Preparation method of arachidonic acid lipid nano drug delivery system

The arachidonic acid lipid nanoparticle drug delivery system addresses the issues of insufficient targeting, low lysosomal escape efficiency, and failed ferroptosis activation in LNP-delivered siRNA, thereby achieving improved stability and safety in cancer cell-specific killing and therapeutic effects.

CN121401237APending Publication Date: 2026-01-27CENT SOUTH UNIV
View PDF 11 Cites 0 Cited by

Patent Information

Application Number
CN202511510782.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-10-22
Publication Date
2026-01-27

AI Technical Summary

Technical Problem

Existing lipid nanoparticles (LNPs) suffer from insufficient targeting, low lysosomal escape efficiency, failure of ferroptosis activation, and safety and stability issues when delivering siRNA, leading to unstable therapeutic effects and safety risks.

Method used

The arachidonic acid lipid nanoparticle drug delivery system utilizes the self-assembly of ionizable lipids, arachidonic acid, conjugated lipids that inhibit particle aggregation, and metal ions to form nanoparticles. These nanoparticles then combine with specific nucleic acid drugs to improve targeting and lysosomal escape rate, thereby activating the ferroptosis pathway.

Benefits of technology

It achieves specific killing of cancer cells, improves the precision and safety of treatment, enhances the stability of nanoparticles and lysosomal escape rate, reduces side effects, and improves treatment efficacy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121401237A_ABST
    Figure CN121401237A_ABST
Patent Text Reader

Abstract

The invention discloses a preparation method of an arachidonic acid lipid nano drug delivery system, and relates to the technical field of biology, the lipid nano drug delivery system comprises the following components: (1) ionizable lipid; (2) arachidonic acid; (3) a conjugated lipid that inhibits particle aggregation of a non-cationic lipid or an ionizable lipid; (4) non-cationic lipids or non-ionizable lipids other than (3); (5) metal ions; (6) a nucleic acid drug; the lipid nano drug delivery system is formed by mixing and self-assembling at least the components (1) to (6). According to the novel preparation method of the lipid nano drug delivery system, cancer cells are specifically killed through lipid replacement and simultaneous use of nuclear nucleic acid drugs and metal ions, the treatment accuracy is improved, and the stability and the lysosome escape rate can be increased.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a nanomedicine delivery system, specifically to a method for preparing an arachidonic acid lipid nanomedicine delivery system. Background Technology

[0002] Lipid nanoparticles (LNPs) are nanoparticles self-assembled from cationic lipids or ionizable lipids, phospholipids, cholesterol, and polyethylene glycol (PEG)-modified lipids. Their core advantage lies in their ability to effectively encapsulate and protect negatively charged siRNA molecules from nuclease degradation, and to promote siRNA uptake and endosome escape within the cell, thereby exerting an RNA interference (RNAi) effect in the cytoplasm to specifically silence the expression of pathogenic genes. LNPs have already demonstrated translational potential in clinical trials (e.g., the approval of drugs like Patisiran), providing a reliable delivery platform for the clinical application of siRNA drugs and propelling RNA interference therapy towards practical application.

[0003] However, despite the promising prospects of LNP-delivered siRNA-induced ferroptosis strategy, its industrial transformation still faces a series of major challenges and unresolved issues: (1) Insufficient targeting of nanocarriers: Although nanocarriers such as LNP have certain advantages in drug delivery, current LNPs still have problems such as insufficient targeting and easy clearance in vivo, which leads to the inability of drugs to be effectively concentrated in pathological sites and reduces the therapeutic effect; (2) Low lysosomal escape efficiency: Low lysosomal escape efficiency is still the most important bottleneck restricting the function of siRNA. After the existing LNP-metal ion complex enters the cell, it is easily encapsulated into the lysosome. The acidic environment within lysosomes (pH approximately 4.5-5.0) and the presence of various hydrolases can disrupt the complex structure, leading to premature release or degradation of metal ions, preventing them from effectively reaching the target site. Simultaneously, the isolating effect of lysosomes hinders the release of therapeutic components carried by the complex into the cytoplasm or specific organelles, significantly reducing treatment efficiency. Furthermore, the complex retained in lysosomes may induce lysosomal stress, prompting the cell to initiate autophagy to clear the complex, further reducing its effective concentration within the cell. A large amount of LNP-siRNA complex remains trapped in lysosomes and is degraded, failing to effectively release siRNA into the cytoplasm. Importantly, the degradation products of the complex that fail to escape may trigger lysosomal rupture, and the released contents may cause non-specific damage to cells, or even induce inflammatory responses, affecting the safety and precision of treatment. This problem has become a key bottleneck restricting the efficient role of LNP-metal ion complexes in cancer treatment, and it is urgent to break through through technological innovation; (3) Failure of ferroptosis activation: Although existing technologies have attempted to inhibit key negative regulatory pathways of ferroptosis by delivering siRNA (such as targeting GPX4 and FSP1) through LNP, treatment failure is still common. One of the underlying reasons is the lack or inaccessibility of the endogenous iron pool, leading to The inability to produce enough lipid peroxides to induce ferroptosis prevents the gene silencing effect of siRNA from being converted into the final cancer cell death effect; (4) Safety and effectiveness issues of ferroptosis induction methods: Existing methods for inducing cancer cell ferroptosis have poor specificity and large toxic side effects, making them difficult to widely apply in clinical practice; Moreover, the effectiveness of these methods is also affected by a variety of factors, such as cell type and cell channel expression level, resulting in unstable treatment effects; (5) Poor stability of production and quality control: The preparation steps of traditional ferroptosis-inducing functional materials are complicated, the resulting nanoparticles have poor stability, large scale is difficult and costly, and the feasibility of clinical translation is low.

[0004] Therefore, providing a nanodelivery system that can solve the above-mentioned technical problems is a technical problem that urgently needs to be solved in this field. Summary of the Invention

[0005] To address the above problems, this invention provides an arachidonic acid lipid nanoparticle drug delivery system.

[0006] To achieve the above objectives, the present invention adopts the following technical solution:

[0007] A method for preparing an arachidonic acid lipid nanoparticle drug delivery system, wherein the lipid nanoparticle drug delivery system comprises the following components:

[0008] (1) Ionizable lipids;

[0009] (2) Arachidonic acid;

[0010] (3) Conjugated lipids that inhibit particle aggregation, wherein the conjugated lipids that inhibit particle aggregation are non-cationic lipids or ionizable lipids;

[0011] (4) Non-cationic lipids or non-ionizable lipids other than (3);

[0012] (5) Metal ions;

[0013] (6) Nucleic acid drugs;

[0014] The preparation method includes mixing the ionizable lipid, arachidonic acid, conjugated lipids that inhibit particle aggregation, non-cationic lipids or non-ionizable lipids other than (3), metal ions and nucleic acid drugs, and then self-assembling them to obtain an arachidonic acid lipid nanoparticle drug delivery system.

[0015] Preferably, the preparation method includes the following steps:

[0016] 1) Dissolve ionizable lipids, arachidonic acid, conjugated lipids that inhibit particle aggregation, non-cationic lipids or non-ionizable lipids other than (3) and metal ions in ethanol to obtain an ethanol phase;

[0017] 2) Dissolve the nucleic acid drug in a buffer solution to obtain an aqueous phase;

[0018] 3) After mixing the aqueous phase and the ethanol phase, the ethanol is removed to obtain the arachidonic acid lipid nanodelivery system.

[0019] Preferably, the buffer solution is a pH 5.0 Tris-HCl buffer solution.

[0020] Preferably, the volume ratio of the ethanol phase to the water phase is 1:3.

[0021] Preferably, the mixing is performed using a microfluidic chip.

[0022] Preferably, the total flow rate of the microfluidic chip is 12 mL / min.

[0023] Preferably, the removal of ethanol is performed using ultrafiltration centrifugation.

[0024] Preferably, the ionizable lipid is SM-102, with the following structural formula:

[0025] .

[0026] Preferably, the arachidonic acid has the following structural formula:

[0027] .

[0028] Preferably, the conjugated lipid that inhibits particle aggregation is a PEG lipid conjugate.

[0029] Preferably, the non-cationic lipids or non-ionizable lipids other than (3) are at least one of cholesterol and its derivatives.

[0030] Preferably, the non-cationic lipids or non-ionizable lipids other than (3) include any one of lecithin PC, phosphatidylethanolamine PE, phosphatidylserine PS, phosphatidic acid PA, phosphatidylglycerol PG, 1-phosphoceramide SP, phosphatidylinositol PI, phosphatidylthreonine PT, sphingomyelin SM, lysophosphatidylcholine LPC, lysophosphatidylethanolamine LPE, lysophosphatidylserine LPS, lysophosphatidylglycerol LPA, lysophosphatidylglycerol LPG, lysophosphatidylinositol LPI, lysophosphatidylthreonine LPT, lysophosphatidylcholine LSM, sphingosine 1-phosphate S1P, cholesterol and their derivatives.

[0031] Preferably, the structural formula of the cholesterol is:

[0032] ,

[0033] Lecithin PC ,

[0034] phosphatidylethanolamine PE ,

[0035] Phosphatidylserine PS ,

[0036] Phosphatidic acid PA ,

[0037] Phosphatidylglycerol PG ,

[0038] 1-Phosphoceramide SP ,

[0039] Phosphatidylinositol PI ,

[0040] Phosphatidylthreonine PT ,

[0041] Sphingomyelin SM ,

[0042] Lysophosphatidylcholine (LPC) ,

[0043] Lysophosphatidylethanolamine (LPE) ,

[0044] Lysophosphatidylserine LPS ,

[0045] Lysophosphatidylcholine (LPA) ,

[0046] Lysophosphatidylglycerol (LPG) ,

[0047] Lysophosphatidylinositol LPI ,

[0048] Lysophosphatidylthreonine LPT ,

[0049] Lysosphingolipid LSM ,

[0050] 1-Sphingosine phosphate S1P ,

[0051] Cholesterol sulfate .

[0052] Preferably, the metal ion is Fe. 3+ Fe 2+ Cu 2+ Ga 3+ Mn 2+ Pb 2+ Cd 2+ Ni 2+ Sb 3+ At least one of the following; preferably Fe 3+ Fe 2+ Cu 2+ Fe is the best. 3+ .

[0053] Preferably, the nucleic acid drug is at least one of mRNA, siRNA, sgRNA, ASO, circRNA, microRNA, double-stranded DNA, and single-stranded DNA.

[0054] Preferably, the nitrogen-to-phosphorus ratio of the ionizable lipid and the nucleic acid drug (residues ignored) is 6; the mass ratio of the nucleic acid drug to the metal ion is 1:(0.1-1).

[0055] Preferably, the nucleic acid drug is siRNA;

[0056] The siRNA includes any one of GPX4-siRNA, SLC7A11-siRNA, Nrf2-siRNA, and CY5-GPX4-siRNA;

[0057] Preferably, the nucleotide sequence of the GPX4-siRNA has the Sense (5'-3') as shown in SEQ ID NO:1 and the Antisense (5'-3') as shown in SEQ ID NO:2;

[0058] The nucleotide sequence of the SLC7A11-siRNA has the following Sense (5'-3') as shown in SEQ ID NO:3 and the Antisense (5'-3') as shown in SEQ ID NO:4;

[0059] The nucleotide sequence of the Nrf2-siRNA is shown as SEQ ID NO:5 for Sense (5'-3') and as shown as SEQ ID NO:6 for Antisense (5'-3').

[0060] The nucleotide sequence of the CY5-GPX4-siRNA is shown as Sense (5'-3') in SEQ ID NO:7 and Antisense (5'-3') in SEQ ID NO:8.

[0061] Preferably, the ionizable lipid is SM-102, the conjugated lipid that inhibits particle aggregation is DMG-PEG2000, and the non-cationic lipid or non-ionizable lipid other than (3) is cholesterol.

[0062] Preferably, the molar ratio of SM-102, arachidonic acid, cholesterol and DMG-PEG2000 is 50:10:38.5:1.5.

[0063] Compared with the prior art, the present invention has the following beneficial effects:

[0064] (1) This invention provides a new nanoplatform and its preparation method, which achieves specific killing effect on cancer cells through lipid replacement and metal ion modification, thereby improving the precision of treatment;

[0065] (2) The metal ions of the present invention can increase the overall stability of the material and the lysosome escape rate;

[0066] (3) The present invention enables arachidonic acid lipid nanoparticles to have a strong specific killing ability against cancer cells. Attached Figure Description

[0067] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. The drawings in this description are merely embodiments of the present invention.

[0068] Figure 1 Example 1 of the present invention: ALNP@GPX4-siRNA-Fe 3+ Structural diagram;

[0069] Figure 2 Example 1 of the present invention: ALNP@GPX4-siRNA-Fe 3+ Diagram of cancer cell-specific killing mechanism;

[0070] Figure 3 This is a particle size distribution diagram of MIX in Embodiment 1 of the present invention;

[0071] Figure 4 This is a bar chart of particle size PDI for MIX in Example 1 of the present invention;

[0072] Figure 5 This is a bar chart of the particle size distribution (PDI) of the finished product in Example 1 of the present invention;

[0073] Figure 6 This is a surface potential diagram of the finished product in Embodiment 1 of the present invention;

[0074] Figure 7 This is an agarose gel electrophoresis image from Example 1 of the present invention;

[0075] Figure 8 This is a graph showing the siRNA encapsulation efficiency results of Example 1 of the present invention;

[0076] Figure 9 Example 1 of the present invention, Fe 3+ Encapsulation efficiency results graph;

[0077] Figure 10 This is a graph showing the particle size stability results at 4℃ in Example 1 of the present invention;

[0078] Figure 11 This is a graph showing the stability results of PDI at 4℃ in Example 1 of the present invention;

[0079] Figure 12 This is a graph showing the particle size stability results of Example 1 of the present invention at 37℃ + 20% FBS.

[0080] Figure 13 This is a graph showing the stability results of PDI at 37℃ + 20% FBS in Example 1 of the present invention.

[0081] Figure 14 ALNP@GPX4-siRNA-Fe with different proportions of metal ions in Example 1 of this invention3+ The results of mRNA knockdown efficiency;

[0082] Figure 15 This is a graph showing the cell viability results of Example 1 of the present invention, specifically 293T cells.

[0083] Figure 16 This is a graph showing the C918 cell viability results in Example 1 of the present invention;

[0084] Figure 17 This is a comparison diagram of the viability of 293T and C918 cells in Example 1 of the present invention;

[0085] Figure 18 Example 1 of the present invention: ALNP@GPX4-siRNA-Fe 3+ Graph showing the results of the iron cycling experiment;

[0086] Figure 19 This is a cell diagram of ALNP@CY5-siRNA lysosomal escape from cells in Example 2 of the present invention;

[0087] Figure 20 Example 2 of the present invention: ALNP@CY5-siRNA-Fe 3+ Diagram of lysosomes escaping from cells;

[0088] Figure 21 This is a comparison chart of Pearson coefficients in Embodiment 2 of the present invention;

[0089] Figure 22 Example 3 of the present invention: ALNP@SLC7A11-siRNA-Fe 3+ The results of mRNA knockdown efficiency;

[0090] Figure 23 This is a graph showing the mRNA knockdown efficiency results of ALNP@Nrf2-siRNA-Fe3+ in Example 3 of the present invention. Detailed Implementation

[0091] Embodiments of the present invention are described below, examples of which are shown in the accompanying drawings. The embodiments described with reference to the drawings are exemplary and intended to explain the present invention, but are not to be construed as limiting the present invention.

[0092] The term "lipid" refers to a group of organic compounds, including, but not limited to, lipids of fatty acids. They are generally classified into three categories: "simple lipids," "compound lipids," and "derived lipids." "Simple lipids" include fats and oils as well as waxes; "compound lipids" include phospholipids and glycolipids; and "derived lipids" include steroids.

[0093] The term "ionizable lipid" refers to a lipid containing a positively charged ionizable amine group that can be protonated and become positively charged at lower pH values, while remaining uncharged under physiological pH conditions.

[0094] The term "neutral lipid" refers to any of a variety of lipids that exist at a selected pH as either uncharged or in a neutral zwitterionic form. At physiological pH, such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramides, sphingomyelin, cerebrosides, cholesterol, cerebrosides, and diacylglycerols.

[0095] The term "anionic lipid" refers to any lipid that carries a negative charge at physiological pH. These lipids include, but are not limited to, phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamine, N-succinylphosphatidylethanolamine, N-glutarylphosphatidylethanolamine, lysylphosphatidylglycerol, palmitoylphosphatidylglycerol (POPG), and other anionic groups linked to neutral lipids.

[0096] The term “cationic lipid” refers to any of many types of lipids that carry a net positive charge at a selected pH, such as physiological pH. These lipids include, but are not limited to, N,N-dioleoyl-N,N-dimethylammonium chloride (“DODAC”); N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (“DOTMA”); N,N-distearate-N,N-dimethylammonium bromide (“DDAB”); N-(2,3-dioleoyloxy)propyl)-N,N,N-trimethylammonium chloride (“DOTAP”); 3-(N-(N',N'-dimethylaminoethane)carbamoyl)cholesterol (“DC-Chol”); and N-(1,2-dimyristyloxypropyl-3-yl)-N,N-dimethyl-N-hydroxyethylammonium bromide (“DMRIE”). The following lipids are cationic and have a positive charge below physiological pH: DODAP, DODMA, DMDMA, etc.

[0097] The term "phospholipid" refers to lipids containing phosphate groups, belonging to complex lipids, also known as phospholipids or phospholipid lipids. Phospholipids are the main components of biological membranes, divided into two main categories: glycerophospholipids and sphingomyelins, composed of glycerol and sphingosine, respectively. Phospholipids are amphoteric molecules, with one end being a hydrophilic nitrogen- or phosphorus-containing head and the other end being a hydrophobic (lipophilic) long hydrocarbon chain. For this reason, the hydrophilic ends of phospholipid molecules are close to each other, and the hydrophobic ends are close to each other, often forming a phospholipid bilayer, i.e., the structure of the cell membrane, together with other molecules such as proteins, glycolipids, and cholesterol.

[0098] The term "lipid delivery system" refers to a technology for delivering small or large molecules. It mainly utilizes the properties of lipids (such as phospholipids) to encapsulate and transport small or large molecules, effectively delivering them to target cells or tissues, thereby improving the bioavailability and therapeutic efficacy of the small or large molecules.

[0099] The term "LNP" refers to a nanoscale colloidal delivery system formed by the self-assembly of components such as cationic lipids or ionizable lipids, auxiliary lipids, cholesterol, and polyethylene glycol-modified lipids. Among them, cationic lipids play a key role in mediating the encapsulation and cellular uptake of nucleic acids, and the positive charge carried by cationic lipids or ionizable lipids after ionization can bind to negatively charged nucleic acids (such as mRNA, siRNA, ASO, etc.) through electrostatic interactions, thereby effectively protecting nucleic acids and promoting their delivery to target cells.

[0100] The term "non-cationic lipid or non-ionizable lipid" refers to lipids that are neither cationic nor non-ionizable, such as anionic lipids or neutral lipids.

[0101] The term "nitrogen-to-phosphorus ratio" refers to the ratio of the amino head of ionizable lipids to the phosphate group of nucleic acids.

[0102] Preparation method of arachidonic acid lipid nanoparticle drug delivery system:

[0103] In some embodiments, the preparation method includes mixing the ionizable lipid, arachidonic acid, conjugated lipids that inhibit particle aggregation, non-cationic lipids or non-ionizable lipids other than conjugated lipids that inhibit particle aggregation, metal ions and nucleic acid drugs, and then self-assembling them to obtain an arachidonic acid lipid nanoparticle drug delivery system.

[0104] In some implementations, the preparation method specifically involves: 1) dissolving ionizable lipids, arachidonic acid, conjugated lipids that inhibit particle aggregation, non-cationic lipids or non-ionizable lipids other than conjugated lipids that inhibit particle aggregation, and metal ions in ethanol to obtain an ethanol phase; 2) dissolving nucleic acid drugs in a buffer solution to obtain an aqueous phase; and 3) mixing the aqueous phase and the ethanol phase and removing the ethanol to obtain the arachidonic acid lipid nanoparticle drug delivery system.

[0105] In some embodiments, the conjugated lipids that inhibit particle aggregation include PEG-lipid conjugates, such as DMG-PEG2000.

[0106] In some embodiments, the non-cationic lipid or non-ionizable lipid is any one of lecithin PC, phosphatidylethanolamine PE, phosphatidylserine PS, phosphatidic acid PA, phosphatidylglycerol PG, 1-phosphoceramide SP, phosphatidylinositol PI, phosphatidylthreonine PT, sphingomyelin SM, lysophosphatidylcholine LPC, lysophosphatidylethanolamine LPE, lysophosphatidylserine LPS, lysophosphatidylglycerol LPA, lysophosphatidylglycerol LPG, lysophosphatidylinositol LPI, lysophosphatidylthreonine LPT, lysophosphatidylsphingomyelin LSM, sphingosine 1-phosphate S1P, cholesterol, and their derivatives.

[0107] In some embodiments, the metal ion is Fe. 3+ Fe 2+ Cu 2+ Ga 3+ Mn 2+ Pb 2+ Cd 2+ Ni 2+ Sb 3+ At least one of the following; preferably Fe 3+ Fe 2+ Cu 2+ Fe is the best. 3+ .

[0108] In some embodiments, the ionizable lipid is SM-102.

[0109] The term "nucleic acid" refers to a polymer consisting of at least two deoxynucleotides or nucleotides, existing in single or double strands. Unless specifically limited, the term encompasses nucleic acids containing known analogs of natural nucleotides, having similar binding properties to reference nucleic acids, and being metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a specific nucleic acid sequence also implicitly includes variants of its conserved modifications (e.g., degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences, as well as explicitly indicated sequences. Specifically, degenerate codon substitutions can be obtained by generating sequences in which the third position of one or more selected (or all) codons is replaced by a mixture of bases and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19: 5081 (1991); Ohtsukae et al., J. Biol. Chem. 260: 2605-2608 (1985); and Cassole et al. (1992); Rossolinie et al., Mol. Cell. Probes 8: 91-98 (1994)). A “nucleotide” contains a sugar, deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together by phosphate groups. "Bases" include purines and pyrimidines, further including natural compounds adenine, thymine, guanine, cytosine, uracil, inosine, and natural analogs, as well as synthetic derivatives of purines and pyrimidines, including, but not limited to, modifications that replace new reactive groups, such as, but not limited to, amines, alcohols, thiols, carboxylates (esters), and alkyl halides. DNA can exist as antisense, plasmid DNA, portions of plasmid DNA, pre-compressed DNA, polymerase chain reaction (PCR) products, vectors (P1, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives of these groups. The terms nucleic acid, gene, cDNA, mRNA encoded by a gene, and interfering RNA molecules may be used interchangeably.

[0110] The term "mRNA" refers to a single-stranded polynucleotide transcribed from one strand of DNA as a template, carrying genetic information and capable of guiding protein synthesis.

[0111] The term "sgRNA" refers to a small, non-coding RNA that guides the insertion or deletion of uridine residues into the kinetoplastid during RNA editing. gRNAs pair with pre-mRNAs. They edit RNA molecules that are approximately 60-80 nucleotides long and are transcribed from a single gene.

[0112] The term "circRNA" refers to a polynucleotide molecule that has no free ends (i.e., no free 3' and / or 5' ends), such as polynucleotides that form cyclic or ring structures through covalent or non-covalent bonds.

[0113] The term "microRNA" refers to a non-coding single-stranded polynucleotide with a length of approximately 22 nucleotides and free 3' and 5' ends. It can regulate the biological functions of cells by binding to the 3'-untranslated region (3'-UTR) of the mRNA of target genes, thereby inhibiting the translation of target gene proteins.

[0114] The term "ASO" refers to a synthetically produced nucleic acid fragment that is complementary to a segment of a target gene or mRNA. It can bind to the target gene / mRNA through the base complementarity principle, thereby blocking gene expression. It includes antisense DNA and antisense RNA.

[0115] The term "siRNA" refers to a class of double-stranded RNA molecules that are 20 to 25 nucleotides in length and can induce the degradation of target gene mRNA.

[0116] In some embodiments, the nucleic acid drug is at least one selected from mRNA, siRNA, sgRNA, ASO, circRNA, microRNA, double-stranded DNA, and single-stranded DNA.

[0117] In some implementations, the nucleic acid drug component typically includes mRNA, interfering RNA (i.e., siRNA), which can be provided in several forms, including, for example, one or more isolated siRNA duplexes, longer double-stranded RNA (dsRNA), or siRNA or dsRNA translated from a transcription cassette in a DNA plasmid.

[0118] RNA ensembles can be used to provide long precursor RNAs, or long precursor RNAs that are substantially or completely identical to selected target sequences that can be used to prepare siRNA. The RNAs can be isolated, synthesized, and / or cloned from cells or tissues according to methods well known to those skilled in the art. The RNAs can be a mixed ensemble (obtained from cells or tissues, transcribed from cDNA, etc.) or can represent a single target sequence. The RNAs can be naturally occurring, for example, isolated from tissue or cell samples, synthesized in vitro, for example, using T7 or SP6 polymerases and PCR products or cloned cDNA; or synthesized chemically.

[0119] To form long dsRNAs, for synthetic RNAs, complements can also be transcribed and hybridized in vitro to form dsRNAs. If naturally occurring RNA groups are used, for example by transcribing cDNAs corresponding to the RNA group, or by using RNA polymerases, RNA complements are also provided (e.g., forming dsRNAs, which are then digested by E. coli RNase III or digestion enzymes). The precursor RNAs then hybridize to form double-stranded RNAs for digestion. The dsRNAs can be directly encapsulated in SNALPs or can be digested in vitro before encapsulation.

[0120] Alternatively, one or more DNA plasmids encoding one or more siRNA templates can be encapsulated in the drug delivery system. For example, based on naturally occurring transcription units of small nuclear RNA U6 or human RNase p RNA H1, siRNA can be transcribed from a DNA template in a plasmid into a sequence that automatically folds into a double strand with a hairpin loop, the plasmid having RNA polymerase III transcription units (see, Brummelkamp, ​​et al., Science 296:550 (2002); Donzé, et al., Nucleic Acids Res. 30:e46 (2002); Paddison, et al., Genes Dev. 16:948 (2002); Yu, et al., Proc. Natl. Acad. Sci. 99:6047 (2002); Lee, et al., Nat. Biotech. 20:500 (2002); Miyagishi, et al., Nat. Biotech. 20:497 (2002); Paul, et al. et al., Nat. Biotech. 20: 505 (2002); and Sui, et al., Proc. Natl. Acad. Sci. 99: 5515 (2002)). Typically, the transcription unit or cassette will contain an RNA transcription promoter sequence, such as an H1-RNA or U6 promoter, and a termination sequence operatively linked to a template of the desired siRNA sequence for transcription. The termination sequence comprises 2-3 uridine residues and a polythymidine (T5) sequence (polyadenylation signal) (Brummelkamp, ​​Science, ibid.). The selected promoter can provide constitutive or inducible transcription. A method for transcription of the composition and DNA-directed RNA interference molecule is described in detail in U.S. Patent No. 6,573,099, which is incorporated herein by reference. Preferably, the synthetic or transcribed siRNA has about 1-4, preferably about 2-3 nucleotides, with a 3' overhang and a 5' phosphate end (Elbashir, et al., Genes Dev. 15:188 (2001); et al., Cell 107:309 (2001)). The transcription unit is incorporated into a plasmid or DNA vector, from which the interfering RNA is transcribed. Plasmids suitable for in vivo delivery of genetic material for therapeutic purposes are described in detail in U.S. Patent Nos. 5,962,428 and 5,910,488, both of which are incorporated herein by reference. Selected plasmids can provide transient or stable delivery to target cells. It will be apparent to those skilled in the art that plasmids initially designed to express desired gene sequences can be modified to contain a transcription unit cassette for transing siRNA.

[0121] In some embodiments, the nucleic acid drug is siRNA; the nitrogen-to-phosphorus ratio of the ionizable lipid to the nucleic acid drug is 6; the nucleic acid drug and the metal ion Fe 3+ The mass ratio is 1:(0.1-1); the siRNA includes any one of GPX4-siRNA, SLC7A11-siRNA, Nrf2-siRNA and CY5-GPX4-siRNA.

[0122] In some embodiments, the non-cationic lipid or non-ionizable lipid is cholesterol; the molar ratio of SM-102, arachidonic acid, cholesterol and DMG-PEG2000 is 50:10:38.5:1.5.

[0123] The following embodiments are provided as examples and are not intended to limit the claimed invention. Those skilled in the art will readily recognize various non-critical parameters that can produce substantially the same results.

[0124] Example 1

[0125] This invention provides an arachidonic acid lipid nanoparticle drug delivery system ALNP@GPX4-siRNA-Fe 3+ The preparation method of ALNP@GPX4-siRNA-Fe was carried out simultaneously with different proportions of metal ions. 3+ The study of particle size PDI and surface potential includes the following steps:

[0126] (1) Preparation of ALNP

[0127] This invention refers to the composition of the LNP of the commercially available product "Onpattro". The molar ratio of ionizable lipids, auxiliary lipids, cholesterol and PEG lipids is 50:10:38.5:1.5. Among them, the ionizable lipid used is SM-102. The auxiliary lipid portion is changed from distearylphosphatidylcholine to the polyunsaturated fatty acid arachidonic acid (ARA). The cholesterol and PEG lipids remain unchanged. The PEG lipid used is PEG2000-DMG. The siRNA is GPX4 (glutathione peroxidase 4)-siRNA with the following sequences: Sense (5'-3'): GUAACGAAGAGAUCAAAGAUU, SEQ ID NO:1; Antisense (5'-3'): UCUUUGAUCUCUUCGUUACUU, SEQ ID NO:2. The primers for GPX4 mRNA were purchased from Beyotime, product number: QH15281S, product name: Human GPX4qPCR Primer Pair.

[0128] The specific steps are as follows: lipids are dissolved in an ethanol phase with the following concentrations: SM-102 7.748 mg / mL, cholesterol 3.248 mg / mL, arachidonic acid 1 mg / mL, and DMG-PEG2000 0.81 mg / mL. siRNA is dissolved in an aqueous phase prepared with pH 5.0 Tris-HCl buffer at a concentration of 150 μg / mL. The nitrogen-to-phosphorus ratio of SM-102 to siRNA is 6, the volume ratio of ethanol to aqueous phase is 1:3, and the total flow rate is 12 mL / min. After mixing in a microfluidic chip, ethanol is removed by ultrafiltration and centrifugation to obtain the final product, arachidonic acid lipid nanoparticles (ALNP).

[0129] (2) ALNP@GPX4-siRNA, ALNP@GPX4-siRNA-Fe 3+ Preparation

[0130] The added Fe 3+ FeCl3·6H2O was added to the ethanol phase above, with different mass ratios depending on the mass of GPX4-siRNA. A 0:0 ratio indicates no siRNA and FeCl3. 3+ Empty ALNP vector, 1:0 is ALNP@GPX4-siRNA without Fe 3+ 1:0.1, 1:0.33, 1:0.66, and 1:1 represent the ratios of ALNP@GPX4-siRNA-Fe 3+ Among them, GPX4-siRNA:Fe 3+ The (w / w) ratios were 1:0.1, 1:0.33, 1:0.66, and 1:1, with specific values ​​as follows: 1 mL of ALNP lipid ethanol solution corresponds to 3 mL of siRNA solution, with a total nucleic acid mass of 450 μg. The 1:0.1 group lipid ethanol solution contained Fe... 3+ The amount added was 45 μg, and the Fe ratio was 1:0.33. 3+ The amount added was 150 μg, and the Fe ratio was 1:0.66. 3+ The amount added was 300 μg, 1:1 Fe 3+ The amount added was 450 μg, of which ALNP@GPX4-siRNA-Fe 3 + Structure as Figure 1 As shown;

[0131] (3) Sample preparation and dispersion methods for particle size detection

[0132] The particle size of each group of samples was measured using a Malvern laser particle size analyzer both immediately after mixing and in the final product stage. Surface potential (Zeta potential) data were also measured in the final product stage. Results are shown below. Figure 3-6 As shown in the figure, both ARA and GPX4-siRNA carry negatively charged groups. In the 0:0 and 1:0 groups, the lack of iron ions to aid particle self-assembly resulted in significantly higher PDI values ​​(above 0.2) in the 0:0 and 1:0 groups during MIX compared to the other four groups. The particle size of the 0:0 group was 93.92 nm ± 1.40 nm, while the volume increase of the 1:0 group after GPX4-siRNA loading was 113.87 nm ± 5.07 nm, containing Fe. 3+ The four ratios of 1:0.1, 1:0.33, 1:0.66, and 1:1 all showed a PDI of less than 0.2 with the addition of iron ions, specifically 0.137±0.019, 0.155±0.026, 0.042±0.014, and 0.074±0.054, respectively. The particle size gradually increased with the increase of iron ions, reaching 94.61nm±0.73nm, 118.40nm±2.33nm, 165.27nm±3.61nm, and 233.67nm±6.75nm, respectively. Among them, the PDI of the 1:0.66 and 1:1 ratios was optimal.

[0133] After removing impurities from the ethanol in each group using ultrafiltration centrifugation, the PDI of the 0:0, 1:0, and 1:0.1 groups improved to 0.090±0.034, 0.034±0.007, and 0.040±0.009, respectively, with particle sizes of 92.82nm±0.94nm, 101.03nm±0.85nm, and 103.10nm±1.59nm, respectively. The PDI of the 1:0.33 and 1:0.66 groups showed no significant change to 0.080±0.033 and 0.092±0.032, respectively, with particle sizes of 116.70nm±2.63nm and 152.80nm±2.63nm, respectively. The 1:1 group showed a sharp increase in both particle size and PDI, possibly due to Fe... 3+ Excessive addition of the substance caused the nanoparticles to aggregate, so this group was excluded in subsequent experiments. The surface potential data of each group were all between 0 and -4mV, with no significant difference.

[0134] Combining the particle size data of MIX and the finished product, it can be seen that Fe 3+ The addition of [a specific ingredient] can help the self-assembly process of nanoparticles, reduce PDI, and control Fe [a specific ingredient]. 3+ The amount added can be adjusted to control the particle size of nanoparticles, with the control range between 100nm and 150nm.

[0135] ALNP@GPX4-siRNA-Fe with different proportions of metal ions 3+siRNA and Fe 3+ Encapsulation rate

[0136] 1) siRNA encapsulation efficiency detection method

[0137] The siRNA encapsulation efficiency was detected by agarose gel electrophoresis. The agarose concentration in the agarose gel was 1.5% (w / v%), and the electrophoresis voltage was 80V. The gray values ​​of naked nucleic acid and free siRNA in each group were counted using ImageJ software. The siRNA encapsulation efficiency was calculated as (1 - gray value of free siRNA / gray value of naked nucleic acid) * 100%.

[0138] 2) Fe 3+ Encapsulation efficiency testing methods

[0139] Fe 3+ The encapsulation efficiency was determined using ultrafiltration, with an ultrafiltration tube pore size of 100 kDa. Unbound free Fe was measured after MIX. 3+ The solution was ultrafiltered into the filtrate, and then inductively coupled plasma mass spectrometry (ICP-MS) was used to detect the Fe content in each group of original solutions and filtrates. 3+ mass concentration of Fe 3+ Encapsulation efficiency = (1 - Fe of filtrate) 3+ Mass concentration / stock solution Fe 3+ (mass concentration) * 100%;

[0140] See results Figure 7-9 It can be seen that due to the strong encapsulation capacity of ionizable lipids, the siRNA encapsulation rate of ALNP in each group exceeded 90%, with no significant difference; due to the presence of ARA and siRNA, Fe 3+ With numerous binding sites, the encapsulation rates of each group were around 90%, showing no significant difference.

[0141] ALNP@GPX4-siRNA-Fe with different proportions of metal ions 3+ stability

[0142] Stability testing methods

[0143] The stability of each group was tested at 4℃ and in a simulated body fluid environment of 37℃ + 20% FBS. The particle size and PDI of each group were measured using a Malvern laser particle size analyzer at different time points. The results are shown in [Figure number missing]. Figure 10-13 It can be seen that when stored at 4℃, the particle size distribution (PDI) of each group did not change significantly within 10 days. However, in the stability test of a simulated body fluid environment at 37℃ + 20% FBS, the 0:0, 1:0, and 1:0.1 Fe-free groups showed significant differences. 3+ or Fe 3+In the three groups with lower addition amounts, the particle size distribution (PDI) fluctuated drastically within 3 hours, with particle sizes exceeding 200 nm and PDI exceeding 0.3. In the 1:0.33 group, the particle size increase was controlled within 20 nm within 3 hours, but it still exceeded 200 nm within 6 hours, with PDI exceeding 0.3. In the 1:0.66 group, the particle size remained below 200 nm within 72 hours, and the PDI remained below 0.3 within 42 hours. In summary, all ALNP groups can be stably stored for more than 10 days at 4℃. In body fluid environments, the 1:0.66 group showed the best stability, followed by the 1:0.33 group. Fe... 3+ The addition of [a certain ingredient] can effectively enhance the stability of the material.

[0144] ALNP@GPX4-siRNA-Fe with different proportions of metal ions 3+ mRNA knockdown efficiency study

[0145] Experimental methods

[0146] Mouse uveal melanoma cells (C918) were seeded in 6-well plates overnight at a density of 8000 cells / mL. Materials from each group were added to the wells for incubation. The concentration of GPX4-siRNA was 1 μg / mL. For the 0:0 group, the concentration was the same as the 1:0 group. After 48 hours of incubation, total RNA was extracted from the cells in each group, and GPX4 gene expression was detected using RT-qPCR. The results are shown below. Figure 14 It can be seen that the 0:0 group, lacking GPX4-siRNA, had no effect on GPX4 mRNA expression. In the 1:0, 1:0.1, 1:0.33, and 1:0.66 groups, GPX4-siRNA was well transfected into cells to exert its mRNA knockdown effect, and Fe... 3+ The presence of [something] had no significant impact, and the knockdown efficiency of each group was above 80%, with no significant difference.

[0147] ALNP@GPX4-siRNA-Fe with different proportions of metal ions 3+ Cell survival rate

[0148] Experimental methods

[0149] Human renal epithelial cells 293T and mouse uveal melanoma cells C918 were seeded into 96-well plates one day in advance at a cell density of 8000 cells / mL. The materials from each group were added to the wells for incubation. The concentration of GPX4-siRNA was 0.25-2 μg / mL. For the 0:0 group, the concentration was used as an example of the 1:0 group. After 72 hours of incubation, the cell viability of each group was detected using a CCK8 assay kit. The results are shown below. Figure 15-17It can be seen that for normal 293T cells, there was no significant killing effect at concentrations ranging from 0.25 μg / mL to 2 μg / mL, and the cell viability in each group was above 80%. For C918 cancer cells, there was no significant killing effect at any concentration in the 0:0 and 1:0 groups, proving that simply adding ARA and knocking down GPX4 mRNA expression cannot produce a devastating effect on cancer cells. 3+ In the three groups of 0:0.1, 0:0.33, and 0:0.66, Fe 3+ At insufficient concentrations, it has no significant killing effect on cancer cells; on the contrary, it has a weak proliferative effect (Fe). 3+ It can participate in many metabolic processes), while Fe 3+ When a certain concentration is reached, the addition of ARA and GPX4-siRNA can significantly kill cancer cells.

[0150] ALNP@GPX4-siRNA-Fe 3+ Iron cycling experiment

[0151] Experimental methods

[0152] o-phenanthroline can react with Fe in the pH range of 3.0 to 9.0. 2+ The ions form a stable orange-red complex, allowing for direct observation of Fe. 2+ The generation of Fe; prepare five centrifuge tubes, add 1 mL of Fe to the first group. 2+ Solution, the second group added 1 mL Fe 3+ Solution, the third group added 1 mL Fe 2+ Add 1 mL of H2O2 (30%, v / v%) to the fourth group, and add 1 mL of Fe. 3+ Add ARA (100 μg / mL, 1 mL) and 1 mL of Tris-HCl buffer (100 mM) at pH 7.4. For the fifth group, add 1 mL of Fe. 3+ Add ARA (100 μg) and 1 mL of Tris-HCl buffer (100 mM) at pH 5.0; Fe 3+ with Fe 2+ Both were dissolved in ultrapure water to form Fe with a mass concentration of 50 μg / mL. 2 + Solution and Fe 3+ The solution was reacted at 37℃ for 6 hours, and then 500 μL (5 mg / mL) of o-phenanthroline solution was added for color development. The results are shown in the figure. Figure 18 It can be seen that Fe in the first group 2+ When it complexes with o-phenanthroline, it appears orange-red; in the second group, Fe... 3+ Colorless with ortho-phenanthroline, Fe in the third group 2+ Fe reacts with H2O2 2+Oxidized to Fe 3+ The phenanthroline remained colorless, and in the fourth group at pH 7.4, ARA could not effectively reduce Fe. 3+ The adjacent phenanthroline remains colorless, possibly because Fe at this point... 3+ The compound formed a complex with the carboxyl group in ARA and could not readily oxidize the double bond. In the fifth group, ARA significantly reduced Fe at pH 5.0. 3+ Fe 2+ When it complexes with ortho-phenanthroline, it turns orange-red.

[0153] As can be seen from the above, such as Figure 2 This invention is the first to replace the structural lipid DSPC in LNP with arachidonic acid, a polyunsaturated fatty acid (PUFA). The PEG lipid used is PEG2000-DMG, which is used to prepare the ALNP. The ALNP is then loaded with GPX4-siRNA, a siRNA drug targeting glutathione peroxidase 4, and Fe. 3+ ALNP@GPX4-siRNA-Fe was prepared 3+ This treatment uses ferroptosis to kill cancer cells. ALNP@GPX4-siRNA-Fe 3+ Fe in 3+ Total Fe in cancer cells 3+ While inducing ferroptosis, the content can increase the overall stability of the material and the lysosomal escape rate. ALNP@GPX4-siRNA-Fe 3+ Fe in 3+ Nanoparticles of varying sizes, ranging from 100 nm to 150 nm, can be prepared by varying the mass ratio of siRNA with Fe. 3+ The mass ratio of siRNA to ALNP can be used to regulate the particle size of the material. 3+ ARA in the formula can replenish PUFA levels in cancer cells, induce ferroptosis, and rapidly reduce Fe in an acidic environment. 3+ Fe 2+ Fe 2+ It reacts with excess H2O2 in cancer cells via a Fenton reaction to generate reactive oxygen species (ROS) and oxidizes PUFA, yielding Fe. 3+ Fe continues to be generated under the action of ARA 2+ The formation of the iron cycle leads to the massive generation of reactive oxygen species (ROS). This invention simultaneously targets three elements in the ferroptosis mechanism: Fe... 3 + GPX4 and PUFA were selected as materials, and lipids were designed. Due to iron overload and abnormal redox states caused by oxidative stress in most cancer cells, ALNP@GPX4-siRNA-Fe 3+It has a strong specific killing ability against cancer cells.

[0154] Example 2

[0155] Provides an ALNP@CY5-siRNA-Fe 3+ Lysosomal escape experiment:

[0156] Following the method described in Example 1, ALNP@CY5-siRNA and ALNP@CY5-siRNA-Fe were prepared by replacing siRNA (GPX4-siRNA) with CY5-siRNA (CY5-GPX4-siRNA). 3+ (Ratio 1:0.66) Mouse uveal melanoma cells C918 were seeded in 6-well plates overnight at a density of 8000 cells / mL. Materials from each group were added to the wells for incubation. The concentration of CY5-siRNA was 1 μg / mL. After 6 hours of incubation, lysosomal tracker Green was added to label the lysosomes. ImageJ software was used to perform colocalization analysis of red and green fluorescence. Red fluorescence (CY5) indicated the presence of free siRNA, green fluorescence (Lysosomal tracker Green) indicated the presence of lysosomes, and yellow fluorescence indicated that the siRNA was still encapsulated within the lysosomes. Results are shown in [Figure number missing]. Figure 19-21 As can be seen, the Pearson coefficient represents the overlap rate of two fluorescences; the larger the coefficient, the higher the degree of co-localization. The Pearson coefficient of ALNP@CY5-siRNA is 0.66±0.05. 3+ The Pearson coefficient was 0.39 ± 0.04, ALNP@CY5-siRNA-Fe 3+ The low degree of co-localization between lysosomes and siRNA, i.e., the high escape rate, indicates that Fe 3+ It can help materials escape from lysosomes; the metal ion Fe of this invention 3+ Total Fe in cancer cells 3+ While inducing ferroptosis, the content can increase the overall stability of the material and the lysosomal escape rate.

[0157] The sequence of CY5-GPX4-siRNA is as follows:

[0158] Sense(5'-3'):GUAACGAAGAGAUCAAAGAUU, SEQ ID NO:7;

[0159] The 5' end of SEQ ID NO:7 is fluorescently labeled with CY5;

[0160] Antisense (5'-3'): UCUUUGAUCUCUUCGUUACUU, SEQ ID NO: 8.

[0161] Example 3

[0162] ALNP@siRNA-Fe 3+ Study on knockdown efficiency of different siRNAs

[0163] Following the method in Example 1, ALNP@SLC7A11-siRNA-Fe was prepared by replacing the siRNA with SLC7A11-siRNA and Nrf2-siRNA, respectively. 3+ With ALNP@Nrf2-siRNA-Fe 3+ siRNA quality and Fe 3+ The mass ratio was 1:0.66. Mouse uveal melanoma cells (C918) were seeded in 6-well plates overnight at a cell density of 8000 cells / mL. Materials from each group were added to the wells and incubated. The concentration of siRNA was 1 μg / mL. After 48 hours of incubation, total RNA was extracted from the cells in each group, and the expression of different genes was detected using RT-qPCR. The results are shown below. Figure 20-21 It can be seen that both SLC7A11-siRNA and Nrf2-siRNA were well transfected into cells to exert mRNA knockdown effects, and Fe 3+ The presence of siRNA had no significant impact, and the knockdown efficiency of each group with siRNA was above 70%, with no significant difference.

[0164] The sequence of SLC7A11-siRNA is as follows:

[0165] Sense(5'-3'):CCCAGGUGGUUUAGAAUAATT, SEQ ID NO:3;

[0166] Antisense (5'-3'): UUAUUCUAAAACCACCUGGGTT, SEQ ID NO: 4.

[0167] The sequence of Nrf2-siRNA is as follows:

[0168] Sense(5'-3'):CAAACAGAAUGGUCCUAAATT, SEQ ID NO:5;

[0169] Antisense(5'-3'):UUUAGGACCAUUCUGUUUGTT, SEQ ID NO:6;

[0170] The primers for SLC7A11 mRNA were purchased from Beyotime, product number: QM24718S, product name: MouseSlc7a11 qPCR Primer Pair;

[0171] The primers for Nrf2 mRNA were purchased from Beyotime, product number: QH18997S, product name: Human NFE2L2qPCR Primer Pair.

[0172] The above embodiments are only used to illustrate the technical solutions of the present invention, and are not intended to limit it. Although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features. Such modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A method for preparing an arachidonic acid lipid nanoparticle drug delivery system, characterized in that, The lipid nanodelivery system comprises the following components: (1) Ionizable lipids; (2) Arachidonic acid; (3) Conjugated lipids that inhibit particle aggregation, wherein the conjugated lipids that inhibit particle aggregation are non-cationic lipids or ionizable lipids; (4) Non-cationic lipids or non-ionizable lipids other than (3); (5) Metal ions; (6) Nucleic acid drugs; The preparation method includes mixing the ionizable lipid, arachidonic acid, conjugated lipids that inhibit particle aggregation, non-cationic lipids or non-ionizable lipids other than (3), metal ions and nucleic acid drugs, and then self-assembling them to obtain an arachidonic acid lipid nanoparticle drug delivery system.

2. The preparation method according to claim 1, characterized in that, The preparation method includes the following steps: 1) Dissolve ionizable lipids, arachidonic acid, conjugated lipids that inhibit particle aggregation, non-cationic lipids or non-ionizable lipids other than (3) and metal ions in ethanol to obtain an ethanol phase; 2) Dissolve the nucleic acid drug in a buffer solution to obtain an aqueous phase; 3) After mixing the aqueous phase and the ethanol phase, the ethanol is removed to obtain the arachidonic acid lipid nanodelivery system.

3. The preparation method according to claim 2, characterized in that, The buffer solution is a pH 5.0 Tris-HCl buffer solution.

4. The preparation method according to claim 2, characterized in that, The volume ratio of the ethanol phase to the water phase is 1:

3.

5. The preparation method according to claim 2, characterized in that, The mixing is performed using a microfluidic chip, with a total flow rate of 12 mL / min.

6. The preparation method according to claim 1, characterized in that, The structural formula of the arachidonic acid is: ; The conjugated lipids that inhibit particle aggregation include PEG-lipid conjugates; The non-cationic lipids or non-ionizable lipids other than (3) are any one of the following: lecithin PC, phosphatidylethanolamine PE, phosphatidylserine PS, phosphatidic acid PA, phosphatidylglycerol PG, 1-phosphoceramide SP, phosphatidylinositol PI, phosphatidylthreonine PT, sphingomyelin SM, lysophosphatidylcholine LPC, lysophosphatidylethanolamine LPE, lysophosphatidylserine LPS, lysophosphatidylglycerol LPA, lysophosphatidylglycerol LPG, lysophosphatidylinositol LPI, lysophosphatidylthreonine LPT, lysophosphatidylcholine LSM, 1-phosphosphoamine S1P, cholesterol, or their derivatives; the structural formula is: lecithin PC phosphatidylethanolamine PE phosphatidylserine PS phosphatidic acid PA phosphatidylglycerol PG 1-Phosphoceramide SP phosphatidylinositol PI Phosphatidylthreonine PT SM sphingomyelin Lysophosphatidylcholine (LPC) lysophosphatidylethanolamine (LPE) Lysophosphatidylserine (LPS) Lysophosphatidylcholine (LPA) Lysophosphatidylglycerol (LPG) Lysophosphatidylinositol (LPI) Lysophosphatidylthreonine LPT lysophospholipid LSM 1-Sphingosine phosphate S1P ,cholesterol ; The metal ion is Fe. 3+ Fe 2+ Cu 2+ Ga 3+ Mn 2+ Pb 2+ Cd 2+ Ni 2+ Sb 3+ At least one of them; The ionizable lipid is SM-102, with the following structural formula: ; The nucleic acid drug is at least one of mRNA, siRNA, sgRNA, ASO, circRNA, microRNA, double-stranded DNA, and single-stranded DNA.

7. The preparation method according to claim 6, characterized in that, The nitrogen-to-phosphorus ratio of the ionizable lipid and nucleic acid drug is 6; the mass ratio of the nucleic acid drug to the metal ion is 1:(0.1-1).

8. The preparation method according to claim 7, characterized in that, The nucleic acid drug is siRNA; the siRNA includes any one of GPX4-siRNA, SLC7A11-siRNA, Nrf2-siRNA and CY5-GPX4-siRNA.

9. The preparation method according to claim 8, characterized in that, in, The nucleotide sequence of the GPX4-siRNA is shown in SEQ ID NO:1 and SEQ ID NO:2; The nucleotide sequence of the SLC7A11-siRNA is shown in SEQ ID NO:3 and SEQ ID NO:4; The nucleotide sequence of the Nrf2-siRNA is shown in SEQ ID NO:5 and SEQ ID NO:6; The nucleotide sequence of the CY5-GPX4-siRNA is shown in SEQ ID NO:7 and SEQ ID NO:

8.

10. The preparation method according to claim 6, characterized in that, The ionizable lipid is SM-102, the conjugated lipid that inhibits particle aggregation is DMG-PEG2000, and the non-cationic lipid or non-ionizable lipid other than (3) is cholesterol; the molar ratio of SM-102, arachidonic acid, cholesterol and DMG-PEG2000 is 50:10:38.5:1.5.

Citation Information

Patent Citations

  • Plasmids suitable for gene therapy

    US5910488A

  • Compositions and methods for delivery of genetic material

    US5962428A

  • Genetic constructs for delaying or repressing the expression of a target gene

    US6573099B2

  • MRNA (messenger ribonucleic acid) lipid nanoparticle delivery system as well as preparation method and application thereof

    CN115154439A

  • Application of ionizable lipid compound in preparation of nucleic acid drug delivery system

    CN115957329A