-free strain was obtained and named strain A21.
[0051] (2) Preservation of bacteria. Under aseptic conditions, the obtained strain A21 was picked up with a pipette tip and placed into a shaker tube containing 3 mL of TSA liquid medium. The culture was incubated at 30°C and 200 rpm for 2 days until the culture became turbid. 800 μL of the bacterial culture was added to 800 μL of 40% glycerol (bacterial culture to 40% glycerol volume ratio 1:1), labeled, and stored at -80°C.
[0052] 2. Strain identification
[0053] Using a sterile toothpick, pick up the purified strain A21 from step 1 and inoculate it into a centrifuge tube containing 20 µL of ddH2O. Place the tube in a 95°C water bath and heat for 10 min. Then transfer it to a clean bench as a DNA template for the strain to be tested.
[0054] Using a 25 µL reaction system, pipette 1 µL of 10 µmol / L 27F (5'-AGAGTTTGATCCTGGCTCAG-3', SEQ ID No. 2) and 1492R (5'-GGTTACCTTGTTACGACTT-3', SEQ ID No. 3) primers, 12.5 µL of 2×TaqPCR Master Mix, and 9.5 µL of ddH2O into a centrifuge tube. Add 1 µL of DNA template, centrifuge at 10000 rpm for 10 s, mix thoroughly, and obtain the PCR mixture.
[0055] Place the PCR mixture into a PCR instrument and set the amplification program to 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 1 min 30 s, and repeat the denaturation, annealing, and extension cycles for 35 cycles; finally, extend at 72℃ for 10 min and store at 10℃ to obtain the PCR amplification product.
[0056] The PCR amplification product stock solution was sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The 16S rDNA sequencing results of the PCR amplification product are shown in SEQ ID No.As shown in Figure 1: 5’-CTGGCGTAGGCTTACACATGCGAGTCGAGCGCCCCGCAAGGGGAGCGGCAGACGGGTGAGTAACGCGTGGGAATCTACCTTTTGCTACGGAATAACGCAGGGAAACTTGTGCTAATACCGTATGTGTCCTTCGGGAGAAAGATTTATCGGCAAGAGATGAGCCCGCGTTGGATTAGCTAGTTGGTGGGGTAAAGGCCTACCAAGGCGACGATCCATAGCTGGTCTGAGAGGATGATCAGCCACATTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTCACCGGAGAAGATAATGACGGTATCCGGAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGATCAGTCAGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTGATACTGTCGATCTGGAGTATGGAAGAGGTGAGTGGAATTCCGAGTGTAGAGGTGAAATTCGTAGATATTCGGAGGAACACCAGTGGCGAAGGCGGCTCACTGGTCCATTACTGACGCTGAGGTGCGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGAATGTTAGCCGTCGGGCAGTATACTGTTCGGTGGCGCAGCTAACGCATTAAACATTCCGCCTGGGGAGTACGGTCGCAAGATTAAAACTCAAAGGAATTGACGGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGAAGCAACGCGCAGAACCTTACCAGCCCTTGACATCCTGTGTTACCCGTAGAGATATGGGGTCCACTTCGGTGGCGCAAAAACAGGTGCTGCATGGCTGTCGTCAGCTCGG-3’.
[0057] The obtained sequence was analyzed by BLAST comparison with the NCBI database, and strain A21 was identified as *Rhizobium hainanense*. Rhizobium hainanense ), namely Hainan Rhizobium A21, the evolutionary tree of Hainan Rhizobium A21 is as follows Figure 1 As shown.
[0058] Example 2
[0059] (1) Culture of hairy roots of Salvia miltiorrhiza: Hairy roots of Salvia miltiorrhiza were obtained by infecting Salvia miltiorrhiza seedlings with Agrobacterium rhizogenes Accc10060. The operation was carried out in accordance with the following: ["Establishment and analysis of in vitro culture system of transgenic hairy roots of Salvia miltiorrhiza", Zhang Xiaonan, China Journal of Traditional Chinese Medicine, No. 15, 2012].
[0060] (2) Subculture of Salvia miltiorrhiza hairy roots: Under aseptic conditions, 0.2 g of the tender part of Salvia miltiorrhiza hairy roots was weighed and inoculated into 50 mL of MS medium. It was placed on a shaker and cultured at 25℃, 90 rpm and in the dark for 15 days. The obtained Salvia miltiorrhiza hairy roots were used as experimental materials.
[0061] (3) Preparation of microbial inducers: Hainan rhizobium A21 was inoculated into 20 mL of LB medium and cultured at 200 rpm and 30 °C for 48 h. The resulting bacterial culture was centrifuged at 5000 rpm for 8 min to remove the supernatant and obtain bacterial precipitate. The bacterial precipitate was washed with sterile water and centrifuged to obtain clean bacterial cells without culture medium. Finally, the bacterial concentration was adjusted to OD using sterile water. 600 =0.5, as a microbial inducer.
[0062] The 250 mg / mL YE stock solution is a YE inducer, prepared as follows: Dissolve 25 g of yeast extract in 125 mL of distilled water, add 100 mL of anhydrous ethanol, and let stand at 4℃ for 4 days. Discard the supernatant, dissolve the gelatinous precipitate in 125 mL of distilled water, add anhydrous ethanol to obtain a mixture with an ethanol volume concentration of 80%. Then, precipitate and centrifuge, dissolve the precipitate in 100 mL of distilled water, sterilize, and then use.
[0063] (4) Induction of hairy roots of Salvia miltiorrhiza
[0064] The hairy roots of Salvia miltiorrhiza were randomly divided into three groups: group A21, group YE, and group CK. The specific operation is as follows:
[0065] Group A21: 500 µL of microbial inducer from step (3) was added to an Erlenmeyer flask containing 50 mL of MS medium, with 6 replicates. The hairy roots of *Salvia miltiorrhiza* cultured for 15 days in step (2) were transferred to the medium and placed in a shaker. They were cultured for 5 days in the dark at 25°C and 90 rpm. Samples were taken, and the phenolic acid content of the hairy roots was determined.
[0066] YE group: 500 μL of YE stock solution was added to an Erlenmeyer flask containing 50 mL of MS medium to obtain the induction medium. The final concentration of YE in the induction medium was 2500 mg / L. Six replicate experiments were set up. The hairy roots of Salvia miltiorrhiza obtained in step 1 were transferred into the induction medium, placed in a shaker, and cultured in the dark at 25℃ and 90 rpm for 5 days. Samples were then taken.
[0067] CK group: 50 mL of MS medium was placed in an Erlenmeyer flask. The hairy roots of Salvia miltiorrhiza that had been cultured for 15 days in step (2) were transferred into the medium. Six replicates were set up and placed in a shaker. The roots were cultured for 5 days in the dark at 25°C and 90 rpm. Samples were taken and the content of phenolic acid components in the hairy roots of Salvia miltiorrhiza was determined.
[0068] (5) Determination of the content of quality components in the hairy roots of Salvia miltiorrhiza
[0069] After rinsing the hairy roots twice with distilled water, carefully blot the moisture off the roots with absorbent paper, and place them in a 40℃ oven to dry for 2 days until constant weight. Then, remove the roots and pulverize the sample using a high-throughput tissue homogenizer (40 Hz, 60 s). Weigh 0.015 g of the Salvia miltiorrhiza hairy root powder into a 2 mL EP tube, add 1.5 mL of 80% methanol (v / v) and weigh immediately (record weight A). Sonicate (300 W, 40 kHz) for 40 min, cool, weigh again, and replenish the weight loss to weight A with the extraction solvent. Centrifuge at 12000 rpm for 5 min, filter the supernatant through a 0.22 µm microporous membrane, and collect the filtrate to obtain the Salvia miltiorrhiza test sample.
[0070] The contents of six chemical components—tanshinone B, rosmarinic acid, tanshinone Y, tanshinone, shikonin, and tanshinone A—in the tested samples of *Salvia miltiorrhiza* were determined using UPLC and UPLC-QQQ-MS. The total phenolic acid content was defined as the sum of the contents of tanshinone B, rosmarinic acid, tanshinone Y, tanshinone, shikonin, and tanshinone A. For the determination methods, please refer to [“Analysis of Quality Differences in *Salvia miltiorrhiza* from Different Origins Based on Multi-Indicator Content Determination and Chemometrics,” Wang Qiao et al., *Journal of Analytical Testing*, Vol. 42, No. 4, 2023].
[0071] Experimental data were processed and calculated using Excel 365, and analyzed using R4.2.0. The Dunnett test was used to analyze the differences in the content of hairy roots of *Salvia miltiorrhiza* under different treatments. The results are shown in Table 1 and... Figures 2-8 As shown in the table, different lowercase letters indicate significant differences in the data within the same column.
[0072] The results showed that strain A21 significantly increased the contents of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, lithospermic acid, salvianolic acid A, and total salvianolic acid by 46.0%, 136.2%, 103.7%, 53.0%, 111.5%, 97.6%, and 76.4%, respectively.
[0073] Table 1. Measurement data for each group (unit: mg / g)
[0074]
[0075] Studies have also shown that the YE inducer has no significant promoting effect on the content of phenolic acid components in the hairy roots of *Salvia miltiorrhiza*. This may be because the inducer activates a series of plant defense mechanisms, and the effector factors transmit the stimulus signal induced by the inducer to the second messenger, leading to an enhanced secondary metabolic response. The promoting effect of adding YE alone on secondary metabolites in the hairy roots of *Salvia miltiorrhiza* is less than that of YE+Ag. + The significant synergistic stimulation may be because the elicitor activates a series of plant defense mechanisms, and the effector transmits the stimulus signal induced by the elicitor to the second messenger, leading to an enhanced secondary metabolic response. In this invention, different elicitors induce different effector pathways, resulting in varying response intensities in tanshinone content. This invention utilizes strain A21 to significantly increase the contents of salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, lithospermic acid, salvianolic acid A, and total salvianolic acid in the hairy roots of *Salvia miltiorrhiza*.
[0076] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A strain of Hainan rhizobium ( Rhizobium hainanense A21, characterized in that, The accession number is CGMCCNo.34687.
2. A growth-promoting agent, characterized in that, Includes Hainan rhizobium A21 as described in claim 1.
3. The growth-promoting bacterial agent according to claim 2, characterized in that, The viable count of Hainan Rhizobium A21 in the growth-promoting bacterial agent is ≥5×10⁻⁶. 8 CFU / mL or ≥5×10 8 CFU / g.
4. The growth-promoting bacterial agent according to claim 2, characterized in that, The application forms of Hainan rhizobium A21 include bacterial suspension.
5. The growth-promoting bacterial agent according to claim 4, characterized in that, The preparation method of the bacterial suspension includes the following steps: inoculating the Hainan rhizobium A21 into a culture medium for culture to obtain the bacterial suspension.
6. The application of the Hainan rhizobium A21 as described in claim 1 or the growth-promoting agent as described in any one of claims 2 to 5 in improving the phenolic acid content of plants; wherein the plant is Salvia miltiorrhiza.
7. The application according to claim 6, characterized in that, The Danshen mentioned includes the hairy root of Danshen.
8. The application according to claim 6, characterized in that, The phenolic acid components include one or more of the following: salvianolic acid B, rosmarinic acid, salvianolic acid Y, tanshinone, lithospermic acid, and salvianolic acid A.
9. A method for increasing the phenolic acid content of plants, characterized in that, The process includes the following steps: applying the Hainan rhizobium A21 as described in claim 1 or the growth-promoting agent as described in any one of claims 2 to 5 to a plant or planting environment for cultivation; wherein the plant is Salvia miltiorrhiza.