Primer group, kit and method for detecting pepper virus F

Abstract

The invention relates to a primer group, a kit and a detection method for detecting a pepper virus F (BPVF), in particular to a primer group for detecting the pepper virus F (BPVF) and a kit for detecting the pepper virus F (BPVF). A primer group for loop-mediated isothermal amplification is designed according to a large coat protein (LCP) conserved region of a BPVF genome RNA2, the primer group consists of sequences 1, 2, 3, 4 and 5 in a sequence table, a complete loop-mediated isothermal amplification system is established, and the complete loop-mediated isothermal amplification system is combined with a colloidal gold test strip to realize visual detection. The method does not depend on precise instruments and equipment and professional operators, can complete detection only by a simple constant temperature device, has the characteristics of high reaction speed, high specificity, high sensitivity, rapid and visual result interpretation and the like, is suitable for pepper cutting stock plant screening, seedling quarantine and early detection of field infected plants, and has a wide application prospect. The method is suitable for popularization and application in seedling production units and disease monitoring departments.

Description

Technical Field

[0001] This invention belongs to the field of plant virology technology, specifically relating to a primer set, kit, and method for detecting black pepper virus F (BPVF) in pepper leaves. Background Technology

[0002] black pepper( Piper nigrum L.) belongs to the genus Piper in the family Piperaceae. Piper Pepper, a perennial evergreen vine, is known as the "King of Spices" and is included in my country's first batch of lists of medicinal and edible plants. It is mainly cultivated in the tropical and subtropical regions of Asia and South America and is an important economic crop in countries such as Vietnam, Cambodia, Indonesia, Sri Lanka, Malaysia, India, and Brazil. my country is one of the world's six major pepper-producing countries, with cultivation in Hainan, Guangdong, Guangxi, Yunnan, and Fujian provinces.

[0003] Black pepper virus F (BPVF) was first discovered in pepper in Hainan, my country in 2022, and has currently been reported only in China, Brazil, and India. BPVF is classified under the family Associated Cowpea Viriidae (BPVF). Secoviridae Favism virus genus ( Fabavirus The virus particles exhibit icosahedral isometric symmetry and a dichotomous genome composed of two linear single-stranded positive-sense RNAs: RNA1 is approximately 6.3 kb long, and RNA2 is approximately 3.3 kb long. BPVF is a highly pathogenic virus that causes various symptoms in pepper, including mosaic, mottling, pustules, chlorosis, and stunting. However, under specific environmental conditions, the symptoms in infected plants may disappear, resulting in a latent disease. The reduced quality and yield of pepper caused by BPVF infection severely restricts the healthy development of the pepper industry. Currently, there is a lack of virus-resistant varieties and effective chemical control measures; therefore, the prevention and control of BPVF has become an urgent problem to be solved in production.

[0004] The most economical and effective measures for controlling pepper virus disease are planting healthy seedlings and promptly destroying infected plants in the field. Currently, virus-free technology for pepper seedlings is not yet mature, and production mainly relies on propagation by cuttings. Therefore, selecting healthy pepper plants as mother plants for cuttings is crucial. Virus testing is necessary in all stages, including the cultivation and transportation of healthy seedlings and the timely destruction of infected plants in the field. Therefore, establishing rapid detection technologies suitable for field use is key to controlling viral damage.

[0005] Traditional methods for detecting BPVF include electron microscopy, conventional RT-PCR, and real-time quantitative PCR. These methods are complex, require sophisticated equipment and skilled operators, and are not suitable for rapid field testing. This invention establishes a visual and rapid method for detecting BPVF based on loop-mediated isothermal amplification (LAMP) combined with colloidal gold test strips. This method requires only a simple temperature control device (such as a water bath or a simple metal bath) for amplification, exhibits rapid reaction speed, high specificity, high sensitivity, and quick and intuitive result interpretation, and requires minimal operator skill, making it particularly suitable for rapid field testing. Applying this invention enables the timely removal of infected mother trees, guides the cultivation and transportation of healthy seedlings, and provides technical support for the early diagnosis and monitoring of viral diseases, thus playing a significant role in the prevention and control of viral diseases in pepper in the field. Summary of the Invention

[0006] A first aspect of the present invention is to provide a primer combination for detecting BPVF, comprising an outer primer, an inner primer, and a loop primer, the specific sequences of which are as follows: Upstream outer primer BPVF-F3: AATATCTTAGAAGTTGTGCTTAGG (SEQ ID NO.1) Downstream outer primer BPVF-B3: GCATGATATTGGATTAAAAGTTAGG (SEQ ID NO.2) Upstream inner primer BPVF-FIP: CTTTGAGAGCTATTCCACTAGTGCAGGAGTAGCATTAAAGTTAGGATAC (SEQ ID NO.3) Downstream inner primer BPVF-BIP: GCATTTAGCAGTGACATGCCACCAACAGTATCACCAGTTGC (SEQ ID NO.4) Loop primer BPVF-LB: ACATCTTCAATGAGCTAGATGCAG (SEQ ID NO.5) The downstream inner primer BPVF-BIP is labeled with 6-carboxyfluorescein (6-FAM) at its 5' end, and the loop primer BPVF-LB is labeled with biotin at its 5' end. This facilitates the detection of the amplification products of the primer set using colloidal gold test strips, thereby enabling simple and accurate confirmation of the detection results.

[0007] The second aspect of the present invention is to provide a loop-mediated isothermal amplification reagent for detecting BPVF, comprising the primer set and lysis buffer, binding buffer, washing buffer I, washing buffer II, elution buffer, reaction buffer, BST Mix, nuclease-free water, positive control template, colloidal gold test strip, magnetic rack, magnetic beads (850nm), and RNase-free centrifuge tubes (2.0mL and 1.5mL).

[0008] The LAMP primer set is prepared as a 10× primer set mixture, wherein the concentration of each primer is: upstream inner primer 16 μmol / L, downstream inner primer 16 μmol / L, upstream outer primer 1~8 μmol / L, downstream outer primer 1~8 μmol / L, and loop primer 2~16 μmol / L.

[0009] The lysis buffer comprises 4–6 mol / L guanidine isothiocyanate, 30–60 mmol / L Tris-HCl, 0.1%–1% Triton X-100, and 10–20 mmol / L EDTA; the binding buffer is 4–6 mol / L guanidine isothiocyanate; washing buffer I is 4–6 M guanidine hydrochloride; washing buffer II is 30–60 mM Tris-HCl; the elution buffer is nuclease-free water; the reaction buffer comprises 100–300 mmol / L Tris-HCl, 300–800 mmol / L KCl, 100–300 mmol / L (NH4)2SO4, 4–10 mmol / L MgSO4, 0.5–2% Tween-20, and 10–50 mmol / L dN(U)TP; the BST Mix comprises 10–80 U / μL Bst plus DNA polymerase and 0.1–1 U / μL UDGase, 10~80 U / μL Reverse Transcriptase and 10~80 U / μL MRI.

[0010] A third aspect of the present invention is to provide a kit for detecting BPVF, comprising the primer set described in the first aspect of the present invention or the loop-mediated isothermal amplification reagent described in the second aspect of the present invention.

[0011] A fourth aspect of the present invention is to provide a method for detecting BPVF, comprising: performing loop-mediated isothermal amplification detection on a pepper leaf sample using the primer set described in the first aspect of the present invention, or the loop-mediated isothermal amplification reagent described in the second aspect, or the kit described in the third aspect.

[0012] Specifically, the method for detecting pepper virus F according to the present invention includes the following steps: (1) The pepper leaf samples to be tested were pretreated using an alcohol-free extraction method; (2) Using the product obtained in (1) as a template, prepare a reaction system for loop-mediated isothermal amplification. The 25 μL reaction system contains: 6 μL reaction buffer, 1 μL BST Mix, 2.5 μL 10× primer set, 5~10 μL template, and the remainder is made up to 25 μL with Nuclease-Free water. The above reaction system is placed at 63~67℃ for 20~30 min to obtain the amplification product. (3) Add the amplification product from (2) to the sample pad of the colloidal gold test strip and let it stand horizontally for 5-10 minutes to observe the results.

[0013] Positive (+): Both the control line (C line) and the test line (T line) of the test strip show red bands, indicating that the sample contains BPVF; Negative (-): A red band appears on the C line of the test strip, but no red band appears on the T line, indicating that the sample does not contain BPVF; Invalid: No red band appears on line C of the test strip, indicating that the test strip used is invalid or the operation is incorrect, and it needs to be tested again.

[0014] The reagents used in the alcohol-free extraction method are as follows: the lysis buffer consists of 4 mol / L guanidine isothiocyanate, 30 mmol / L Tris-HCl, 0.2% Triton X-100, and 10 mmol / L EDTA; the binding buffer is 4 mol / L guanidine isothiocyanate; washing buffer I is 4 mol / L guanidine hydrochloride; washing buffer II is 30 mmol / L Tris-HCl. The specific operating steps are as follows: (1) Lysis: Take 100~200 mg of pepper leaves, place them in a mortar, add 600 μL of lysis buffer and grind them thoroughly. Transfer all solutions to 2.0 mL RNase-Free centrifuge tubes and let them stand at room temperature for 3 min. (2) Binding: Add 600 μL of binding solution and 40 μL of magnetic beads to the mixture obtained in step (1), and shake thoroughly for 1 min; (3) Magnetic separation and liquid disposal: Place the centrifuge tube on the magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, use a pipette to completely dispose of the liquid in the tube. (4) Washing I: Remove the centrifuge tube from the magnetic rack, add 700 μL of washing solution I, and mix thoroughly by inverting for 1 min; (5) Magnetic separation and liquid disposal: Place the centrifuge tube on a magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, use a pipette to completely dispose of the liquid in the tube. (6) Washing II: Remove the centrifuge tube from the magnetic rack, add 500 μL of washing solution II, and mix thoroughly by inverting for 1 min; (7) Magnetic separation and liquid disposal: Place the centrifuge tube on the magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, use a pipette to remove the liquid in the tube.

[0015] The beneficial effects of this invention are: This invention provides a method for detecting BPVF, which features high specificity, high sensitivity, and intuitive and easy-to-interpret results. The method is simple and quick to operate, requiring no professional personnel or specialized instruments. It is suitable for screening pepper cuttings, seedling quarantine, and early detection of infected plants in the field, and is suitable for widespread application in production units and disease monitoring departments. Attached Figure Description

[0016] Figure 1 Experimental verification of the detection effect of LAMP primer set for some samples Figure 2 To investigate the effects of different pretreatment methods on the detection results of LAMP-colloidal gold test strips NTC: Blank control; PC: Positive control; 1: Direct lysis method; 2: Alcohol-free lysis method; 3: Alcohol-free extraction method Figure 3 Results of sensitivity testing of LAMP-colloidal gold test strips 1: 1000 copies / μL; 2: 300 copies / μL; 3: 100 copies / μL; 4: 10 copies / μL; NTC: blank control Figure 4 Results of specific detection of LAMP-colloidal gold test strips 1: PYMoV; 2: CMV; 3: BPVB; 4: BPVE; 5: PDV-1; 6: PDV-2; PC: positive control; NC: negative control. Detailed Implementation

[0017] To better understand the present invention, the present invention will be further described below with reference to specific embodiments.

[0018] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0019] Example 1: Design and validation of rapid detection primer sets for BPVF LAMP-colloidal gold test strips (a) Primer design Based on the BPVF genome nucleotide sequences (RNA1: MZ648325.1; RNA2: MZ648326.1) published by NCBI (https: / / www.ncbi.nlm.nih.gov / ), sequence alignment analysis was performed using DNAMAN software to select conserved regions of the genome. Subsequently, a set of LAMP primers was designed using the online LAMP primer design software PrimerExplorer V4 (http: / / primerexplorer.jp / e / ) for rapid visualization detection of BPVF. This primer set targets the conserved region of the large coat protein (LCP) in the BPVF RNA2 genome and includes: upstream outer primer BPVF-F3, downstream outer primer BPVF-B3, upstream inner primer BPVF-FIP, downstream inner primer BPVF-BIP, and loop primer BPVF-LB (Table 1). The downstream inner primer BPVF-BIP is labeled with 6-carboxyfluorescein (6-FAM) at its 5' end, and the circular primer BPVF-LB is labeled with biotin at its 5' end.

[0020] Table 1 Primer sequence information for BPVF detection using the LAMP-colloidal gold test strip method. Primer name Sequence Sequence number BPVF-F3 AATATCTAGAAGTTGTGCTTAGG SEQ ID NO. 1 BPVF-B3 GCATGATATTGGATTAAAAGTTAGG SEQ ID NO. 2 BPVF-FIP CTTTGAGAGCTATTCCACTAGTGCAGGAGTAGCATTAAAGTTAGGATAC SEQ ID NO. 3 BPVF-BIP GCATTTAGCAGTGACATGCCACCAACAGTATCACCAGTTGC SEQ ID NO. 4 BPVF-LB ACATCTTCAATGAGCTAGATGCAG SEQ ID NO. 5 (II) Specificity Validation of LAMP Primer Sets To evaluate the specificity of the primers designed in this invention, the primer sequences were aligned using NCBI's BLAST tool (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). In the parameter settings, the Database was set to Standard databases (nr etc.): Core nucleotide database (core nt), and Program Selection was set to Somewhat similar sequences (blastn). The alignment results showed that five primers in the designed primer set completely matched only BPVF sequences occurring in my country (sequence coverage and similarity were both 100%), indicating that the designed primers have excellent specificity.

[0021] (III) Experimental verification of the detection effect of LAMP primer set To verify the detection efficacy of the designed LAMP primer set, this study used 24 BPVF-infected pepper cDNA samples and 15 healthy pepper cDNA samples preserved in the laboratory as templates for the experiment. The specific steps are as follows: 1. The reaction system (25 μL) for loop-mediated isothermal amplification contained: 6 μL reaction buffer, 1 μL BSTMix, 2.5 μL 10× primer set, 5 μL template, and 10.5 μL Nuclease-Free water. The reaction buffer contains 100 mmol / L Tris-HCl, 500 mmol / L KCl, 100 mmol / L (NH4)2SO4, 5 mmol / L MgSO4, 0.5% Tween-20, and 10 mmol / L dN(U)TP; the BST Mix contains 20 U / μL Bst plus DNA polymerase, 0.2 U / μL UDGase, 30 U / μL Reverse Transcriptase, and 30 U / μL MRI; the 10× primer set contains 16 μmol / L BPVF-FIP, 16 μmol / L BPVF-BIP, 4 μmol / L BPVF-F3, 4 μmol / L BPVF-B3, and 8 μmol / L BPVF-LB.

[0022] 2. The reaction system was kept at 65°C for 30 min to obtain the amplified product; 3. Add the amplification product to the sample pad of the colloidal gold test strip, let it stand for 5 minutes, and then interpret the results. The results showed that both the T and C lines of 24 BPVF-infected samples showed red bands, indicating a positive result; while only the C line of 15 healthy control samples showed a red band, indicating a negative result. Experimental validation of the detection effect of LAMP primer sets for some samples can be found in [link to experimental data]. Figure 1 .

[0023] The above results demonstrate that the LAMP primer set designed in this invention can be used for the detection of BPVF.

[0024] Example 2: Screening of pretreatment methods for pepper leaves This embodiment provides a method for pretreatment of pepper leaves.

[0025] To eliminate the inhibitory effect of endogenous substances in pepper leaves on LAMP amplification and achieve field detection of BPVF, we evaluated the effects of three leaf pretreatment methods (direct lysis, alcohol-free lysis, and alcohol-free extraction) on the detection results of LAMP-colloidal gold test strips. Pepper leaf samples (HJ24) containing BPVF were treated using the three methods respectively, and LAMP-colloidal gold test strips were used for detection according to the method described in Example 1 (III). The results showed that only the alcohol-free extraction method yielded a positive detection result, while the other two methods were negative. Figure 2 ).

[0026] Alcohol-free extraction requires no laboratory equipment and is suitable for sample pretreatment in the field. The reagents used in this method are as follows: lysis buffer consists of 4 mol / L guanidine isothiocyanate, 30 mmol / L Tris-HCl, 0.2% Triton X-100, and 10 mmol / L EDTA; binding buffer is 4 mol / L guanidine isothiocyanate; washing buffer I is 4 mol / L guanidine hydrochloride; washing buffer II is 30 mmol / L Tris-HCl. The specific operating steps are as follows: (1) Lysis: Take 100-200 mg of pepper leaves, place them in a mortar, add 600 μL of lysis buffer and grind them thoroughly. Transfer all solutions to 2.0 mL RNase-Free centrifuge tubes and let stand at room temperature for 3 min.

[0027] (2) Binding: Add 600 μL of binding solution and 40 μL of magnetic beads to the mixture obtained in step (1), and shake thoroughly for 1 min.

[0028] (3) Magnetic separation and liquid disposal: Place the centrifuge tube on a magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, use a pipette to completely dispose of the liquid in the tube.

[0029] (4) Washing I: Remove the centrifuge tube from the magnetic rack, add 700 μL of washing solution I, and mix thoroughly by inverting for 1 min.

[0030] (5) Magnetic separation and liquid disposal: Place the centrifuge tube on the magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, use a pipette to completely dispose of the liquid in the tube.

[0031] (6) Washing II: Remove the centrifuge tube from the magnetic rack, add 500 μL of washing solution II, and mix thoroughly by inverting for 1 min.

[0032] (7) Magnetic separation and liquid disposal: Place the centrifuge tube on the magnetic rack and let it stand for 1 minute. After the magnetic beads are completely adsorbed, use a pipette to remove the liquid in the tube.

[0033] (8) Repeat washing II: Repeat steps (6) and (7) once.

[0034] (9) Drying: Keep the centrifuge tubes on the magnetic rack, open the tube caps, and let them dry at room temperature for 3-5 minutes.

[0035] (10) Elution: Remove the centrifuge tube from the magnetic rack, add 50~100 μL of elution buffer, invert and mix thoroughly, and let stand at room temperature for 3-5 min (you can gently invert and mix twice during this period).

[0036] (11) Collection: Place the centrifuge tube on a magnetic rack and let it stand until the magnetic beads are completely adsorbed. Carefully aspirate all the liquid in the tube and transfer it to a new 1.5 ml centrifuge tube. This liquid can be used for subsequent isothermal amplification detection.

[0037] Example 3: Establishment of a LAMP-colloidal gold test strip detection method for BPVF This embodiment provides a method for detecting BPVF, the specific steps of which are as follows: Using the lysis product of the infected sample HJ24 in Example 2 as a template, based on the LAMP reaction system described in Example 1 (III), the primer dosage, reaction temperature and reaction time were optimized sequentially using the single-factor gradient method.

[0038] The primer concentrations in the LAMP reaction system were optimized: the concentration of the inner primer (BPVF-FIP / BPVF-BIP) was fixed at 1.6 µmol / L, and four concentration combinations of the outer primer (BPVF-F3 / BPVF-B3) and the loop primer (BPVF-LB) were screened (Table 2). The results showed that all four concentration combinations (A, B, C, and D) could achieve stable detection.

[0039] Table 2 Primer usage settings in LAMP reaction system optimization

[0040] The LAMP reaction temperature was optimized by setting six gradients: 58℃, 61℃, 63℃, 65℃, 67℃, and 70℃. The results showed that within the range of 63–67℃, both the T and C lines of the test strip showed red bands; while at other temperatures, only the C line showed a red band. Therefore, 63–67℃ can be considered a suitable reaction temperature.

[0041] The LAMP reaction time was optimized: the reaction temperature was set to 65℃, and six reaction time gradients were set: 5 min, 10 min, 15 min, 20 min, 25 min, and 30 min. The results showed that within the 20–30 min range, both the T and C lines of the test strip showed red bands; while at other reaction times, only the C line showed a red band. Therefore, 20–30 min can be considered a suitable reaction time.

[0042] Example 4: Preparation of BPVF Detection Kit This embodiment provides a kit for detecting BPVF, which includes the lysis buffer, binding buffer, washing buffer I, washing buffer II, elution buffer, 10× primer set mixture, reaction buffer, BST Mix, Nuclease-Free water, positive control template, colloidal gold strip, magnetic rack, magnetic beads (850 nm), and RNase-Free centrifuge tubes (2.0 mL and 1.5 mL).

[0043] (1) Preparation of lysis buffer required for sample pretreatment The lysis buffer consisted of 4–6 mol / L guanidine isothiocyanate, 30–60 mmol / L Tris-HCl, 0.1%–1% Triton X-100, and 10–20 mmol / L EDTA; the binding buffer was 4–6 mol / L guanidine isothiocyanate; washing buffer I was 4–6 M guanidine hydrochloride; washing buffer II was 30–60 mM Tris-HCl; and the elution buffer was nuclease-free water.

[0044] (2) Preparation of solutions required for LAMP reaction system The concentrations of each primer in the 10× primer set mixture are as follows: upstream inner primer BPVF-FIP 16 μmol / L, downstream inner primer BPVF-BIP 16 μmol / L, upstream outer primer BPVF-F3 1~8 μmol / L, downstream outer primer BPVF-B3 1~8 μmol / L, and loop primer BPVF-LB 2~16 μmol / L.

[0045] The reaction buffer consists of 100–300 mmol / L Tris-HCl, 300–800 mmol / L KCl, 100–300 mmol / L (NH₄)₂SO₄, 4–10 mmol / L MgSO₄, 0.5–2% Tween-20, and 10–50 mmol / L dN(U)TP; BSTMix consists of 10–80 U / μL Bst plus DNA polymerase, 0.1–1 U / μL UDGase, 10–80 U / μL ReverseTranscriptase, and 10–80 U / μL MRI. All solutions were prepared using nuclease-free water.

[0046] (3) Preparation of positive control template A partial coding region sequence of the BPVF RNA2 genomic LCP gene, targeted by a synthetic LAMP primer set (see sequence 6 in the sequence listing), was ligated into the pESI-TA / Blunt vector and transformed. E. coli After screening positive clones and verifying them by sequencing DH5α Competent Cells, the plasmid is extracted and used as a positive control template in the kit.

[0047] (4) Assembly of colloidal gold test strips The colloidal gold test strip includes a PVC base plate, a sample pad, a conjugate pad, a nitrocellulose membrane, and an absorbent pad. The conjugate pad is coated with colloidal gold-labeled FAM monoclonal antibody and chicken IgY antibody. The nitrocellulose membrane has a test line and a control line. The test line is coated with biotin monoclonal antibody, and the control line is coated with goat anti-chicken IgY antibody. The colloidal gold test strip (product number WLFS8206) was purchased from Anpu Future (Changzhou) Biotechnology Co., Ltd.

[0048] Example 5: Sensitivity evaluation of LAMP-colloidal gold test strip method for detecting BPVF To evaluate the sensitivity of the established LAMP-colloidal gold test strip method for detecting BPVF, the positive control described in Example 4 was diluted to the following concentrations: 1000 copies / μL, 300 copies / μL, 100 copies / μL, and 10 copies / μL, as amplification templates. Detection was performed according to the method described in Example 1 (III). The detection results are as follows: Figure 3 As shown: for templates of 1000 copies / μL, 300 copies / μL, and 100 copies / μL, both the T-line and C-line show red bands; for a template of 10 copies / μL, only the C-line shows a red band. Therefore, the detection limit of this method is 100 copies / μL.

[0049] Example 6: Specificity verification of the primer combination of the present invention To verify the specificity of the primers designed in this invention, common pepper viruses were selected as test subjects, including Piper Yellow Mottle Virus (PYMoV), Cucumber Mosaic Virus (CMV), Black Pepper Virus B (BPVB), Black Pepper Virus E (BPVE), Piper DNA Virus 1 (PDV-1), and Piper DNA Virus 2 (PDV-2). Samples carrying BPVF were used as positive controls, and healthy pepper leaf samples were used as negative controls. 100 mg of pepper leaves infected with the above viruses were taken and pretreated according to the alcohol-free extraction method described in Example 3. The pretreated sample extract was used as a template, and detection was performed according to the steps in Example 1 (III). The results showed ( Figure 4 Except for the positive control, all test samples were negative, indicating that the detection method established in this invention does not cross-react with common viruses that infect pepper and has strong specificity.

Claims

1. A LAMP primer set for detecting Black pepper virus F (BPVF), comprising outer primers, inner primers and loop primers; wherein, The outer primer is composed of an upstream outer primer and a downstream outer primer, the upstream outer primer is a nucleotide shown in SEQ ID NO. 1 in the sequence listing, and the downstream outer primer is a nucleotide shown in SEQ ID NO. 2 in the sequence listing; the inner primer is composed of an upstream inner primer and a downstream inner primer, the upstream inner primer is a nucleotide shown in SEQ ID NO. 3 in the sequence listing, and the downstream inner primer is a nucleotide shown in SEQ ID NO. 4 in the sequence listing; and the loop primer is a nucleotide shown in SEQ ID NO. 5 in the sequence listing.

2. The LAMP primer set according to claim 1, characterized in that, The 5' end of the downstream inner primer is labeled with 6-carboxyfluorescein (6-FAM), and the 5' end of the loop primer is labeled with biotin (Biotin).

3. A kit for detecting pepper virus F, comprising the LAMP primer set of claim 1.

4. The kit of claim 3, characterized in that: The kit further comprises a lysis solution, a binding solution, a washing solution I, a washing solution II, an elution solution, a Reaction buffer, a BST Mix, a Nuclease-Free water, a positive control template, a colloidal gold detection test strip, a magnetic stand, a magnetic bead, and an RNase-Free centrifuge tube; wherein the lysis solution comprises 4-6 mol / L guanidine isothiocyanate, 30-60 mmol / L Tris-HCl, 0.1%-1% Triton X-100, and 10-20 mmol / L EDTA; the binding solution is 4-6 mol / L guanidine isothiocyanate; the washing solution I is 4-6 M guanidine hydrochloride; the washing solution II is 30-60 mM Tris-HCl; the elution solution is Nuclease-Free water; the Reaction buffer comprises 100-300 mmol / L Tris-HCl, 300-800 mmol / L KCl, 100-300 mmol / L (NH4)2SO4, 4-10 mmol / L MgSO4, 0.5-2% Tween-20, and 10-50 mmol / L dN(U)TP; and the BST Mix comprises 10-80 U / μL Bst plus DNA polymerase, 0.1-1 U / μL UDGase, 10-80 U / μL Reverse Transcriptase, and 10-80 U / μL MRI.

5. The kit of claim 3, characterized in that: The LAMP primer set is prepared as a 10×primer set mixture; wherein the concentrations of the primers in the 10×primer set mixture are as follows: 16 μmol / L of the upstream inner primer, 16 μmol / L of the downstream inner primer, 1-8 μmol / L of the upstream outer primer, 1-8 μmol / L of the downstream outer primer, and 2-16 μmol / L of the loop primer.

6. Application of the LAMP primer set of claim 1 or 2 and the kit of claim 3 or 4 in detecting pepper virus F.

7. A method for detecting pepper virus F, comprising the following steps of detecting pepper virus F by using the kit of claims 3-5: (1) The alcohol-free extraction method is used for pretreatment of the pepper leaf sample to be tested; (2) The product obtained in (1) is used as a template to prepare a reaction system of loop-mediated isothermal amplification, and the reaction system of 25 muL contains: 6 muL of reaction buffer, 1 muL of BST Mix, 2.5 muL of 10x primer group, 5-10 muL of template, and the rest is supplemented with Nuclease-Free water to 25 muL; the above reaction system is placed at 63-67 DEG C constant temperature reaction for 20-30 min to obtain the amplification product; (3) The amplification product in (2) is added dropwise to the sample pad of the colloidal gold detection test strip, and the result is observed after horizontal standing for 5-10 min; Positive (+): The test strip control line (C line) and test line (T line) all appear red bands, indicating that the sample to be tested contains BPVF; Negative (-): The test strip C line appears a red band, and the T line does not appear a red band, indicating that the sample to be tested does not contain BPVF; Invalid: The test strip C line does not appear a red band, indicating that the test strip used is invalid or the operation is wrong, and needs to be retested.

8. The method of claim 7, wherein, The reagent composition used in the alcohol-free extraction method is as follows: the lysis solution composition is 4 mol / L guanidine isothiocyanate, 30 mmol / L Tris-HCl, 0.2% Triton X-100 and 10 mmol / L EDTA; the binding solution is 4 mol / L guanidine hydrochloride; the washing solution I is 4 mol / L guanidine hydrochloride; the washing solution II is 30 mmol / L Tris-HCl, and the specific operation steps are as follows: (1) Lysis: take 100-200 mg of pepper leaves, place them in a mortar, then add 600 muL of lysis solution for grinding, transfer all the solution to a 2.0 mL RNase-Free centrifuge tube, and stand at room temperature for 3 min; (2) Binding: add 600 muL of binding solution and 40 muL of magnetic beads to the mixed solution obtained in step (1), shake well and mix for 1 min; (3) Magnetic separation and liquid discarding: place the centrifuge tube on the magnetic stand and stand for 1 min, then completely absorb and discard the liquid in the tube with a pipette after the magnetic beads are completely adsorbed; (4) Washing I: take the centrifuge tube off the magnetic stand, add 700 muL of washing solution I, mix well and invert for 1 min; (5) Magnetic separation and liquid discarding: place the centrifuge tube on the magnetic stand and stand for 1 min, then completely absorb and discard the liquid in the tube with a pipette after the magnetic beads are completely adsorbed; (6) Washing II: take the centrifuge tube off the magnetic stand, add 500 muL of washing solution II, mix well and invert for 1 min; (7) Magnetic separation and liquid discarding: place the centrifuge tube on the magnetic stand and stand for 1 min, then completely absorb and discard the liquid in the tube with a pipette after the magnetic beads are completely adsorbed; (8) Repeat washing II: repeat step (6) and step (7) once; (9) Drying: keep the centrifuge tube on the magnetic stand, open the tube cap, and stand at room temperature for 3-5 min to dry. (10) Elution: remove the centrifuge tube from the magnetic stand, add 50-100 μL elution buffer, mix well by inverting, and stand at room temperature for 3-5 min; (11) Collection: place the centrifuge tube on the magnetic stand, and after the magnetic beads are completely adsorbed, carefully pipette all the liquid in the tube and transfer it to a new 1.5 ml centrifuge tube. This liquid can be used for subsequent isothermal amplification detection.

Images