A genetic control method for monochamus alternatus

By releasing male pine sawyer beetles carrying Wolbachia into the control area and mating them with females not carrying Wolbachia, the reproductive regulation effect of Wolbachia is utilized to solve the problems of high investment and pollution risk of existing control methods, and achieve a highly efficient, green and widely applicable control effect.

CN122168456APending Publication Date: 2026-06-09INST OF ZOOLOGY CHINESE ACAD OF SCI +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411781413.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2024-12-05
Publication Date
2026-06-09

AI Technical Summary

Technical Problem

Existing methods for controlling the pine sawyer beetle have drawbacks such as high investment, high pollution risk, and significant susceptibility to climatic conditions, and their control effects are not ideal.

Method used

Genetic control was achieved by using male *Pinus sylvestris* carrying a new strain of *Wolbachia*. The hatching rate of female *Pinus sylvestris* was reduced by the cytoplasmic incompatibility of *Wolbachia*. The specific steps included screening and releasing male *Pinus sylvestris* carrying *Wolbachia*, and mating them with female *Pinus sylvestris* not carrying *Wolbachia*.

Benefits of technology

It significantly reduces the egg hatching rate of the pine sawyer beetle by more than 90%, reduces the spread during the larval and pupal stages, has a significant control effect, a wide range of applications, conforms to the principle of green control, and reduces the input of human and material resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure HDA0005173567310000011
    Figure HDA0005173567310000011
Patent Text Reader

Abstract

The application provides a method for preventing and treating monochamus alternatus, which comprises putting male monochamus alternatus carrying Wolbachia into a target prevention and treatment area of monochamus alternatus not carrying Wolbachia. The method has low investment cost, is green, safe, environment-friendly, has no pesticide residue and high risk, conforms to the green prevention and control principle and needs of diseases and pests in the new era, is less affected by external temperature, humidity and other climate environments, is suitable for wide plots, is a new prevention and treatment method, is early in the prevention and treatment period, prevents and treats from the egg stage, reduces the double hazards of the larval stage dry woodworm and the pupal stage adult stage spreading pine wood nematode disease from the root, has good prevention and treatment effect, and can significantly reduce the egg hatching rate of monochamus alternatus by more than 90%.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application belongs to the field of biological control technology, and specifically relates to a method for genetic control of the pine sawyer beetle by utilizing the reproductive regulation function of the endosymbiotic bacterium Wolbachia. Background Technology

[0002] The pine longhorn beetle (Monochamus alternatus), belonging to the order Coleoptera, family Cerambycidae, and genus Monochaetus, is not only a major borer that damages pine trees, but also a vector for pine wilt disease, known as "pine tree cancer." It is listed as a quarantine pest both internationally and domestically.

[0003] Currently, there are various methods for controlling the pine sawyer beetle, including strengthening silvicultural measures such as creating mixed coniferous and broad-leaved forests, chemical control such as spraying pine oxychloride, and biological control such as releasing *Malus bacillus* and *Beauveria bassiana*. These methods have achieved some success, but they either require high levels of manpower and resources, pose a high risk of pesticide resistance and residues, or are significantly affected by external environmental conditions such as temperature, humidity, and climate. In general, the control effects of these methods are not ideal for every specific area treated. Therefore, there is an urgent need in production practice for a method of controlling the pine sawyer beetle that is low-cost, environmentally friendly, highly efficient, and less affected by external climatic conditions. Summary of the Invention

[0004] In view of the problems and limitations of existing methods for controlling the pine sawyer beetle, and based on the discovery of a new strain of Wolbachia in the pine sawyer beetle, the purpose of this application is to provide a method for genetic control of the pine sawyer beetle by utilizing the reproductive regulation function of the endosymbiotic bacterium Wolbachia.

[0005] Specifically, this application relates to the following aspects:

[0006] 1. A species of Wolbachia pipientis, with accession number CGMCC NO.46207 from the China General Microbiological Culture Collection Center.

[0007] 2. A method for controlling the pine sawyer beetle, comprising releasing male pine sawyer beetles carrying Wolbachia into the target control area for the pine sawyer beetle.

[0008] 3. The control method according to item 2, wherein the housekeeping genes of Wolbachia include gatB, coxA, hcpA, ftsZ, and fbpA.

[0009] Preferably, the housekeeping gene gatB has the sequence of SEQ ID NO:17 or as shown in SEQ ID NO:17, the housekeeping gene coxA has the sequence of SEQ ID NO:18 or as shown in SEQ ID NO:18, the housekeeping gene hcpA has the sequence of SEQ ID NO:19 or as shown in SEQ ID NO:19, the housekeeping gene ftsZ has the sequence of SEQ ID NO:20 or as shown in SEQ ID NO:20, and the housekeeping gene fbpA has the sequence of SEQ ID NO:21 or as shown in SEQ ID NO:21.

[0010] 4. The prevention and control method according to item 2 or 3, wherein the Wolbachia is the Pitiswabachia species described in item 1.

[0011] 5. The control method according to any one of items 1-4, wherein the ratio of the number of male pine sawyer beetles carrying Wolbachia to the number of pine sawyer beetles in the target control area is 1:12:1.

[0012] 6. The control method according to any one of items 1-5, wherein the method further comprises screening for male longhorn beetles carrying Wolbachia.

[0013] 7. The control method according to any one of items 1-6, wherein the method further comprises artificially breeding the male longhorn beetle carrying Wolbachia.

[0014] Preferably, the artificial breeding involves mating a female pine beetle carrying Wolbachia with a male pine beetle not carrying Wolbachia to breed a male pine beetle carrying Wolbachia.

[0015] 8. Uses of Wolbachia in the control of pine sawyer beetle.

[0016] 9. The use as described in item 8, wherein the housekeeping genes of said Wolbachia include gatB, coxA, hcpA, ftsZ, and fbpA.

[0017] Preferably, the housekeeping gene gatB has the sequence of SEQ ID NO:17 or as shown in SEQ ID NO:17, the housekeeping gene coxA has the sequence of SEQ ID NO:18 or as shown in SEQ ID NO:18, the housekeeping gene hcpA has the sequence of SEQ ID NO:19 or as shown in SEQ ID NO:19, the housekeeping gene ftsZ has the sequence of SEQ ID NO:20 or as shown in SEQ ID NO:20, and the housekeeping gene fbpA has the sequence of SEQ ID NO:21 or as shown in SEQ ID NO:21.

[0018] 10. The use according to item 8 or 9, wherein the Wolbachia is the Pitišovbachia body as described in item 1.

[0019] Beneficial effects of this application

[0020] The method described in this application belongs to biological control and genetic control, and has multiple advantages. It has low input costs in terms of manpower and materials; it is green, safe, and environmentally friendly, with no high risk of pesticide residues, and meets the principles and needs of green pest control in the new era; it is less affected by external climate conditions such as temperature and humidity, and is applicable to a wide range of sites; the control method is novel and the control period is early, starting from the egg stage, reducing the dual harm of pine wilt disease caused by larval borers boring into the trunk and the transmission of pine wilt disease during the pupal and adult stages; the control effect is good, and it can significantly reduce the egg hatching rate of pine sawyer beetle by more than 90%. Attached Figure Description

[0021] Figure 1 The bar chart shows the hatching rate of larvae in each experimental group. The values ​​a and b represent the statistical differences between groups. The same letter (such as pairwise comparisons of cross1, cross2 and cross4) indicates that the difference between groups is not significant, while different letters (such as comparison between cross2 and cross3) indicate that the difference between groups is extremely significant (p<0.001). Detailed Implementation

[0022] The present application is further illustrated below with reference to embodiments. It should be understood that the embodiments are only used to further illustrate and explain the present application and are not intended to limit the present application.

[0023] Unless otherwise defined, technical and scientific terms used in this specification have the same meaning as commonly understood by one of ordinary skill in the art. While similar or identical methods and materials may be applied in experimental or practical applications, materials and methods are described herein. In case of conflict, the definitions included herein shall prevail. Furthermore, materials, methods, and examples are for illustrative purposes only and are not intended to be limiting. The present application is further described below with reference to specific embodiments, but is not intended to limit the scope of the application.

[0024] New technologies for controlling pathogenic vector insects using Wolbachia have received widespread attention due to their green and efficient control effects, and related technologies are considered to have great application potential in the fields of public health and agricultural and forestry pest control. The pine sawyer beetle, as a major host of the plant pathogen pine wilt nematode, and due to its trunk-boring habits, has caused enormous damage to forest ecosystems and forestry economies in many countries. As early as the beginning of this century, international researchers explored whether Wolbachia could be used to control the pine sawyer beetle and pine wilt nematode disease. However, the conclusion was that the pine sawyer beetle does not carry Wolbachia, thus research progress on using Wolbachia for the control of the pine sawyer beetle stalled (see Aikkawa T, Anbutsu H, Nikoh N, Kikuchi T, Shibata F, Fukatsu T, 2009. Longicorn beetle thatvectors pinewood nematode carries many Wolbachia genes on anautosome. Proc.R.Soc.B,276,3791–3798. doi:10.1098 / rspb.2009.1022; Aikkawa T, Nikoh N, Anbutsu H, Togashi K, 2014. Prevalence of laterally transferred Wolbachianes in Japanese pine sawyer, Monochamus alternatus (Coleoptera: Cerambycidae). Appl Entomol Zool, 49:337–346. doi: 10.1007 / s13355-014-0256-0).

[0025] Based on preliminary research, the applicant first conducted Wolbachia testing on geographical populations of *Aegilops pineinae* from 11 regions across China. Wolbachia was detected in only three geographical populations, with the remaining populations not carrying it. Secondly, the MLST (Multi-locus sequence typing) method was used to accurately identify the detected Wolbachia strains, confirming that the discovered strains were novel strains previously unknown in the genus *Wolbachia*, further expanding the genetic resources of Wolbachia bacteria. Finally, the distribution and infection status of this new strain within *Aegilops pineinae* were analyzed, clarifying its strong cytoplasmic incompatibility genetic function, and this function was used to initially achieve population control of *Aegilops pineinae*. The applicant believes that the cytoplasmic incompatibility genetic function of this newly discovered Wolbachia strain in *Aegilops pineinae* can be used as a method or technique for controlling this disease.

[0026] Specifically, this application provides a species of Wolbachia pipientis, which was deposited on October 30, 2024, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China, with accession number CGMCC NO.46207.

[0027] This application provides a method for controlling the pine sawyer beetle, the method comprising step S1: releasing male pine sawyer beetles carrying Wolbachia into the target control area for the pine sawyer beetle.

[0028] Due to the cytoplasmic incompatibility of Wolbachia, male pine sawyer beetles carrying Wolbachia, when released into the target control area, can significantly reduce the larval hatching rate after mating with female pine sawyer beetles not carrying Wolbachia, by up to 90% or more, thus achieving the goal of controlling pine sawyer beetles.

[0029] In some specific embodiments, the housekeeping genes of Wolbachia include gatB, coxA, hcpA, ftsZ, and fbpA.

[0030] In some specific embodiments, the sequence of the housekeeping gene gatB of Wolbachia includes SEQ ID NO:17 or as shown in SEQ ID NO:17, the sequence of the housekeeping gene coxA includes SEQ ID NO:18 or as shown in SEQ ID NO:18, the sequence of the housekeeping gene hcpA includes SEQ ID NO:19 or as shown in SEQ ID NO:19, the sequence of the housekeeping gene ftsZ includes SEQ ID NO:20 or as shown in SEQ ID NO:20, and the sequence of the housekeeping gene fbpA includes SEQ ID NO:21 or as shown in SEQ ID NO:21.

[0031] Based on the five housekeeping genes (gatB, coxA, hcpA, ftsZ, fbpA) mentioned above, the Wolbachia strain was accurately identified and classified using the MLST (Multilocus sequence typing) method. The obtained sequence was uploaded to the PubMLST website for sequence typing, and it was found to be a novel strain of the genus wolbachia, named wAltA.

[0032] In some specific implementations, the Wolbachia is the aforementioned Pitišovbachia body.

[0033] In step S1, when releasing male pine sawyer beetles carrying Wolbachia, the release quantity can be determined based on the number of pine sawyer beetles in the target control area or the area of ​​the control area.

[0034] The population of *Pinus pineina* in the target control area can be investigated using methods known in the field. For example, a five-point survey method using traps can be employed. Trapping is conducted during the peak emergence period in early May. Five traps are suspended in areas with similar forest stand conditions within the target control area, spaced 100 meters apart, meaning each trap has an effective area of ​​3.14 hectares. The number of adult *Pinus pineina* in each trap is counted, and the average number trapped per trap is calculated. This number is then divided by the trapping efficiency of that type of trap to obtain the population size of *Pinus pineina* within the 3.14 hectares of the control area. Finally, the population size of *Pinus pineina* in the entire target control area is determined based on the total area. For example, in a 500-hectare Masson pine forest, five traps with similar stand conditions are hung in a selected area. The effective distance of this type of trap is 100 meters, so they are hung 100 meters apart. A total of 90 pine sawyer beetles are trapped by the five traps, averaging 18 traps per trap. The trapping efficiency of this type of trap is 50%. Therefore, the population of pine sawyer beetles in a 3.14-hectare area is 36, which is 11.46 per hectare. The population of pine sawyer beetles in a 500-hectare area is 5730 (90 ÷ 5 ÷ 0.5 ÷ 3.14 × 500).

[0035] In some specific implementations, the ratio of the number of male pine sawyer beetles carrying Wolbachia to the number of pine sawyer beetles in the target control area is 1:1 to 2:1, for example, it can be 1:1, 1.1:1, 1.2:1, 1.3:1, 1.4:1, 1.5:1, 1.6:1, 1.7:1, 1.8:1, 1.9:1, 2:1, and any value between these values.

[0036] When releasing animals, specifically, the principle of multi-point release should be followed to release male pine sawyer beetles carrying Wolbachia into the target control area covered by the pine sawyer beetle as much as possible.

[0037] The method of this application may also include step S0: screening for male longhorn beetles carrying Wolbachia.

[0038] Specifically, this process may include: trapping adult *Spodoptera litura* beetles, preparing a DNA template from one antenna, using the COⅠ gene for molecular identification, and confirming the sample as *Spodoptera litura* before conducting live identification of *Wolbachia* infection. Using the successfully identified *Spodoptera litura* DNA sample as an amplification template, the WSP and 16S genes of *Wolbachia* are used as molecular markers for *Wolbachia* detection to screen for male *Spodoptera litura* beetles carrying *Wolbachia*.

[0039] The method of this application may also include step S00: artificially breeding the male longhorn beetle carrying Wolbachia.

[0040] Specifically, male longhorn beetles carrying Wolbachia can be bred by mating female longhorn beetles carrying Wolbachia with male longhorn beetles not carrying Wolbachia.

[0041] In some specific embodiments, the method for controlling the pine sawyer beetle of this application includes the following steps: Step S0: Screening for male pine sawyer beetles carrying Wolbachia; Step S1: Releasing male pine sawyer beetles carrying Wolbachia into the target control area for the pine sawyer beetle. The sequence of the housekeeping gene gatB of Wolbachia includes SEQ ID NO:17 or as shown in SEQ ID NO:17, the sequence of the housekeeping gene coxA includes SEQ ID NO:18 or as shown in SEQ ID NO:18, the sequence of the housekeeping gene hcpA includes SEQ ID NO:19 or as shown in SEQ ID NO:19, the sequence of the housekeeping gene ftsZ includes SEQ ID NO:20 or as shown in SEQ ID NO:20, and the sequence of the housekeeping gene fbpA includes SEQ ID NO:21 or as shown in SEQ ID NO:21.

[0042] In some specific embodiments, the method for controlling the pine sawyer beetle of this application includes the following steps: Step S0: Selecting male pine sawyer beetles carrying Wolbachia; Step S00: Mating female pine sawyer beetles carrying Wolbachia with male pine sawyer beetles not carrying Wolbachia to breed male pine sawyer beetles carrying Wolbachia; Step S1: Releasing male pine sawyer beetles carrying Wolbachia into the target control area for pine sawyer beetles not carrying Wolbachia. The sequence of the housekeeping gene gatB of Wolbachia includes SEQ ID NO:17 or as shown in SEQ ID NO:17, the sequence of the housekeeping gene coxA includes SEQ ID NO:18 or as shown in SEQ ID NO:18, the sequence of the housekeeping gene hcpA includes SEQ ID NO:19 or as shown in SEQ ID NO:19, the sequence of the housekeeping gene ftsZ includes SEQ ID NO:20 or as shown in SEQ ID NO:20, and the sequence of the housekeeping gene fbpA includes SEQ ID NO:21 or as shown in SEQ ID NO:21.

[0043] The method of this application utilizes the principle that Wolbachia has cytoplasmic incompatibility in insect hosts, thereby regulating the reproduction of insects. Individuals of the pine sawyer beetle carrying Wolbachia were identified in vivo, strains of the pine sawyer beetle carrying Wolbachia were artificially propagated, and populations of pine sawyer beetles without Wolbachia were collected in the wild. Male pine sawyer beetles carrying Wolbachia were mated with female pine sawyer beetles without Wolbachia. After mating, the hatching rate of offspring eggs was significantly reduced (the reduction rate reached more than 90%), thereby achieving the goal of controlling the population of the pine sawyer beetle.

[0044] This application also provides the use of Wolbachia in the control of the pine sawyer beetle.

[0045] In some specific embodiments, the housekeeping genes of Wolbachia include gatB, coxA, hcpA, ftsZ, and fbpA.

[0046] In some specific embodiments, the sequence of the housekeeping gene gatB of Wolbachia includes SEQ ID NO:17 or as shown in SEQ ID NO:17, the sequence of the housekeeping gene coxA includes SEQ ID NO:18 or as shown in SEQ ID NO:18, the sequence of the housekeeping gene hcpA includes SEQ ID NO:19 or as shown in SEQ ID NO:19, the sequence of the housekeeping gene ftsZ includes SEQ ID NO:20 or as shown in SEQ ID NO:20, and the sequence of the housekeeping gene fbpA includes SEQ ID NO:21 or as shown in SEQ ID NO:21.

[0047] In some specific implementations, the Wolbachia is the aforementioned Pitišovbachia body.

[0048] Example

[0049] (I) Identification of live specimens of the target pest, the longhorn beetle (Pinus sylvestris var. chinensis).

[0050] Adult pine sawyer beetles were captured using traps in the controlled areas. Each beetle was individually placed in a 50ml perforated centrifuge tube containing small pine twigs to maintain viability. The beetles were then brought back to the laboratory for live identification using molecular biology methods. First, genomic DNA was extracted using the Jinsha Biotechnology Animal Tissue DNA Extraction Kit. Second, the COI fragment sequence was amplified using the genomic DNA as a template. The amplification primers were LCO1490: (5'-GGTCAACAAATCATAAAGATATTGG-3'(SEQ ID NO:1)); HCO2198: (5'-TAAACTTCAGGGTGACCAAAAAATCA-3'(SEQ ID NO:2)). The PCR program was set to 94℃ for 3 min pre-denaturation, 35 cycles (94℃ for 30 s, 50℃ for 30 s, 72℃ for 1 min), followed by extension at 72℃ for 2 min. Third, the amplified products were subjected to 1% gel electrophoresis. Samples with a bright, single target band were sent to Beijing Tianyi Huiyuan Biotechnology Co., Ltd. for bidirectional sequencing. Finally, after the valid sequencing results are returned, BLAST verification is performed using the NCBI blastn program. If the E value is 0 and the identity is >99%, it can be confirmed as *Syngonium pineense*.

[0051] (II) Target of Prevention and Control: Live identification of Wolbachia infection

[0052] Using the DNA sample identified as *Ceratophyllum demersum* in Step 1 as a template, the WSP and 16S fragment sequences of *Wolbachia* were amplified to identify *Wolbachia* infection status. The primers for the WSP fragment sequence amplification were: WSP81F: (5'-TGGTCCAATAAGTGATGAAGAAAC-3'(SEQ ID NO:3)); WSP691R: (5'-AAAAATTAAACGCTACTCCA-3'(SEQ ID NO:4)). The PCR program was set to 94°C for 3 min pre-denaturation, 35 cycles (94°C for 30 s, 57°C for 30 s, 72°C for 1 min), followed by extension at 72°C for 2 min. The primers for the 16S fragment sequence amplification were: WolbF: (5'-GAAGATAATGACGGTACTCAC-3'(SEQ ID NO:5)); Wspecr: (5'-AGCTTCGAGTGAAACCAATTC-3'(SEQ ID NO:6)). The PCR program was set to 94℃ for 3 min pre-denaturation, 35 cycles (94℃ for 30 s, 60℃ for 30 s, 72℃ for 1 min), and extension at 72℃ for 2 min. The primers for amplifying the WSP and 16S fragment sequences were subjected to 1% gel electrophoresis. A single bright target band indicated that the DNA sample contained *Wolbachia*, a species of longhorn beetle.

[0053] (III) Identification of new strains of Wolbachia in *Spodoptera litura*

[0054] Using the DNA sample clearly identified as infected with Wolbachia in step 2 as a template, fragments of five housekeeping genes (gatB, coxA, hcpA, ftsZ, fbpA) were amplified for strain identification using the MLST method. The primers for the gatB fragment sequence were: (gatB_F1: 5'-GAK TTA AAY CGY GCA GGB GTT-3' (SEQ ID NO: 7); gatB_R1: 5'-TGG YAAYTCRGG YAAAGA TGA-3' (SEQ ID NO: 8)). The primers for the coxA fragment sequence were: (coxA_F1: 5'-TTG GRG CRATYA ACT TTATAG-3' (SEQ ID NO: 9); coxA_R1: 5'-CT AAAGAC TTT KAC RCC AGT-3' (SEQ ID NO: 10)). The primers for the hcpA fragment sequence are: (hcpA_F1:5'-GAA ATA RCAGTT GCT GCAAA-3'(SEQ ID NO:11); hcpA_R1:5'-GAAAGT YRAGCA AGY TCT G-3'(SEQ ID NO:12)). The primers for the ftsZ fragment sequence are: (ftsZ_F1:5'-ATY ATG GAR CAT ATAAAR GAT AG-3'(SEQ ID NO:13); ftsZ_R1:5'-TCR AGY AAT GGATTR GAT AT-3'(SEQ ID NO:14)). The primers for the fbpA fragment sequence were: (fbpA_F1: 5'-GCT GCT CCR CTT GGY WTG AT-3' (SEQ ID NO: 15); fbpA_R1: 5'-CCR CCAGAR AAAAYY ACTATT C-3' (SEQ ID NO: 16)). The PCR program was set to 94℃ for 3 min pre-denaturation, 35 cycles (94℃, 30 s, (gatB, coxA, hcpA, ftsZ annealing temperature 54℃; fbpA annealing temperature 59℃) 45 s, 72℃, 1 min), 72℃, 2 min extension. The obtained gene fragment sequence was: gatB:>gatB

[0055] GAGTTAAAATTTGCAGGGGTTGCTTTAATGGAAAATTGTTTCAGAACCAGATCTCCGTTCATCTGCGGAAGCTGCAGAATGCATGAAAAAATTGAGGCAGATTTTGCGTTACATTGGTTCGTGTGATGGTGATATGGAAAAGGGATCACTTCGTTGTGATGCAAATGTTTCTGTCCGCCTAAAAGGCAGTAGCACATTTGGCACTCGTTGTGAGATAAAAAATCTGAACTCGATACGTTATATTGTGCAAGCTATAGACTATGAAATACAAAGACAAATTGAAATTTTAGAAAGTGGGGAAGAAATAAGTCAAGATACCTTATTGTTTGATGTCGCTTCGGGAAAAAACAAAAGTGATGCGAAACAAAGAAGATGCAAGCGACTATAGATACTTCCCTGAGCCTGATTTATTACCTGTTGAGGTAAGCCAGGAGAAAATTGATTTAATTCAATCATCTTTACGGAAAAATTACCA(SEQ ID NO:17)

[0056] CoxA:>coxA

[0057] CTAAAGACCTTTTACGCCAGTTATAACACCGATAAAAATTGTGGTAGTGCTAAAAAATGCAGCAGCGTCAGCACTAAGCCCAACAGTGAACATATGATGAGCCCAAACCATAAAGCCAAATACTGCTATACCTATCATTGCATAAACCATCCCTATGTAACCAAATACAGGTCTGTGAGAAAAAGTTGATACAACCTGACTTATGATGCCAAATGCAGGAAAAATAATTACGTAAACCTCCGGATGACCAAAAAACCAAAATAAATGTTGAAATAACACAGGGTCACCACCACCGGCAGGATCAAAAAAGGAAGTACCAATATTGCGATCAGTAAGAAGCATAGTTATAGCACCGGCAAGCACTGGTAAGGCGACAATCAACATAAATGCTGTTAGCAAGACAGACCAAACAAATAGTGGCATCTTAGTTAATGACATTCCTTTTGCGCGCATGTTAAATATAGTAACTATAAAGTTATTCGCCCCAA(SEQ ID NO:18)

[0058] hcpA:>hcpA

[0059] CTGCAAAGCAAGGGCTGCCTGATCCCGAACTCAACCCGCGCCTTCGCTCTGCTATATTTGCTGCACGCAAGGAAAATCTACCAAAAGATAAAATAGAAACAGCAATAAAAAATGCAACTGGTAACGTTGCTGGAGAAAATTACGAGGAAATACAATATGAAGGTCATGGGCCTTCTGGTACTGCACTCATTGTCCATGCCTTGACTAATAACCGCAACCGTACTGCTTCTGAGGTACGTTATATATTTTCTCGCAAGGGTGGAAACTTGGGAGAAACAGGAAGTGTTAGTTACCTTTTCGATCATGTAGGTTTAATCGTCTATAAAGCAGAGGGTGTGAATTTTGATGATTTATTTAATTATGGGATCGAGTTAGAAGTATTGAATGTTGAGGAAAATGACAAAGAAGGATTACACGTTATAACTTGTGAAATAAAAGATTTTGGTAAAGTACGCGATGCCTTTTATGCAAAATTCAGAGAACCAGAACTTGTTCAACTTTC(SEQ ID NO:19)

[0060] FtsZ:>ftsZ

[0061] TCGAGTAAATGGATTGGATATTGCAGCTTCCGCAGCACTAATTGCTCTATCTTCTCCTTCTGCCTCTCCGGTGCCGATCATCGCTTTGCCCATCTCGCTCATTACTGTTTCTATATCAGCAAAATCAAGATTTATAAGCCCTGGCATGACCATCAAGTCAGTTACTCCTCTGATGCCAATGTGCAGAACATTATCAGCAAGTTTAAATGCATCAGAAAACGTAGTTTTTTCATTTGCAATTCTAAACAAATTCTGATTTGGAATGACAATAAGTGTATCCACGTATTTTTGCAGTTCTTCAAGTCCAAGCTCTGCAATGCGCATGCGGCGCACACCTTCAAAACCGAACGGTTTAGTGACAACTCCAACAGTCAATATCTTTTTTTCTTTTGGCGCTCTATCCTTAACTGCAGCTCTTGCTTCTCTGGCTGCTTTTGCAATTACCGGTGCTGCACCGGTTCCAGTACCACCGCCCATTCCTGCTGTGATGAAAAGCATATGACTATCCTTTATATGCTCCATAAT(SEQ ID NO:20)

[0062] FbpA:>fbpA

[0063] CCGCCAGAGGGAAATTACTATTCTTTTCCCTGCAAAACAAGATCTTTTAACATATTCAATTCTTTTAGATAATGATTCAATATTTTCTGTTTCTATTTTTTCCCTTTCCAAATATTTAGTTGGAAGTTTTACTTTGATTATATTAGCGCCAAGTAAAGCTGCTATGTGCGCAGCATAGGCAATAACATCAACTGCTGTTTCACCTTCTTTGGAAATTCCTCACCGCGTGGATAAGACCATAGCACTACTGCAAGCCC GTAAGATTTGGCTTCAGCTATGATTCCACGGGCTTCTTCCATCATATCGAAACACTTAGCAGAACCAGGATATATAGTAAATCCGACAGCTAAGCAGCCCAAACGCAGCGCATCTTTCACAGAAGAGGT TATTGCCTGATCAGAGGTTAGATCCTTTGAATGTAAAGAGTTGGAACTATTAAGTTTCAAAATAAGTGGGAGCATTCCAGCATAAGTTGCAGCACCAGCTTCAATCAAACCACGGGGGGAGCAGC(SEQ ID NO:21)

[0064] The gene sequences were uploaded to the PubMLST website (https: / / pubmlst.org / ), and the assigned allele numbers were as follows: gatB: no perfectly matched sequence, the most recent matched allele number is 53, with three different loci: 226G→292A, 264C→330T; 267T→333C; CoxA: a perfectly matched sequence, with a matched allele number of 44; hcpA: a perfectly matched sequence, with a matched allele number of 358; FtsZ: no perfectly matched sequence, the most recent matched allele number is 260, with six different loci: 114A→168C; 225A→279G; 252A→306G; 291T→345C; 339T→393A; 348C→402T; FbpA: a perfectly matched sequence, with a matched allele number of 131. Because the new locus gene sequence database failed to include the corresponding allele number, the sequence type (ST) was not assigned.

[0065] Based on this, we can identify the Wolbachia strain found in the pine sawyer beetle as a novel strain and name it wAltA according to international nomenclature.

[0066] (iv) Identification and Preservation of Wolbachia

[0067] The Wolbachia species identified in step 2 was deposited and classified as Wolbachia pipientis. Its accession number at the China General Microbiological Culture Collection Center is CGMCC NO.46207.

[0068] (v) Artificial propagation of the pine beetle strain carrying Wolbachia

[0069] In step 2, select female pine sawyer beetles carrying Wolbachia and mix them with males not carrying Wolbachia. Use fresh pine twigs directly for rearing, replacing them with fresh pine twigs every 5 or 7 days, and clean the rearing cages. Place pine logs in the cages for the sawyer beetles to lay eggs naturally. Remove the logs when there are many egg-laying grooves. Place the egg-laying logs in a 25℃, 50% humidity environment. Once sawdust rises, use a knife to extract the second-instar larvae. Transfer the second-instar larvae to 10ml centrifuge tubes with holes punched in the top, and rear them with artificial feed at 25℃ until they emerge as adults. The females are used as maternal stock for propagation, while the males are used for control.

[0070] (vi) Release of male adult pine sawyer beetles carrying Wolbachia

[0071] A mating experiment was conducted in the laboratory between populations of *Pterocarya stenoptera* carrying *Wolbachia* and those without *Wolbachia* to observe the hatching of offspring eggs and verify the effectiveness of genetic control. The mating experiment consisted of four groups: cross 1: mating of adult *Pterocarya stenoptera* without *Wolbachia* in individual rearing boxes (5 replicates); cross 2: mating of adult *Pterocarya stenoptera* carrying *Wolbachia* with adult *Pterocarya stenoptera* without *Wolbachia* in individual rearing boxes (3 replicates); cross 3: mating of adult *Pterocarya stenoptera* without *Wolbachia* in individual rearing boxes (6 replicates); and cross 4: mating of adult *Pterocarya stenoptera* carrying *Wolbachia* in individual rearing boxes (4 replicates). Each pair of adult pine sawyer beetles was given 15 days of supplemental nutrition after emergence and placed in a log for egg laying. The logs were placed in each pair with roughly the same length, thickness, and moisture level, and were changed every 5 days for a total of 5 changes. The logs for each pair were stored separately. After being removed from the rearing box for 10 days, the eggs and larvae were dissected with a knife, the number of eggs and larvae was counted, and the larval hatching rate was calculated.

[0072] The experimental results are shown in Table 1 and Figure 1 As shown.

[0073] Table 1

[0074]

[0075]

[0076] The results showed that the average hatching rate of eggs in cross 1 was 92.34%; the average hatching rate of eggs in cross 2 was 93.54%; the average hatching rate of eggs in cross 3 was 3.02%; and the average hatching rate of eggs in cross 4 was 92.64%.

[0077] The hatching rate of eggs from mating between male and female *Pterocarya stenoptera* was 92.34%; the hatching rate from mating between male and female *Pterocarya stenoptera* carrying Wolbachia was 92.64%; the hatching rate from mating between female *Pterocarya stenoptera* carrying Wolbachia and male *Pterocarya stenoptera* not carrying Wolbachia was 93.54%; and the hatching rate from mating between female *Pterocarya stenoptera* not carrying Wolbachia and male *Pterocarya stenoptera* carrying Wolbachia was only 3.02%, a decrease of 96.73% compared to the group where neither male nor female carried Wolbachia. Therefore, the hatching rate of eggs from mating between male *Pterocarya stenoptera* infected with Wolbachia and female *Pterocarya stenoptera* not infected with Wolbachia is significantly reduced.

Claims

1. A species of Wolbachia pipientis, with accession number CGMCC NO.46207 from the China General Microbiological Culture Collection Center.

2. A method for controlling the pine sawyer beetle, comprising releasing male pine sawyer beetles carrying Wolbachia into the target control area for the pine sawyer beetle.

3. The prevention and control method according to claim 2, wherein the housekeeping genes of Wolbachia include gatB, coxA, hcpA, ftsZ, and fbpA. Preferably, the housekeeping gene gatB has the sequence of SEQ ID NO:17 or as shown in SEQ ID NO:17, the housekeeping gene coxA has the sequence of SEQ ID NO:18 or as shown in SEQ ID NO:18, the housekeeping gene hcpA has the sequence of SEQ ID NO:19 or as shown in SEQ ID NO:19, the housekeeping gene ftsZ has the sequence of SEQ ID NO:20 or as shown in SEQ ID NO:20, and the housekeeping gene fbpA has the sequence of SEQ ID NO:21 or as shown in SEQ ID NO:

21.

4. The prevention and control method according to claim 2 or 3, wherein the Wolbachia is the Pitischowbachia as described in claim 1.

5. The control method according to any one of claims 1-4, wherein the ratio of the number of male pine sawyer beetles carrying Wolbachia to the number of pine sawyer beetles in the target control area is 1:12:

1.

6. The control method according to any one of claims 1-5, wherein the method further comprises screening for male longhorn beetles carrying Wolbachia.

7. The control method according to any one of claims 1-6, wherein the method further comprises artificially breeding the male longhorn beetle carrying Wolbachia. Preferably, the artificial breeding involves mating a female pine beetle carrying Wolbachia with a male pine beetle not carrying Wolbachia to breed a male pine beetle carrying Wolbachia.

8. Uses of Wolbachia in the control of pine sawyer beetle.

9. The use according to claim 8, wherein the housekeeping genes of Wolbachia include gatB, coxA, hcpA, ftsZ, and fbpA. Preferably, the housekeeping gene gatB has the sequence of SEQ ID NO:17 or as shown in SEQ ID NO:17, the housekeeping gene coxA has the sequence of SEQ ID NO:18 or as shown in SEQ ID NO:18, the housekeeping gene hcpA has the sequence of SEQ ID NO:19 or as shown in SEQ ID NO:19, the housekeeping gene ftsZ has the sequence of SEQ ID NO:20 or as shown in SEQ ID NO:20, and the housekeeping gene fbpA has the sequence of SEQ ID NO:21 or as shown in SEQ ID NO:

21.

10. The use according to claim 8 or 9, wherein the Wolbachia is the Pitišovbachia body as described in claim 1.