Methylation marker combination, primer probe combination and kit for gastric cancer screening and application of methylation marker combination, primer probe combination and kit

Abstract

The invention discloses a methylation marker combination for gastric cancer screening, a corresponding primer probe combination, a kit and application thereof. The methylation marker combination related to the gastric cancer comprises a CpG methylation site cg07155336 of an NTNG1 gene, a CpG methylation site cg01043019 of an RSPO3 gene and a CpG methylation site cg26917673 of a BMP3 gene, and is characterized in that the CpG methylation site cg07155336 of the NTNG1 gene, the CpG methylation site cg01043019 of the RSPO3 gene and the CpG methylation site The methylation levels of the NTNG1, RSPO3 and BMP3 sites are related to gastric cancer staging, and the marker can be used as a high-specificity marker for early screening of gastric cancer. The primer probe combination for detecting the marker combination comprises a specific upstream primer, a downstream primer and a probe aiming at each marker. The kit comprises a primer probe combination, and also comprises a positive control, a negative control and a quality control reagent. Three-site combined detection is adopted, the detection sensitivity in a gastric cancer blood sample reaches 92% or above, the specificity reaches up to 100%, the method can be used for auxiliary screening, detection or molecular analysis related to gastric cancer and precancerous lesions of the gastric cancer, and a technical scheme high in sensitivity, high in specificity and good in repeatability is provided for clinical detection.

Description

Technical Field

[0001] This invention belongs to the fields of biotechnology and DNA detection technology, and relates to a combination of methylation biomarkers, primer-probe combination, and reagent kit for gastric cancer screening, as well as the application of the biomarker combination and reagent kit in gastric cancer detection. Background Technology

[0002] Gastric cancer (GC) is one of the leading causes of cancer-related deaths worldwide. According to the latest statistics released by the World Cancer Research Fund (WCRF) and the International Agency for Research on Cancer (IARC), there were approximately 969,000 new cases of gastric cancer and 660,000 deaths globally in 2022, both ranking among the top five malignant tumors. my country is a high-incidence area for gastric cancer, accounting for more than 40% of the global total in both cases and deaths. Although screening and treatment technologies have improved in recent years, most patients are diagnosed at an advanced stage, severely impacting treatment outcomes and survival rates.

[0003] Early-stage gastric cancer often presents with no obvious specific symptoms, resulting in a low early detection rate. The 5-year survival rate for stage 0 and stage I gastric cancer patients can exceed 90%, while the 5-year survival rate for stage III and IV patients is less than 30%. Therefore, improving early screening rates is crucial to reducing gastric cancer mortality.

[0004] Currently, the main screening and diagnostic methods for gastric cancer include gastroscopy, histopathological examination, imaging examinations, and tumor marker detection (such as CEA, CA19-9, CA72-4, etc.). Among these, gastroscopy combined with biopsy remains the gold standard for diagnosis, but it is complex, invasive, expensive, and has poor patient compliance, making it unsuitable for large-scale screening. While tumor marker detection is simple, its sensitivity and specificity are limited, especially in early-stage gastric cancer where the detection rate is low. Imaging examinations such as CT or MRI are also insufficient to detect early, small lesions.

[0005] With the development of molecular biology and epigenetics, molecular diagnostic methods based on DNA methylation detection have gradually become a hot topic in early cancer screening research. DNA methylation is a common and stable epigenetic modification that usually occurs on CpG islands in gene promoter regions, leading to gene transcriptional silencing. Multiple studies have shown that tumor cells exhibit specific methylation abnormalities in the early stages of carcinogenesis and can release these abnormalities into peripheral blood and gastric juice, thus making them ideal molecular markers for early cancer screening.

[0006] Current research on DNA methylation in gastric cancer has reported several candidate genes, including CDH1, RASSF1A, RNF180, and SEPTIN9. These biomarkers exhibit varying degrees of hypermethylation in gastric cancer tissues, but the sensitivity of single-gene detection is typically between 60% and 80%, with a specificity of approximately 80% to 90%, and false negatives and false positives remain issues. Some studies have attempted to combine the detection of multiple methylation sites to improve diagnostic accuracy, but a standardized testing system that can be widely applied in clinical practice has not yet been established.

[0007] Furthermore, currently approved or commercialized methylation detection products mainly focus on colorectal cancer (such as the FDA-approved Cologuard kit, which screens fecal DNA by detecting NDRG4 and BMP3 gene methylation). There are currently no highly sensitive, multi-site combined methylation detection products specifically for gastric cancer. Therefore, developing a gastric cancer methylation detection system with good stability, high specificity, and suitability for large-scale clinical screening has significant clinical importance and market value.

[0008] To address the challenges of balancing sensitivity and specificity, as well as insufficient early screening coverage in existing technologies, it is necessary to develop a specific methylation biomarker combination for gastric cancer and its matching primer-probe system. This multi-site combined detection approach can significantly improve detection sensitivity and specificity, enabling early and high-precision detection of gastric cancer and providing a reliable technical means for clinical screening and auxiliary diagnosis. Summary of the Invention

[0009] To address key issues in the early diagnosis of gastric cancer, such as insufficient sensitivity, low specificity, and poor compliance with traditional testing methods, this invention provides a novel gastric cancer screening scheme based on specific DNA methylation detection. By screening and validating combinations of methylation sites specific to gastric cancer, a highly specific and sensitive primer-probe system is designed, and a detection kit suitable for clinical and large-scale screening is constructed, thereby achieving early and high-precision detection of gastric cancer.

[0010] Existing methods for gastric cancer screening and auxiliary diagnosis have significant shortcomings: gastroscopy, while the gold standard, is highly invasive and has poor compliance; biomarkers have limited sensitivity and specificity; and imaging methods have low detection rates for early lesions. Although DNA methylation detection technology has proven effective in several tumors, there is still a lack of mature detection products specifically targeting gastric cancer with a stable combination of targets. To achieve the above objectives, this invention discloses a combination of methylation biomarkers for gastric cancer screening, wherein the combination of methylation biomarkers consists of target gene sequences or fragments thereof containing the following CpG methylation sites:

[0011] Methylation marker 1: CpG methylation site cg07155336 in the NTNG1 gene;

[0012] Methylation marker 2: CpG methylation site cg01043019 in the RSPO3 gene;

[0013] Methylation marker 3: CpG methylation site cg26917673 in the BMP3 gene.

[0014] The methylation status of the above three sites is significantly correlated with the occurrence of gastric cancer, and their combined detection can significantly improve detection sensitivity and specificity.

[0015] The cg07155336 site of the NTNG1 gene is contained in the nucleotide sequence shown in SEQ ID NO.16.

[0016] The cg01043019 site of the RSPO3 gene is contained in the nucleotide sequence shown in SEQ ID NO.17.

[0017] The cg26917673 site of the BMP3 gene is contained in the nucleotide sequence shown in SEQ ID NO.18.

[0018] On the other hand, this invention discloses a primer-probe combination for detecting the above-mentioned methylation marker combination, wherein the primer-probe combination includes an upstream primer, a downstream primer, and a probe targeting the methylation site of each methylation marker, wherein:

[0019] The upstream primer NTNG1-FP targeting the methylation site of methylation marker 1 is shown in SEQ ID NO.1, the downstream primer NTNG1-RP is shown in SEQ ID NO.2, and the probe NTNG1-P is shown in SEQ ID NO.3;

[0020] The upstream primer RSPO3-FP targeting the methylation site of methylation marker 2 is shown in SEQ ID NO.4, the downstream primer RSPO3-RP is shown in SEQ ID NO.5, and the probe RSPO3-P is shown in SEQ ID NO.6;

[0021] The upstream primer BMP3-FP targeting the methylation site of methylation marker 3 is shown in SEQ ID NO.7, the downstream primer BMP3-RP is shown in SEQ ID NO.8, and the probe BMP3-P is shown in SEQ ID NO.9.

[0022] Furthermore, the nucleotide sequences of the primers and the probes are designed based on the nucleotide sequences of the corresponding methylation sites of each target gene after sulfite modification. The sulfite-modified sequences are as follows:

[0023] The sulfite modification sequence of the NTNG1 gene is shown in SEQ ID NO.10;

[0024] The sulfite modification sequence of the RSPO3 gene is shown in SEQ ID NO.11;

[0025] The sulfite-modified sequence of the BMP3 gene is shown in SEQ ID NO.12.

[0026] Furthermore, the cg07155336 site of the NTNG1 gene under methylation is the second CG from the 5' end to the 3' end of the nucleotide sequence shown in SEQ ID NO.3;

[0027] The cg01043019 site of the RSPO3 gene under methylation is the second CG from the 5' end to the 3' end of the nucleotide sequence shown in SEQ ID NO.6;

[0028] In the methylated state, the cg26917673 site of the BMP3 gene is the second CG from the 5' end to the 3' end of the nucleotide sequence shown in SEQ ID NO.9.

[0029] The present invention also discloses a kit comprising the primer-probe combination described above for detecting the combination of methylation markers.

[0030] Furthermore, the kit also includes a positive control; the positive control includes a plasmid containing a sulfite-modified target gene methylation sequence and / or a gastric cancer cell line; the vector plasmid is selected from pUC57, pUC57-Kan, pUC57-Simple, pUC57-mini, pUC18, or pUC19; the gastric cancer cell line is selected from MKN-45, AGS, SGC-7901, BGC-823, or HGC-27, and the positive cell lines are all from the American Type Culture Collection (ATCC); the sulfite-modified target gene methylation sequences are as follows:

[0031] The sulfite modification sequence of the NTNG1 gene is shown in SEQ ID NO.10;

[0032] The sulfite modification sequence of the RSPO3 gene is shown in SEQ ID NO.11;

[0033] The sulfite-modified sequence of the BMP3 gene is shown in SEQ ID NO.12.

[0034] Furthermore, the kit also includes a quality control gene primer pair and a quality control gene probe; the quality control gene is β-actin, and the quality control gene primer pair consists of a forward primer and a reverse primer; the primer and probe sequences are as follows:

[0035] The quality control gene forward primer (ACTB-FP) is shown in SEQ ID NO.13;

[0036] The quality control gene reverse primer (ACTB-RP) is shown in SEQ ID NO.14;

[0037] The quality control gene probe (ACTB-P) is shown in SEQ ID NO.15.

[0038] In some embodiments, the reporter fluorescent group of the quality control gene probe and the reporter fluorescent groups of the probes NTNG1-P, RSPO3-P, and BMP3-P are each independently selected from one or more of FAM, VIC, NED, CY5, CY3, JOE, and HEX; the reporter quenching group of the quality control gene probe and the reporter quenching group of the probes NTNG1-P, RSPO3-P, and BMP3-P are each independently selected from one or more of MGB, BHQ1, BHQ2, and TAMRA.

[0039] Furthermore, the kit also includes a negative control; the negative control is normal human genomic DNA or DNA from the negative cell line 293T (derived from ATCC).

[0040] Furthermore, the test results of the kit are determined based on the qPCR analysis results of the primer-probe combination:

[0041] Quality control validity: Ct≤36 for β-actin indicates that the amount of DNA template loaded is within the allowable range and the result is reliable; Ct>36 indicates that the amount of DNA template loaded is outside the allowable range and the result is unreliable.

[0042] Site positivity determination: For NTNG1, RSPO3 and BMP3, a single site with Ct ≤ 40 is considered methylation positive, and a site with Ct > 40 is considered negative.

[0043] Combined determination: if any one site is methylated positive, it is determined to be gastric cancer positive; if all three sites are negative, it is determined to be gastric cancer negative.

[0044] Furthermore, the qPCR is real-time fluorescent qPCR, and its reaction conditions are as follows: 96℃ pre-denaturation for 3 minutes; 15 cycles: 95℃ denaturation for 15 seconds, 70℃ annealing and extension for 20 seconds, 64℃ annealing and extension for 20 seconds, and 72℃ extension for 10 seconds; 35 cycles: 95℃ denaturation for 15 seconds, 70℃ annealing and extension for 20 seconds, 60℃ annealing and extension for 34 seconds, and 72℃ extension for 10 seconds; and fluorescence signal is detected during annealing in all 35 cycles.

[0045] Preferably, the final concentration of each primer in the qPCR is 0.2–0.3 μM, and the final concentration of the probe is 0.2 μM.

[0046] Preferably, the qPCR amplification system is: 2×Premix Ex Taq TM (Probe qPCR) 20 μL, 50×Rox II 0.8 μL, final concentration of each primer 0.2-0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to make up to 40 μL.

[0047] Furthermore, it also includes other reagents required for qPCR reactions, such as polymerase, buffer, and dNTPs.

[0048] Preferably, the polymerase is 2×Premix Ex Taq. TM (Probe qPCR); the buffer solution is 50×Rox II. 2×Premix Ex Taq TM (Probe qPCR) contains dNTPs.

[0049] The CpG methylation sites cg07155336 of the NTNG1 gene, cg01043019 of the RSPO3 gene, and cg26917673 of the BMP3 gene have not been previously reported to be used simultaneously for gastric cancer detection. Multi-tumor comparisons showed high methylation in gastric cancer, but lower methylation levels in other tumors (pancreatic cancer, colorectal cancer, squamous cell carcinoma of the lung, adenocarcinoma of the lung, and esophageal cancer, etc.), indicating that the site combination has good specificity for gastric cancer. Therefore, this invention provides a novel DNA methylation biomarker for gastric cancer detection kits.

[0050] The clinical sample of this invention is peripheral blood from patients. It uses fluorescent qPCR detection technology, and the results directly detect changes during the qPCR process. The entire detection process has been optimized, resulting in fast detection speed and simple steps. Compared with existing methods, it has better sensitivity and more significant advantages in specificity. It solves the problems of difficulty in balancing sensitivity and specificity and insufficient early screening coverage in existing technologies, making it more suitable for early screening of gastric cancer.

[0051] This invention also relates to the application of the methylation biomarker combination of this patent application in the preparation of primers and probes or methylation detection reagents for gastric cancer detection, wherein the gastric cancer-related methylation biomarkers include the CpG methylation site cg07155336 of the NTNG1 gene, the CpG methylation site cg01043019 of the RSPO3 gene, and the CpG methylation site cg26917673 of the BMP3 gene; the primer and probe combination is used to detect the gastric cancer-related methylation biomarkers.

[0052] This invention also relates to the application of the kits described in this patent application in molecular analysis products for gastric cancer screening, detection, diagnosis, or prognostic assessment.

[0053] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0054] 1. Innovative three-point combination significantly improves detection performance.

[0055] This invention is the first to propose the combined application of the CpG methylation sites cg07155336 of the NTNG1 gene, cg01043019 of the RSPO3 gene, and cg26917673 of the BMP3 gene for gastric cancer detection. All three sites exhibit high methylation in gastric cancer samples, while methylation levels are lower in normal tissues and other tumors. Database sample analysis and clinical sample validation show that the combined detection of these three sites significantly improves sensitivity, with a detection sensitivity of 92.19% for gastric cancer and 80.95% for precancerous lesions; specificity reaches 100%, significantly superior to existing single-site (e.g., CDH1, RASSF1A) or dual-site (e.g., RNF180+SEPTIN9) detection schemes, solving the problem of difficulty in achieving both sensitivity and specificity in existing technologies.

[0056] 2. Easy to operate.

[0057] This invention uses peripheral blood DNA as the sample source, which is convenient and safe to collect, resulting in high patient compliance and suitability for large-scale screening. The entire testing process requires only one reaction tube to complete the three-point combined detection. The testing procedure is standardized and highly repeatable, making it suitable for widespread application in clinical laboratories and primary healthcare institutions.

[0058] 3. The detection system is sensitive, stable, and provides reliable results.

[0059] This invention employs TaqMan probe-based quantitative real-time PCR (qPCR) technology, which boasts high amplification specificity and sensitivity. By setting β-actin (ACTB) as an internal control gene, the quality of sample DNA and the effectiveness of the reaction system can be accurately determined, ensuring the accuracy and reproducibility of the detection results.

[0060] 4. It has good experimental reproducibility and high clinical application value.

[0061] The three-point joint detection system provided by this invention can effectively identify early gastric cancer, providing a highly sensitive, highly specific, low-cost, and reproducible detection method for early gastric cancer screening. It can be widely used in clinical screening, auxiliary diagnosis, and postoperative recurrence monitoring. Attached Figure Description

[0062] The following will further explain the concept, specific structure, and technical effects of the present invention in conjunction with the accompanying drawings, so as to fully understand the purpose, features, and effects of the present invention.

[0063] Figure 1 ROC curves were obtained by combined detection of cg01043019 (RSPO3), cg07155336 (NTNG1), and cg26917673 (BMP3).

[0064] Figure 2 ROC curves were obtained by joint detection of cg01043019 (RSPO3), cg07155336 (NTNG1), and cg01049530 (BMP3).

[0065] Figure 3 ROC curves were obtained by combined detection of cg19365062 (RSPO3), cg07155336 (NTNG1), and cg26917673 (BMP3).

[0066] Figure 4 ROC curves were obtained by combined detection of cg19365062 (RSPO3), cg07155336 (NTNG1), and cg01049530 (BMP3).

[0067] Figure 5 : Differences in the NTN G1 site between cancerous (T) and adjacent (N) tissues.

[0068] Figure 6 Differential analysis of RSPO3 sites in cancerous (T) and adjacent (N) tissues.

[0069] Figure 7 Differential analysis of BMP3 sites in cancerous (T) and adjacent (N) tissues. Detailed Implementation

[0070] The present invention will be further illustrated below with reference to the accompanying drawings, providing some non-limiting embodiments. However, it should be understood that these descriptions are merely illustrative and not intended to limit the scope of the invention. Furthermore, descriptions of common knowledge and techniques are omitted in the following description to avoid unnecessarily obscuring the concept of the invention.

[0071] Example 1: Site Screening Process

[0072] The key and challenge of this invention lies in finding three sites that can both ensure screening specificity and improve detection sensitivity. To determine this combination of sites, during the research and development process, the methylation numbers of nearly 13,000 tumors of 33 tumor types were analyzed using a database. The specific steps are as follows:

[0073] 1.1 We selected 450 samples (415 tumor samples and 35 normal samples) from the Stomach adenocarcinoma (STAD) database of The Cancer Genome Atlas (TCGA) database. We performed a Wilcoxon rank-sum test on 485,578 loci, setting threshold conditions: p-value < 0.01, mean β ≥ 0.2, and Δβ ≥ 0.2. 14,053 loci met these threshold conditions.

[0074] 1.2 Differential analysis was performed on sample data (111 normal samples) from the population blood methylation database (GSE33651 and GSE54129), and sites with methylation difference values ​​greater than 25%, i.e., 2145 sites, were retained.

[0075] 1.3 CpG sites (cytosine-phosphate-guanine sites, i.e., sites in the DNA sequence immediately following guanine after cytosine) with high methylation levels, associated with key genes of interest, were selected from 450 TCGA database samples and sorted in descending order of β difference (Δβ) ≥ 0.5, β difference (Δβ) ≥ 0.3, and β difference (Δβ) ≥ 0.2. DNA methylation in vertebrates generally occurs at CpG sites.

[0076] 1.4 The 16 loci selected in step 1.3 were combined and sorted in descending order according to the β difference (Δβ) ≥ 0.3. Four combinations with a frequency greater than 95% were selected (see Table 1), and ROC curves of these four combinations were plotted using data from the Cancer Genome Atlas database (see Table 1). Figure 1 , Figure 2 , Figure 3 and Figure 4 The results were consistent with those in Table 1. Further analysis of cell, tissue, and blood samples was conducted to select the most sensitive and specific locus combinations. The screening process for the four combinations in Table 1 is described in Example 2 and Comparative Example 1. Finally, the optimal combination—Combination 1 in Table 1 (cg07155336 locus of the NTNG1 gene, cg01043019 locus of the RSPO3 gene, and cg26917673 locus of the BMP3 gene)—was selected for further research.

[0077] Table 1. Combinations with a frequency greater than 95% after being sorted in descending order.

[0078]

[0079] Example 2 Primer and probe design and screening

[0080] This invention utilizes plasmids containing nucleotide sequences of methylation sites in the NTNG1, RSPO3, and BMP3 genes after sulfite modification, and DNA from the positive cell line MKN-45 as templates to construct a real-time fluorescent qPCR detection system for NTNG1, RSPO3, and BMP3 gene methylation. VIC, FAM, and NED are used as fluorescence signal detection targets. Through optimized combinations of primers for NTNG1, RSPO3, and BMP3 gene methylation and optimization of the fluorescent probe detection system, rapid and accurate detection is achieved. The specific steps are as follows:

[0081] The plasmid is a synthetic plasmid obtained by inserting a pre-designed target gene sequence fragment into a molecular cloning vector plasmid at Sangon Biotech (Shanghai) Co., Ltd. The target gene sequence includes the nucleotide sequences of the methylation sites of the NTNG1 gene, the RSPO3 gene, and the BMP3 gene after sulfite modification.

[0082] NTNG1 gene nucleotide sequence (SEQ ID NO.16, containing the cg07155336 site):

[0083] GGAGCGAGGAGGCGCGGAGGAGAGCCGGCGAGCAGGGGACTGGGCTGGCACGACCTCCGAAGGCTGAGATCTCATTATTAATATCACTATATTTTTGGAGGGAGAGGCACCTTTCTCATCCTCTCTTCCTCTCCGCCCACCCTTACTCCCTCCCCCTCATCTACCTGTCAAAGTCACTGATCTTTTGCATTTCGGAAGAGGACGTCAACGGGAAGGAATTCCCCCTCTGGGTGCGGGCTCCGAGAGGGGGCGACTTGCAGGAGGCTCCCCCCGGGGGCGGAGGCGAAGGTAATTAAGCGGCGGGGAGTGGCGGGCCGGCGCTGGGTTCTCGGTCCTCGGGGTCCTCTCCCGCCGGCGGCCGGGCGCGATCGGAATCCCCGGGCTGCGGCGGTGGCGGCGGCTCGGGTCCTCACGCCCACCCCTCCCGCTCCGCCCGCTCCCGCCTGGGGAGGAGGCTCCGCGGGAGCTGCCGCCCTCCGCCCGTACGCCGCCCGCGGGCTCCGCTGCTGCGGCCGCCGCCCGAGGCGGACCAGGCTGGCTGCGCAGGGCCGCCGCCCCGCGCCGTCGGCTCGGCTCCCGCCCGGCGCAAGGGCAAACGAGCC

[0084] Nucleotide sequence of the RSPO3 gene (SEQ ID NO.17, containing the cg01043019 locus):

[0085] AGAGGAGAAGTCCCGCTGCTCGGGCACTGTCTATATACGCCTAACACCTACATATATTTTAAAAACATTAAATATAATTAACAATCAAAAGAAAGAGGAGAAAGGAAGGGAAGCATTACTGGGTTACTATGCACTTGCGACTGATTTCTTGGCTTTTTATCATTTTGAACTTTATGGAATACATCGGCAGCCAAAACGCCTCCCGGGGAAGGCGCCAGCGAAGAAGTAAGTGCAGGGTTTTTTACGCGTTTGCTCCCTCCCGCCGCGTTCACCTGTCGGGTCGCTTTGCCTGTCCGGAGCCGGCTCCCAACTGCAGCGGTCCTCCCGCCCTGCGCCTCGCAGAGGAGATGCAGGTTCGGGCTTTGGGGGTATGGACGGCGTCTTTCACCCTTGCCTCTCGGCGCCCCTGCCTTCCGCAGCATCCTAGCCGGTGCGAGGGGCGGGCGGACGCGGCGCTAAGGTGGCTCCCGCCCCATGGTAACTTCAGGTTCGCGGGAAAGTTCGGTCCTGGGTTAGACTCGCACCCGGGATTTGTGCTTTCCTTTTGAGGATCGGACAGGGGCACCCAGCCGAAGGCACTTGGGACTCCCAGACGCAGGATG

[0086] Nucleotide sequence of BMP3 gene (SEQ ID NO.18, containing the cg26917673 locus):

[0087] CCGCTGCCAGTTCTCTGGTTACTCCCCCCCTCCCTTGCTTCTATCCCAGCCTGGTGCAAGCTAAGAGGGCGAGGACGAGGGAGTGGGAGAGATTGGCTGAGGACTCTACAGATCAGCTAGAGAGCGAAAGAACTAAGTCTCTCTCTCTCATACACACACACACACGCACACACGCGCGCGCGCGCGCGCACACACACACACACGTACACTAAAAAACTCGGACCAGCCGCGCCGCAGCTGCTCCAATCCCTGGAAAAGGCAATCGAGCGCCCTCCGGACCGCTGCGCACAGCCCCGGCTCCGACCTGGCGCCCAAAACAGAGCTAGTCCTAGTCCCTCGCGCGGCCAGTTTGGCCGGGTGTTCCCAAAAATAAAGCGAGGAGGGAAGGTACAGACAGATCTTGAAAACACCCGGGCCACACACGCCGCGACCTACAGCTCTTTCTCAGCGTTGGAGTGGAGACGGCGCCCGCAGCGCCCTGCGCGGGTGAGGTCCGCGCAGCTGCTGGGGAAGAGCCCACCTGTCAGGCTGCGCTGGGTCAGCGCAGCAAGTGGGGCTGGCCGCTATCTCGCTGCACCCGGCCGCGTCCCGGGCTCCGTGCG

[0088] Nucleotide sequence of methylation site after bisulfite modification of NTNG1 gene (SEQ ID NO.10, NTNG1-S-L (cg07155336) contains the cg07155336 site):

[0089] NTNG1-S-L(cg07155336):

[0090] GGAGCGAGGAGGCGCGGAGGAGAGTCGGCGAGTAGGGGATTGGGTTGGTACGATTTTCGAAGGTTGAGATTTTATTATTAATATTATTATATTTTTGGAGGGAGAGGTATTTTTTTTATTTTTTTTTTTTTTTCGTTTATTTTTATTTTTTTTTTTTTATTTATTTGTTAAAGTTATTGATTTTTTGTATTTCGGAAGAGGACGTTAACGGGAAGGAATTTTTTTTTTGGGTGCGGGTTTCGAGAGGGGGCGATTTGTAGGAGGTTTTTTTCGGGGGCGGAGGCGAAGGTAATTAAGCGGCGGGGAGTGGCGGGTCGGCGTTGGGTTTTCGGTTTTCGGGGTTTTTTTTCGTCGGCGGTCGGGCGCGATCGGAATTTTCGGGTTGCGGCGGTGGCGGCGGTTCGGGTTTTTACGTTTATTTTTTTCGTTTCGTTCGTTTTCGTTTGGGGAGGAGGTTTCGCGGGAGTTGTCGTTTTTCGTTCGTACGTCGTTCGCGGGTTTCGTTGTTGCGGTCGTCGTTCGAGGCGGATTAGGTTGGTTGCGTAGGGTCGTCGTTTCGCGTCGTCGGTTCGGTTTTCGTTCGGCGTAAGGGTAAACGAGTT

[0091] Nucleotide sequence of methylation site after bisulfite modification of RSPO3 gene (SEQ ID NO.11, RSPO3-S-L (cg01043019) contains the cg01043019 site):

[0092] RSPO3-S-L (cg01043019):

[0093] AGAGGAGAAGTTTCGTTGTTCGGGTATTGTTTATATACGTTTAATATTTATATATATTTTAAAAATATTAAATATAATTAATAATTAAAAGAAAGAGGAGAAAGGAAGGGAAGTATTATTGGGTTATTATGTATTTGCGATTGATTTTTTGGTTTTTTATTATTTTGAATTTTATGGAATATATCGGTAGTTAAAACGTTTTTCGGGGAAGGCGTTAGCGAAGAAGTAAGTGTAGGGTTTTTTACGCGTTTGTTTTTTTTCGTCGCGTTTATTTGTCGGGTCGTTTTGTTTGTTCGGAGTCGGTTTTTAATTGTAGCGGTTTTTTCGTTTTGCGTTTCGTAGAGGAGATGTAGGTTCGGGTTTTGGGGGTATGGACGGCGTTTTTTATTTTTGTTTTTCGGCGTTTTTGTTTTTCGTAGTATTTTAGTCGGTGCGAGGGGCGGGCGGACGCGGCGTTAAGGTGGTTTTCGTTTTATGGTAATTTTAGGTTCGCGGGAAAGTTCGGTTTTGGGTTAGATTCGTATTCGGGATTTGTGTTTTTTTTTTGAGGATCGGATAGGGGTATTTAGTCGAAGGTATTTGGGATTTTTAGACGTAGGATG

[0094] Nucleotide sequence of methylation site after bisulfite modification of BMP3 gene (SEQ ID NO.12, BMP3-S-L (cg26917673) contains the cg26917673 site):

[0095] BMP3-S-L (cg26917673):

[0096] TCGTTGTTAGTTTTTTGGTTATTTTTTTTTTTTTTTGTTTTATTTTAGTTTTGGTGTAAGTTAAGAGGGCGAGGACGAGGGAGTGGGAGAGATTGGTTGAGGATTTTATAGATTAGTTAGAGAGCGAAAGAATTAAGTTTTTTTTTTTTA TATATATATATATACGTATATACGCGCGCGCGCGCGTATATATATATATACGTATATTAAAAAATTCGGATTAGTCGCGTCGTAGTTGTTTTAATTTTTGGAAAAGGTAATCGAGCGTTTTTCGGATCGTTGCGTATAGTTTCGGTTTC GATTTGGCGTTTAAAATAGAGTTAGTTTTAGTTTTTCGCGCGGTTAGTTTGGTCGGGTGTTTTTAAAAATAAAGCGAGGAGGGAAGGTATAGATAGATTTTGAAAATATTCGGGTTATATACGTCGCGATTTATAGTTTTTTTTTAGCGT TGGAGTGGAGACGGCGTTCGTAGCGTTTTGCGGGTGAGGTTCGCGTAGTTGTTGGGGAAGAGTTTATTTGTTAGGTTGCGTTGGGTTAGCGTAGTAAGTGGGGTTGGTCGTTATTTCGTTGTATTCGGTCGCGTTTCGGGTTTCGTGCG

[0097] The molecular cloning vector plasmid used was pUC57.

[0098] The positive cell line MKN-45 was derived from the American Type Culture Collection (ATCC).

[0099] 1. For the detection of methylation of the NTNG1, RSPO3, and BMP3 genes, 26 primer-probe combinations were designed using Primer5 software. For positive cell lines, tissues, and blood (e.g., Examples 2, 3, and Comparative Example 1), actin was used as a quality control gene (or internal reference gene). Primers Actin-FP and Actin-RP were used as quality control primers, and probe Actin-P was used as a quality control probe for quality control. Commonly used actins include β-actin (ACTB), but are not limited to β-actin; α-actin, γ-actin, etc., can also be used. This example uses ACTB as a quality control gene for illustration.

[0100] Quality control gene forward primer (ACTB-FP): 5'-GGTGTTTAAGATAGTGTTGTGGGTG-3' (SEQ ID NO. 13)

[0101] Quality control gene reverse primer (ACTB-RP): 5'-CACACTCCAAAACCGCTTTACA-3' (SEQ ID NO.14)

[0102] The quality control gene probe (ACTB-P) is: 5'-ACCTCATAACCTTATCACAC-3' (SEQ ID NO.15)

[0103] 2. Using 2×10 3 Using the synthesized plasmid as a template, real-time fluorescence qPCR amplification (total volume 40 μL) was performed using different primer and probe combinations according to the following amplification system:

[0104] 2×Premix Ex Taq TM (Probe qPCR) 20 μL, Rox II (50×) 0.8 μL, final concentration of each primer 0.2-0.3 μM, final concentration of probe 0.2 μM, DNA template, and water to make up to 40 μL.

[0105] The 2×Premix Ex Taq used in the real-time fluorescence qPCR amplification is described above. TM (Probe qPCR) and Rox II (50×) were from TAKARA.

[0106] The reaction conditions for real-time fluorescence qPCR are as follows:

[0107] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0108] The primer-probe combinations and detection results are shown in Table 2. A second round of probe and primer screening was conducted in positive cell lines using one set of RSPO3 primer-probe combinations (combination 1), one set of NTNG1 primer-probe combinations (combination 26), and one set of BMP3 primer-probe combinations (combination 4).

[0109] Table 2 Primer and probe sets

[0110]

[0111]

[0112] 3. Using 10 ng of DNA from the positive cell line MKN-45 as a template, qPCR amplification was performed using the primer and probe combination selected in the previous step for NTNG1, RSPO3, and BMP3. The qPCR system and reaction conditions were the same as in the previous step.

[0113] The primer-probe combinations and detection results are shown in Table 3. NTNG1 combination 26 (NTNG1-FP4, NTNG1-RP4, and NTNG1-P2) showed high methylation in gastric cancer-positive cell lines, and the amplification curve of this primer-probe combination exhibited an "S" shape with strong fluorescence signal. RSPO3 combination 1 (RSPO3-FP1, RSPO3-RP1, and RSPO3-P1) showed high methylation in gastric cancer-positive cell lines, and the amplification curve of this primer-probe combination exhibited an "S" shape with strong fluorescence signal. BMP3 combination probe 4 (BMP3-FP2, BMP3-RP2, and BMP3-P1) showed high methylation in gastric cancer-positive cell lines, and the amplification curve of this primer-probe combination exhibited an "S" shape with strong fluorescence signal. The primer sequences are as follows:

[0114] Preferred probe primers for NTNG1:

[0115] NTNG1-FP4: 5'-GAGAGGGGGCGATTTGTAGG-3' (SEQ ID NO.1)

[0116] NTNG1-RP4: 5'-CGAAAACCGAAAACCCAAC-3'(SEQ ID NO.2)

[0117] NTNG1-P2: (SEQ ID NO.3, cg07155336 is circled in a box)

[0118] Preferred probe primers for RSPO3:

[0119] RSPO3-FP1: 5'-GCGTTTGTTTTTTCGTCG-3' (SEQ ID NO.4)

[0120] RSPO3-RP1: 5'-CCTCTACGAAACGCAAAACGA-3' (SEQ ID NO.5)

[0121] RSPO3-P1: (SEQ ID NO.6, cg01043019 is circled in a box)

[0122] Preferred probe primers for BMP3:

[0123] BMP3-FP2:5'-TTTGGAAAAGGTAATCGAGCG-3' (SEQ ID NO.7)

[0124] BMP3-RP2:5'-ACTAACCGCGCGAAAAACTA-3' (SEQ ID NO.8)

[0125] BMP3-P1: (SEQ ID NO.9, cg26917673 fragment sequence)

[0126] Enjoy 2 units on the beach:

[0127] NTNG1-FP1:5′-GGGTGCGGGTTTCGAGAGGG-3′(SEQ ID NO.19)

[0128] NTNG1-FP2:5′-GAAGAGGACGTTAACGGGAAGG-3′(SEQ ID NO.20)

[0129] NTNG1-FP3:5'-GCGATTTGTAGGAGGTTTTT-3' (SEQ ID NO.21)

[0130] NTNG1-RP1:5'-GAAAACCCAACGCCGACC-3' (SEQ ID NO.22)

[0131] NTNG1-RP2:5'-GATCGCGCCCGACCGCCGACGAAA-3' (SEQ ID NO.23)

[0132] NTNG1-RP3:5'-AAAAAACCCCGAAAACCG-3' (SEQ ID NO.24)

[0133] NTNG1-P1:5′-AATTAAGCGGCGGGGA-3′(SEQ ID NO.25)

[0134] RSPO3-FP2:5'-CGTTTATTTGTCGGGTCGTTTTG-3' (SEQ ID NO.26)

[0135] RSPO3-FP3:5′-GTGTAGGGTTTTTTACGCGTTTG-3′(SEQ ID NO.27)

[0136] RSPO3-RP2:5’-GCAAAACGAAAAAACCGCTAC-3’(SEQ ID NO.28)

[0137] RSPO3-RP3:5’-CTACATCTCCTCTACGAAACGC-3’(SEQ ID NO.29)

[0138] RSPO3-RP4:5’-CGAACCTACATCTCCTCTACG-3’(SEQ ID NO.30)

[0139] RSPO3-RP5:5’-AACCCGAACCTACATCTCCTC-3’(SEQ ID NO.31)

[0140] RSPO3-RP6:5’-CCCCAAAACCCGAACCTACATC-3’(SEQ ID NO.32)

[0141] RSPO3-RP7:5’-GCCGTCCATACCCCCAAAACCCG-3’(SEQ ID NO.33)

[0142] RSPO3-P2:5’-CGGAGTCGGTTTTTA-3’(SEQ ID NO.34)

[0143] BMP3-FP1:5’-CGAGCGTTTTTCGGATCGTTGCG-3’(SEQ ID NO.35)

[0144] BMP3-FP3:5’-CGTAGTTGTTTTAATTTTTGG-3’(SEQ ID NO.36)

[0145] BMP3-RP1:5’-CTAAAACTAACTCTATTTT-3’(SEQ ID NO.37)

[0146] BMP3-RP3:5’-GCGAAAAACTAAAACTAACTC-3’(SEQ ID NO.38)

[0147] BMP3-RP4:5’-CTAACCGCGCGAAAAACTAAAAC-3’(SEQ ID NO.39)

[0148] BMP3-RP5:5’-CCGACCAAACTAACCGCGCG-3’(SEQ ID NO.40)

[0149] BMP3-RP6: 5'-AAAACCCCGACCAAACTAACC-3' (SEQ ID NO.41)

[0150] BMP3-RP7: 5'-CTTTATTTTTAAAAACACCCGACC-3' (SEQ ID NO.42)

[0151] BMP3-P1: 5'-TCGGTTTCGATTTGGCG-3' (SEQ ID NO.43)

[0152] Table 3. Probe and primer combinations and screening results for positive cell lines.

[0153]

[0154] 4. Sensitivity analysis: The plasmid template was diluted from 10,000 copies to 5 copies, and then detected separately. The results showed that the fluorescent PCR method of the present invention has high sensitivity. The primers can detect the corresponding plasmid sample with 5 copies / 40 μL (as shown in Table 4).

[0155] Table 4 Results of plasmid serial dilution

[0156] plasmid copy number NTNG1 RSPO3 BMP3 <![CDATA[1×10 4 ]]> 26.29 27.48 26.89 <![CDATA[1×10 3 ]]> 28.31 29.31 28.95 <![CDATA[1×10 2 ]]> 30.42 31.65 30.76 50 31.51 32.69 31.94 25 32.37 33.54 32.83 10 33.58 34.74 34.12 5 34.61 36.52 35.85 0 No Ct No Ct No Ct

[0157] Example 3: Tissue and Blood Sample Detection

[0158] 1. Using organizations as samples

[0159] Gastric cancer and adjacent tissue specimens removed surgically or endoscopically were selected, and the methylation levels of the RSPO3, NTNG1, and BMP3 genes were quantitatively detected. The specimens consisted of 18 pairs of paired gastric cancer and adjacent tissues. The preferred primer-probe combination and real-time fluorescent qPCR reaction system of this invention were used to detect the cancerous tissue and its paired adjacent tissue samples.

[0160] Step 1, Sample processing, DNA extraction and transformation:

[0161] DNA was extracted from tissue cells using a cell DNA extraction kit (purchased from QIAGEN). For specific procedures, please refer to the kit's instruction manual.

[0162] Step 2, sulfite modification:

[0163] The extracted cellular DNA was modified with sulfite using the EZDNA methylation kit (purchased from ZYMORESEARCH). For specific instructions, please refer to the kit's manual.

[0164] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0165] 2×Premix Ex Taq TM (Probe qPCR) 20 μL, Rox II (50×) 0.8 μL, final concentration of each primer 0.2–0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to a final volume of 40 μL. The sulfite-modified cellular DNA obtained in step 2 was used as the template.

[0166] 2×Premix Ex Taq in qPCR amplification TM (Probe qPCR) and Rox II (50×) were from TAKARA.

[0167] The reaction conditions for real-time fluorescence qPCR are as follows:

[0168] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0169] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0170] If the number of cycles (Ct) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is ≤36, it indicates that the amount of sample DNA is within the allowable range and the result is reliable. If the number of cycles (CT) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is >36, the sample is considered invalid. Under valid detection conditions, if the CT value of the RSPO3 gene is ≤40, or the CT value of the NTNG1 gene is ≤40, or the CT value of the BMP3 gene is ≤40, the sample test result is "positive"; if the CT value of the RSPO3 gene is >40, the CT value of the NTNG1 gene is >40, and the CT value of the BMP3 gene is >40, the sample test result is "negative".

[0171] The results (Table 5) show that the sensitivity of individual site detection in the tissue samples of this invention was 100%, and the sensitivity of combined detection was also 100%. Difference analysis was performed on the Ct values ​​detected in cancerous tissue (T) and adjacent normal tissue (N), such as... Figure 5 , Figure 6 and Figure 7 As shown, the NTNG1, RSPO3, and BMP3 sites all showed significant differences between cancerous tissue (T) and adjacent normal tissue (N).

[0172] Table 5. Results of tissue sample testing

[0173]

[0174]

[0175] 2. Using blood as a sample

[0176] 125 blood samples were selected, of which 64 were diagnosed with gastric cancer, 21 with precancerous lesions, and 40 were normal via gastroscopy. The methylation levels of the RSPO3, NTNG1, and BMP3 genes were quantitatively detected. Using the preferred primer-probe combination and qPCR reaction system of this invention, blood samples from 64 clinical gastric cancer patients, 21 patients with precancerous lesions, and 40 healthy individuals were analyzed. Sample information is shown in Tables 6-8.

[0177] Table 6 Clinical Diagnostic Information of Blood Samples for Gastric Cancer

[0178]

[0179]

[0180] Table 7 Clinical Diagnostic Information of Blood Samples from Precancerous Lesions

[0181] Sample number Clinical diagnosis Sample type AP-001 Precancerous lesions blood AP-002 Precancerous lesions blood AP-003 Precancerous lesions blood AP-004 Precancerous lesions blood AP-005 Precancerous lesions blood AP-006 Precancerous lesions blood AP-007 Precancerous lesions blood AP-008 Precancerous lesions blood AP-009 Precancerous lesions blood AP-010 Precancerous lesions blood AP-011 Precancerous lesions blood AP-012 Precancerous lesions blood AP-013 Precancerous lesions blood AP-014 Precancerous lesions blood AP-015 Precancerous lesions blood AP-016 Precancerous lesions blood AP-017 Precancerous lesions blood AP-018 Precancerous lesions blood AP-019 Precancerous lesions blood AP-020 Precancerous lesions blood AP-021 Precancerous lesions blood

[0182] Table 8 Clinical Diagnostic Information of Blood Samples from Normal Individuals

[0183]

[0184]

[0185] Sample testing experimental procedure:

[0186] Step 1, molecular hybridization capture.

[0187] 1.1 Nucleic acid extraction

[0188] 1. Take 500 μL of blood into a centrifuge tube and add lysis buffer, proteinase K and magnetic beads (TIANGEN, DP709). Shake to mix and incubate at room temperature for 20 min.

[0189] 2. Place the centrifuge tube on the magnetic rack for 2 minutes. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0190] 3. Add 750 μl of protein removal solution, invert and mix for 30 seconds to fully suspend the magnetic beads, and briefly centrifuge to remove droplets from the inner wall of the tube cap.

[0191] 5. Place the centrifuge tube on the magnetic rack for 1 minute. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0192] 6. Add 750 μl of rinsing solution, invert and mix for 30 seconds to fully suspend the magnetic beads, and briefly centrifuge to remove droplets from the inner wall of the tube cap.

[0193] 7. Place the centrifuge tube on the magnetic rack for 1 minute. Once the magnetic beads are fully adsorbed, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0194] 8. Repeat steps 6 and 7 once.

[0195] 9. Place the centrifuge tubes on the magnetic rack, remove and discard all liquid, and let them air dry at room temperature for 10 minutes.

[0196] 10. Add 50 μl of elution buffer, use a pipette to resuspend the magnetic beads, and incubate at 56°C for 5 min, gently shaking every 2 min to ensure complete elution of nucleic acids.

[0197] 11. Place the centrifuge tube on the magnetic rack and let it stand for 2 minutes. Once the magnetic beads have been completely adsorbed, carefully transfer the nucleic acid solution to a new centrifuge tube.

[0198] 1.2 Hybrid Capture

[0199] 1. Take the DNA solution dissolved in the previous step into a PCR tube, and add the probe, hybridization buffer and water.

[0200] 2. Set the PCR program according to the following parameters:

[0201] ①98℃ for 5 minutes;

[0202] ②65℃ for 1 hour;

[0203] ③ Hold at 65℃ (heat preservation).

[0204] 1.3 Purification and Recovery

[0205] 1. Remove the streptavidin magnetic beads, place them on a magnetic rack, and discard the supernatant.

[0206] 2. Add cleaning solution, vortex, place on a magnetic rack, and carefully remove the supernatant.

[0207] 3. Add binding solution: Add the solution from step 1.2 to the magnetic beads containing binding solution, and place them on a rotary mixer to rotate at room temperature for 30 minutes.

[0208] 4. After the rotation incubation is complete, add the washing solution WB1, place it on a magnetic rack, and carefully aspirate the supernatant.

[0209] 5. Add rinsing solution WB2, place on a magnetic rack, and carefully aspirate the supernatant.

[0210] 6. Add 80% ethanol, place on a magnetic rack, and carefully aspirate the supernatant.

[0211] 7. Open the tube cap and let it stand at room temperature for 5 minutes to allow the remaining alcohol to evaporate completely. Remove the centrifuge tube from the magnetic rack, add 45 μL of purified water to the centrifuge tube, and vortex to mix thoroughly to completely disperse the magnetic beads. The resulting solution can be used for subsequent sulfite conversion.

[0212] Step 2: Perform sulfite conversion on the extracted DNA sample (EZ DNA Methylation Kit, purchased from ZYMO RESEARCH).

[0213] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0214] 2×Premix Ex Taq TM (Probe qPCR) 20 μL, Rox II (50×) 0.8 μL, final concentration of each primer 0.2–0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to bring the volume to 40 μL. Use the sulfite-modified DNA obtained in step 2 as a template.

[0215] 2×Premix Ex Taq in qPCR amplification TM (Probe qPCR) and Rox II (50×) were from TAKARA.

[0216] The qPCR reaction conditions are as follows:

[0217] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0218] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0219] If the number of cycles (Ct) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is ≤36, it indicates that the amount of sample DNA is within the allowable range and the result is reliable. If the number of cycles (CT) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is >36, the sample is considered invalid. Under valid detection conditions, if the CT value of the RSPO3 gene is ≤40, or the CT value of the NTNG1 gene is ≤40, or the CT value of the BMP3 gene is ≤40, the sample test result is "positive"; if the CT value of the RSPO3 gene is >40, the CT value of the NTNG1 gene is >40, and the CT value of the BMP3 gene is >40, the sample test result is "negative".

[0220] In 125 blood samples (64 gastric cancer cases, 21 precancerous lesions, and 40 normal samples), the methylation levels of RSPO3, NTNG1, and BMP3 genes were detected. The results (Table 9) show that the sensitivity of NTNG1 gene detection alone was 66.67% (precancerous lesions) and 84.38% (gastric cancer), with a specificity of 100% for both; the sensitivity of RSPO3 gene detection alone was 71.43% (precancerous lesions) and 85.94% (gastric cancer), with a specificity of 100% for both; the sensitivity of BMP3 gene detection alone was 76.19% (precancerous lesions) and 89.06% (gastric cancer), with a specificity of 100% for both; and the sensitivity of combined detection of the three genes was 80.95% (precancerous lesions) and 92.19% (gastric cancer), with a specificity of 100% for both.

[0221] Table 9. Blood Sample Test Results

[0222]

[0223] Comparative Example 1

[0224] Based on the descending order of β difference (Δβ) ≥ 0.3 (Table 1), primers and probes were designed for the corresponding sites of combinations 2, 3, and 4, and the sequences are as follows:

[0225] RSPO3-5062-FP: 5'-CGTCGTTGTAGTCGTAGTCGTCG-3' (SEQ ID NO.44)

[0226] RSPO3-5062-RP:5'-TTATACGACAACTACCGCAAACG-3'(SEQ ID NO.45)

[0227] RSPO3-5062-P: (SEQ ID NO.46)

[0228] BMP3-9530-FP: 5'-CGGATTAGTCGCGTCGTAGTTG-3' (SEQ ID NO.47)

[0229] BMP3-9530-RP: 5'-TTAAACGCCAAATCGAAACCG-3' (SEQ ID NO.48)

[0230] BMP3-9530-P: (SEQ ID NO.49)

[0231] Blood samples from gastric cancer patients were tested using a selected primer-probe combination and a real-time fluorescence qPCR reaction system.

[0232] The steps are as follows:

[0233] Thirty-six blood samples were selected, including 17 cases of gastric cancer, 9 cases of precancerous lesions, and 10 cases of normal individuals. The methylation levels of relevant genes were quantitatively detected.

[0234] Step 1, molecular hybridization capture.

[0235] 1.1 Nucleic acid extraction

[0236] 3. Take 500 μL of blood into a centrifuge tube and add lysis buffer, proteinase K and magnetic beads (TIANGEN, DP709). Shake to mix and incubate at room temperature for 20 min.

[0237] 4. Place the centrifuge tube on the magnetic rack for 2 minutes. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0238] 3. Add 750 μl of protein removal solution, invert and mix for 30 seconds to fully suspend the magnetic beads, and briefly centrifuge to remove droplets from the inner wall of the tube cap.

[0239] 5. Place the centrifuge tube on the magnetic rack for 1 minute. After the magnetic beads are completely attracted, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0240] 6. Add 750 μl of rinsing solution, invert and mix for 30 seconds to fully suspend the magnetic beads, and briefly centrifuge to remove droplets from the inner wall of the tube cap.

[0241] 12. Place the centrifuge tube on the magnetic rack for 1 minute. Once the magnetic beads are fully adsorbed, carefully remove the liquid with a pipette and remove the centrifuge tube.

[0242] 13. Repeat steps 6 and 7 once.

[0243] 14. Place the centrifuge tubes on a magnetic rack, remove and discard all liquid, and let them air dry at room temperature for 10 minutes.

[0244] 15. Add 50 μl of elution buffer, use a pipette to resuspend the magnetic beads, and incubate at 56°C for 5 min, gently shaking every 2 min to ensure complete elution of nucleic acids.

[0245] 16. Place the centrifuge tube on the magnetic rack and let it stand for 2 minutes. Once the magnetic beads have been completely adsorbed, carefully transfer the nucleic acid solution to a new centrifuge tube.

[0246] 1.2 Hybrid Capture

[0247] 1. Take the DNA solution dissolved in the previous step into a PCR tube, and add the probe, hybridization buffer and water.

[0248] 2. Set the PCR program according to the following parameters:

[0249] ④ 98℃ for 5 minutes;

[0250] ⑤ 65℃ for 1 hour;

[0251] ⑥ Hold at 65℃ (heat preservation).

[0252] 1.3 Purification and Recovery

[0253] 1. Remove the streptavidin magnetic beads, place them on a magnetic rack, and discard the supernatant.

[0254] 2. Add cleaning solution, vortex, place on a magnetic rack, and carefully remove the supernatant.

[0255] 3. Add binding solution: Add the solution from step 1.2 to the magnetic beads containing binding solution, and place them on a rotary mixer to rotate at room temperature for 30 minutes.

[0256] 4. After the rotation incubation is complete, add the washing solution WB1, place it on a magnetic rack, and carefully aspirate the supernatant.

[0257] 5. Add rinsing solution WB2, place on a magnetic rack, and carefully aspirate the supernatant.

[0258] 6. Add 80% ethanol, place on a magnetic rack, and carefully aspirate the supernatant.

[0259] 7. Open the tube cap and let it stand at room temperature for 5 minutes to allow the remaining alcohol to evaporate completely. Remove the centrifuge tube from the magnetic rack, add 45 μL of purified water to the centrifuge tube, and vortex to mix thoroughly to completely disperse the magnetic beads. The resulting solution can be used for subsequent sulfite conversion.

[0260] Step 2: Perform sulfite conversion on the extracted DNA sample (EZ DNA Methylation Kit, purchased from ZYMO RESEARCH).

[0261] Step 3: Perform qPCR amplification according to the following amplification system (total volume 40 μL).

[0262] 2×Premix Ex Taq TM (Probe qPCR) 20 μL, Rox II (50×) 0.8 μL, final concentration of each primer 0.2–0.3 μM, final concentration of probe 0.2 μM, DNA template >10 ng, and water to bring the volume to 40 μL. Use the sulfite-modified DNA obtained in step 2 as a template.

[0263] 2×Premix Ex Taq in qPCR amplification TM (Probe qPCR) and Rox II (50×) were from TAKARA.

[0264] The qPCR reaction conditions are as follows:

[0265] Pre-denaturation at 96℃ for 3 minutes; 15 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 64℃ for 20 seconds, and extension at 72℃ for 10 seconds; 35 cycles: denaturation at 95℃ for 15 seconds, annealing and extension at 70℃ for 20 seconds, annealing and extension at 60℃ for 34 seconds, and extension at 72℃ for 10 seconds; and fluorescence signal was detected during annealing in all 35 cycles.

[0266] Step 4: Detect the fluorescence signal and use the Ct value as the standard for judging the result.

[0267] If the number of cycles (Ct) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is ≤36, it indicates that the amount of sample DNA is within the allowable range and the result is reliable. If the number of cycles (CT) required for the internal reference gene (actin) fluorescence signal to reach the set threshold is >36, the sample is considered invalid. Under valid detection conditions, if the CT value of the RSPO3 gene is ≤40, or the CT value of the NTNG1 gene is ≤40, or the CT value of the BMP3 gene is ≤40, the sample test result is "positive"; if the CT value of the RSPO3 gene is >40, the CT value of the NTNG1 gene is >40, and the CT value of the BMP3 gene is >40, the sample test result is "negative".

[0268] The test results (Table 10) show that among the four combinations, combination 1 (cg07155336 (NTNG1), cg01043019 (RSPO3) and cg26917673 (BMP3)) is the site combination used in this invention, and combinations 2 and 3 have the lowest false positives in healthy individuals. Combination 4 has too high a false positive rate and is therefore not considered a preferred site. In addition, combinations 1, 2 and 3 have high detection effects in gastric cancer and precancerous lesions, while combination 4 has too low a positive detection result in precancerous lesions and is therefore not considered a preferred site.

[0269] Table 10 Comparative detection results of the four combined detection combinations in blood samples.

[0270]

[0271] The preferred embodiments of the present invention have been described in detail above. It should be understood that those skilled in the art can make numerous modifications and variations based on the concept of the present invention without creative effort. Therefore, all technical solutions that can be obtained by those skilled in the art based on the concept of the present invention through logical analysis, reasoning, or limited experimentation on the basis of existing technology should be within the scope of protection defined by the claims.

Claims

1. A methylation marker combination for gastric cancer screening, characterized by, The methylation marker combination consists of target gene sequences or fragments thereof containing the following CpG methylation sites respectively: Methylation marker 1: CpG methylation site cg07155336 of NTNG1 gene; Methylation marker 2: CpG methylation site cg01043019 of RSPO3 gene; Methylation marker 3: CpG methylation site cg26917673 of BMP3 gene.

2. A primer probe combination for detecting the methylation marker combination according to claim 1, characterized in that The primer probe combination includes an upstream primer, a downstream primer and a probe for each methylation marker methylation site, wherein: The upstream primer for the methylation marker 1 methylation site is NTNG1-FP as shown in SEQ ID NO. 1, the downstream primer is NTNG1-RP as shown in SEQ ID NO. 2, and the probe is NTNG1-P as shown in SEQ ID NO. 3; The upstream primer for the methylation marker 2 methylation site is RSPO3-FP as shown in SEQ ID NO. 4, the downstream primer is RSPO3-RP as shown in SEQ ID NO. 5, and the probe is RSPO3-P as shown in SEQ ID NO. 6; The upstream primer for the methylation marker 3 methylation site is BMP3-FP as shown in SEQ ID NO. 7, the downstream primer is BMP3-RP as shown in SEQ ID NO. 8, and the probe is BMP3-P as shown in SEQ ID NO.

9.

3. The primer probe combination of claim 2, wherein, The nucleotide sequences of the primers and the probes are designed according to the nucleotide sequences of the corresponding methylation sites of each target gene after bisulfite modification, and the bisulfite modified sequences are as follows: The bisulfite modified sequence of NTNG1 gene is as shown in SEQ ID NO. 10; The bisulfite modified sequence of RSPO3 gene is as shown in SEQ ID NO. 11; The bisulfite modified sequence of BMP3 gene is as shown in SEQ ID NO.

12.

4. A kit for detecting gastric cancer, characterized by comprising the polynucleotide of claim 1 or 2. The primer probe combination of claim 2 or 3 is included.

5. The kit of claim 4, wherein A positive control is also included; the positive control includes a plasmid containing the methylation sequence of the target gene after bisulfite modification and / or a gastric cancer cell line; the carrier plasmid is selected from pUC57, pUC57-Kan, pUC57-Simple, pUC57-mini, pUC18 or pUC19; the gastric cancer cell line is selected from MKN-45, AGS, SGC-7901, BGC-823 or HGC-27; and the methylation sequence of the target gene after bisulfite modification is as follows: The bisulfite modified sequence of NTNG1 gene is as shown in SEQ ID NO. 10; The bisulfite modified sequence of RSPO3 gene is as shown in SEQ ID NO. 11; The bisulfite modified sequence of BMP3 gene is as shown in SEQ ID NO.

12.

6. The kit of claim 5, wherein A quality control gene primer pair and a quality control gene probe are also included; the quality control gene primer pair includes a quality control gene forward primer and a quality control gene reverse primer; and the quality control gene is beta actin, and the primer and probe sequences are as follows: The quality control gene forward primer is as shown in SEQ ID NO. 13; The reverse primer of the quality control gene is shown as SEQ ID NO.

14. The probe of the quality control gene is shown as SEQ ID NO.

15.

7. The kit of claim 6, wherein A negative control is also included, which is normal human genomic DNA or DNA of the negative cell line 293T.

8. The kit of claim 7, wherein The detection result is determined by qPCR analysis result of the primer probe combination: Quality control effectiveness: Ct of beta actin ≤ 36, the result is reliable; Ct > 36, the result is unreliable; Site positive determination: when the Ct of NTNG1, RSPO3 and BMP3 single site is ≤ 40, it is determined to be methylation positive, and when the Ct of each site is > 40, it is negative; Joint determination: when any site is methylation positive, it is determined to be gastric cancer positive, and when all three sites are negative, it is determined to be gastric cancer negative.

9. Use of the methylation marker combination of claim 1 in the preparation of a primer probe or methylation detection reagent for gastric cancer detection.

10. Use of the kit of claim 4 in the preparation of a molecular analysis product for gastric cancer screening, detection, diagnosis or prognosis evaluation.

Images