Sulfate reducing bacteria with phosphate solubilizing capacity and application thereof in ecological restoration of soil

Abstract

The invention relates to sulfate reducing bacteria with phosphate solubilizing capacity and application of the sulfate reducing bacteria in soil ecological restoration, and belongs to the technical field of soil environment microorganisms. The sulfate reducing bacterium disclosed by the invention is Desulfosporosinus sp.QY25, and is preserved in the Guangdong Microbial Culture Collection Center on August 6, 2024, and the preservation number of the sulfate reducing bacterium is GDMCC No: 64963. The invention provides a sulfate reducing bacterium Desulfosporosinus sp.QY25 which is high in dissimilatory sulfate reducing capacity and can be used for converting insoluble phosphorus in soil into soluble phosphorus which can be absorbed by plants. The invention further provides a preparation method of the sulfate reducing bacterium Desulfosporosinus sp.QY25 and an application of the sulfate reducing bacterium Desulfosporosinus sp.QY25. The strain can restore soil ecology, neutralize pH, reduce the content of SO4 < 2->, reduce the bioavailability of heavy metals, improve the utilization efficiency of phosphorus in soil, improve the activity of acid phosphatase in tailings and enable plants to grow well.

Description

Technical Field

[0001] This invention relates to the field of soil environmental microbiology, and in particular to a sulfate-reducing bacterium with phosphorus-solubilizing ability and its application in soil ecological restoration. Background Technology

[0002] Mineral resources are a crucial material foundation for economic and social development. However, with the development and utilization of mineral resources, the area of ​​exposed land and the area covered by large amounts of tailings and other solid waste from mining are rapidly increasing, posing a pollution hazard to the surrounding environment. Heavy metal tailings are waste generated during the mining and beneficiation processes of metal mines. They typically contain low pH, high levels of heavy metals, and may contain sulfides, creating an ecological environment that is severely detrimental to the survival of most organisms. Furthermore, phosphorus is one of the main limiting factors for plant growth, and abandoned mining areas suffer from a severe deficiency of available phosphorus, which is also unfavorable for plant growth.

[0003] Sulfate-reducing bacteria (SRB) are facultative anaerobic prokaryotes. SRB typically use organic or inorganic compounds as electron donors and sulfate as electron acceptors, carrying out sulfate reduction reactions through dissimilatory processes to remove SO42- from the environment. 2- Restore to S 2- This process allows it to combine with heavy metal ions (such as iron, copper, lead, cadmium, and zinc) in the environment to form heavy metal sulfide precipitates, reducing the bioavailability of heavy metals in the environment. Simultaneously, HCO3- is generated during sulfate reduction. - Weak acid anions react with free H+ ions. + Combined, they increase the pH of the environment. Phosphate-solubilizing bacteria (PSB) are a class of microorganisms that can convert insoluble phosphorus in the soil into available phosphorus that can be absorbed and utilized by plants, playing an important role in the biogeochemical cycle of phosphorus. PSM can promote the mineralization and dissolution of insoluble phosphorus by releasing phosphatases and secreting organic acids, thereby promoting the absorption and utilization of phosphorus by plants.

[0004] Currently, heavy metal tailings remediation technologies mainly include physical remediation, chemical remediation, bioremediation, and combined remediation technologies. Among them, phyto-microbe combined remediation combines the advantages and characteristics of multiple remediation technologies, resulting in high remediation efficiency. However, common microbial agents only have single functions, which limits their application in tailings ecological remediation. Therefore, there is an urgent need in this field to find a microbial agent that is adaptable to acidic and neutral mining waste sites and has sulfate reduction and phosphorus solubilization capabilities to better perform combined remediation of tailings soil. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of the prior art and provide a sulfate-reducing bacterium with phosphorus-solubilizing ability and its application in soil ecological restoration.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a sulfate-reducing bacterium, namely Desulfosporosinus sp. QY25, which was deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 6, 2024, with accession number GDMCC No: 64963.

[0007] This invention screened a sulfate-reducing bacterium, Desulfosporosinus sp. QY25, from acidic heavy metal tailings soil. It has excellent sulfate-reducing ability, can further neutralize soil pH, reduce soil heavy metal pollution, and has phosphorus-solubilizing ability, which can increase the available phosphorus content in the soil and restore vegetation growth.

[0008] Secondly, the present invention provides the application of the sulfate-reducing bacteria and / or their fermentation products in soil ecological restoration.

[0009] Furthermore, the soil ecological restoration includes restoring vegetation growth, neutralizing soil pH, and reducing SO4. 2- It can reduce soil heavy metal pollution, increase soil acid phosphatase activity, and increase the content of soluble phosphorus in soil by at least one of the following:

[0010] Furthermore, the vegetation includes at least one of ryegrass, alfalfa, Kentucky bluegrass, tall fescue, and crested wheatgrass.

[0011] Furthermore, the soil includes tailings and spoil heap soil.

[0012] Furthermore, the heavy metal includes at least one of Fe, Cu, Cd, Zn, and Pb.

[0013] Thirdly, the present invention provides a biological agent containing the sulfate-reducing bacteria and / or their fermentation products.

[0014] Furthermore, the biological agent contains a bacterial solution of the sulfate-reducing bacteria.

[0015] Furthermore, the OD of the sulfate-reducing bacteria in the bacterial solution... 600 The value is 0.8 to 1.2, with 1.2 being preferred.

[0016] Furthermore, the bacterial culture also contains an enrichment culture medium containing at least one of (NH4)2SO4, KCl, MgSO4·7H2O, KH2PO4, Ca(NO3)2·4H2O, yeast extract, glycerol, and trace elements, wherein the trace elements include at least one of FeSO4·7H2O, ascorbic acid, and CH3C(S)NH4.

[0017] More preferably, the enrichment culture medium contains 0.44–0.46 g / L (NH4)2SO4, 0.04–0.06 g / L KCl, 0.4–0.5 g / L MgSO4·7H2O, 0.04–0.06 g / L KH2PO4, 0.014–0.015 g / L Ca(NO3)2·4H2O, 0.19–0.21 g / L yeast extract, 0.9–0.95 g / L glycerol, and 4.5–5 mL / L trace elements, wherein the trace elements contain 0.49–0.51 g / L FeSO4·7H2O, 0.019–0.021 g / L ascorbic acid, and 0.09–0.11 g / L CH3C(S)NH4.

[0018] Preferably, the enrichment medium contains 0.45 g / L (NH4)2SO4, 0.05 g / L KCl, 0.5 g / L MgSO4·7H2O, 0.05 g / L KH2PO4, 0.014 g / L Ca(NO3)2·4H2O, 0.2 g / L yeast extract, 0.92 g / L glycerol, and 5 mL / L trace elements, wherein the trace elements contain 0.5 g / L FeSO4·7H2O, 0.02 g / L ascorbic acid, and 0.1 g / L CH3C(S)NH4.

[0019] Fourthly, the present invention provides the application of the biological agent in soil ecological restoration.

[0020] Furthermore, the soil ecological restoration includes restoring vegetation growth, neutralizing soil pH, and reducing SO4. 2- It can reduce soil heavy metal pollution, increase soil acid phosphatase activity, and increase the content of soluble phosphorus in soil by at least one of the following:

[0021] Furthermore, the vegetation includes at least one of ryegrass, alfalfa, Kentucky bluegrass, tall fescue, and crested wheatgrass.

[0022] Furthermore, the soil includes tailings and spoil heap soil.

[0023] Furthermore, the heavy metal includes at least one of Fe, Cu, Cd, Zn, and Pb.

[0024] Fifthly, the present invention provides a method for soil ecological restoration, wherein the sulfate-reducing bacteria are added to the soil for ecological restoration.

[0025] Furthermore, the methods of addition include at least one of watering, spraying, and burying.

[0026] Furthermore, the inoculation dose is 0.5–8% v / v. The preferred inoculation dose is 8% v / v.

[0027] Furthermore, the soil is preliminarily improved, and the preliminary improvement method includes the following steps: mixing alkaline amendment materials and organic amendment materials with the soil, stirring evenly, and allowing the mixture to equilibrate for 1-4 weeks. The alkaline amendment materials include at least one of caustic soda, wood ash, quicklime, and slaked lime; the organic amendment materials include at least one of livestock manure, river silt, pond silt, and sewer silt. The alkaline amendment materials can largely neutralize the acid already produced in the mining wasteland soil, creating favorable conditions for the growth and reproduction of the sulfate-reducing bacteria strains. The organic amendment materials contain abundant nutrients for the growth and reproduction of the sulfate-reducing bacteria strains.

[0028] Furthermore, the livestock and poultry manure includes at least one of chicken manure, pig manure, cow manure, and sheep manure.

[0029] Furthermore, the alkaline amendment material is mixed with the soil, stirred evenly, and allowed to equilibrate for 2 weeks. Then, the organic amendment material is added, stirred evenly, and allowed to equilibrate for 2 weeks.

[0030] More preferably, when the soil redox potential is below 300 mV, a trench with a depth of 8-12 cm is dug in the soil surface layer, the sulfate-reducing bacteria are evenly applied to the trench in the form of bacterial liquid, the trench is backfilled, and the surface soil is gently compacted to carry out ecological restoration.

[0031] Furthermore, plant seeds can be sown in soil inoculated with sulfate-reducing bacteria, and after sowing, the surface can be covered with rice straw and watered for maintenance.

[0032] Furthermore, the sowing rate of the plant seeds is 15–20 g / m². 2 Preferred 18 g / m 2 .

[0033] More preferably, the vegetation includes at least one of ryegrass, alfalfa, Kentucky bluegrass, tall fescue, and crested wheatgrass.

[0034] Compared with the prior art, the beneficial effects of the present invention are as follows: This invention provides a sulfate-reducing bacterium, Desulfosporosinus sp. QY25, with strong dissimilatory sulfate-reducing ability, capable of converting insoluble phosphorus in soil into soluble phosphorus that can be absorbed by plants. This strain can grow and reproduce at pH 5, SO42- 2- High removal rate. This strain can restore soil ecology, neutralize pH, and significantly reduce soil SO4. 2- This reduces the content of heavy metals and their bioavailability, while improving soil phosphorus utilization efficiency and increasing the activity of acid phosphatase in tailings, thus promoting healthy plant growth. It provides a new microbial strain with great application value for the ecological restoration of tailings and spoil heap soils. Attached Figure Description

[0035] Figure 1 The enrichment and isolation of the sulfate-reducing bacterium *Desulfosporosinus* sp. QY25 are shown. In the diagram, a represents the enrichment process, and b represents the isolation process.

[0036] Figure 2 Scanning electron micrographs (SEM) of the morphological characteristics of sulfate-reducing bacterium *Desulfosporosinus* sp. QY25. In the image, a is an SEM image of the bacterial colony; b is an SEM image of the morphological characteristics of a single bacterium.

[0037] Figure 3 Phylogenetic tree of sulfate-reducing bacterium Desulfosporosinus sp. QY25.

[0038] Figure 4 The growth curve of sulfate-reducing bacterium Desulfosporosinus sp. QY25 at 37℃ and pH 5.

[0039] Figure 5 The growth and formation of phosphate-solubilizing zones of the sulfate-reducing bacterium *Desulfosporosinus* sp. QY25 on organophosphate-SRB solid medium. Where D is the diameter of the phosphate-solubilizing zone; d is the colony diameter.

[0040] Figure 6 The germination rate and plant height of plants after ecological restoration using the sulfate-reducing bacterium *Desulfosporosinus* sp. QY25 are shown. Where a represents the plant germination rate; b represents the plant height.

[0041] Figure 7 To measure the pH and SO4 levels in tailings before and after ecological restoration using the sulfate-reducing bacterium Desulfosporosinus sp. QY25 in conjunction with plants. 2-The available contents of Fe, Cu, Pb, Cd, and Zn in the tailings, as well as the available phosphorus content and acid phosphatase activity in the tailings. Where a represents the change in pH of the tailings; b represents the SO4 content in the tailings. 2- The changes in content are: c, d, e, f, g, h, i, and i. Detailed Implementation

[0042] To better illustrate the purpose, technical solution, and advantages of this invention, the invention will be further described below with reference to specific embodiments. Unless otherwise specified, other materials and reagents used in the embodiments are commercially available.

[0043] The culture medium involved in this invention is as follows: 1. Enrichment medium composition: 0.45 g / L (NH4)2SO4, 0.05 g / L KCl, 0.5 g / L MgSO4·7H2O, 0.05 g / L KH2PO4, 0.014 g / L Ca(NO3)2·4H2O, 0.2 g / L yeast extract, 0.92 g / L glycerol and 5 mL / L trace element solution.

[0044] 2. Solid culture medium composition: 0.45 g / L (NH4)2SO4, 0.05 g / L KCl, 0.5 g / L MgSO4·7H2O, 0.05 g / L KH2PO4, 0.014 g / L Ca(NO3)2·4H2O, 0.2 g / L yeast extract, 0.92 g / L glycerol, 5 mL / L trace element solution and 15 g / L agar.

[0045] 3. Trace element solution composition: 0.5 g / L FeSO4·7H2O, 0.02 g / L ascorbic acid and 0.1 g / L CH3C(S)NH4.

[0046] 4. Organophosphorus-SRB solid medium: 0.45 g / L (NH4)2SO4, 0.05 g / L KCl, 0.5 g / L MgSO4·7H2O, 0.05 g / L KH2PO4, 0.014 g / L Ca(NO3)2·4H2O, 0.2 g / L yeast extract, 0.92 g / L glycerol, 5 mL / L trace element solution, 5 g / L CaCO3, 5 g / L egg yolk lecithin and 20 g / L agar.

[0047] Example 1: Isolation of sulfate-reducing strains I. Experimental Methods (1) Collection of bacterial source: Tailings samples were collected from the Shuilongwei lead-zinc mine in Fogang County, Qingyuan City, Guangdong Province, and stored in a refrigerator at 4 ℃ for later use.

[0048] (2) Enrichment culture and acclimatization: Weigh 0.5 g of tailings sample into an anaerobic tube, add 2 / 3 volume of enrichment culture medium to the anaerobic tube, and incubate in the dark in an incubator (34~37°C) until black FeS precipitate appears in the anaerobic tube and the culture medium changes from clear to ink color.

[0049] (3) Strain isolation: The bacterial culture obtained in step (2) was diluted to 10 using the enrichment medium as a diluent. -1 10 -2 10 -3 10 -4 10 -5 and 10 -6 Six concentration gradients were used to obtain diluted bacterial solutions. 100 μL of each diluted bacterial solution was taken from each concentration gradient, evenly spread on solid culture medium plates, and incubated in anaerobic bags at 34–37°C until single colonies appeared. Well-grown single colonies were selected and repeatedly isolated and purified on solid culture medium plates until stable, single-form bacterial colonies (single colonies) appeared on the plates.

[0050] II. Experimental Results Depend on Figure 1 As shown in Figure a, the culture medium in the anaerobic tube changed from clear to ink-colored. (As shown in Figure a) Figure 1 As shown in b, stable, single-form bacterial colonies appeared on the plate.

[0051] Example 2 Identification of sulfate-reducing bacteria strains I. Experimental Methods (1) Morphological characteristics: The single colony isolated in Example 1 was identified and observed by scanning electron microscopy and labeled as strain QY25.

[0052] (2) Identification and preservation of strains based on 16S rDNA gene sequence: Genomic DNA of strain QY25 was extracted, and the 16S rDNA gene sequence of strain QY25 was amplified using 27F (5'-3': AGAGTTTGATCCTGGCTCAG, SEQ ID NO: 1) and 1492R (5'-3': TACGGCTACCTTGTTACGACTT, SEQ ID NO: 2).

[0053] The PCR amplification system is shown in Table 1. The PCR amplification program is as follows: pre-denaturation temperature 94℃, 3 min; denaturation temperature 95℃, 45 s; annealing temperature 55℃, 45 s; extension temperature 72℃, 90 s; 30 cycles; supplementary extension temperature 72℃, 5 min.

[0054] Table 1 The amplified PCR stock solution was sent to Qingke Biotechnology (Guangzhou) Co., Ltd. for sequencing. The gene sequence obtained by sequencing was compared with the database sequence using NCBIBLAST to obtain the strain sequence with the highest similarity to strain QY25.

[0055] II. Experimental Results like Figure 2 a and Figure 2 As shown in b, strain QY25 is rod-shaped or short rod-shaped, without flagella, and grows by adsorbing onto ferrous sulfide precipitates.

[0056] The 16S rDNA gene sequence of strain QY25 is as follows:

[0057] like Figure 3 As shown, the 16S rDNA gene sequence of strain QY25 has the highest similarity to Desulfosporosinus acididurans of the Desulfosporosinus genus, with a homology of 99.16%.

[0058] The strain QY25 was named Desulfosporosinussp. QY25 and deposited at the Guangdong Provincial Center for Microbial Culture Collection on August 6, 2024, with accession number GDMCC No: 64963. The deposit address is 5th Floor, Building 59, No. 100 Xianlie Middle Road, Guangzhou.

[0059] Example 3: Evaluation of sulfate reducing capacity of strain QY25 I. Experimental Methods 1. Preparation of bacterial suspension: The sulfate-reducing bacterium *Desulfosporosinus* sp. QY25 isolated in Example 1 was inoculated into an anaerobic tube containing enrichment medium and placed in an anaerobic bag. The tube was then incubated statically at 37 °C until the exponential phase (2-3 days) to obtain the bacterial suspension of strain QY25. The bacterial suspension of strain QY25 was transferred to a 50 mL sterile centrifuge tube and diluted with enrichment medium to prepare an OD ratio. 600 The concentration of QY25 bacterial suspension was 0.6.

[0060] 2. Inoculation: QY25 bacterial suspension was inoculated at a rate of 2% (v / v) into 100 mL of enrichment medium at pH 5. Three replicates were set up for each experimental group. The culture was incubated statically at 37 ℃ in an anaerobic incubator for 10 days. The absorbance of the bacterial suspension was measured every 12 hours using a spectrophotometer at a wavelength of 600 nm. Samples were taken on day 7 for SO42- analysis. 2- Determine and evaluate the sulfate reduction rate.

[0061] II. Experimental Results 1. Determination of cell density in bacterial culture like Figure 4 As shown, during the 10-day anaerobic culture, strain QY25 exhibited rapid growth and strong activity as early as day 2, with a high OD value. 600 The result of achieving a pH of 0.8 to 1.2 indicates that strain QY25 grows well at a pH of 5.

[0062] 2. Calculation of sulfate reduction rate After 7 days of anaerobic culture, the sulfate reduction rate of strain QY25 reached 84%. This indicates that strain QY25 is acid-resistant and has a strong dissimilatory sulfate reduction ability, providing a new microbial strain for soil ecological remediation.

[0063] Example 4: Determination of the phosphorus solubilization ability of strain QY25 using the phosphorus solubilization zone method I. Experimental Methods 10 μL of QY25 bacterial culture in the logarithmic growth phase was inoculated onto organophosphate-SRB solid medium and placed in an anaerobic incubator at 37°C for 8 days. The growth of the strain was observed and the diameter of the phosphate-solubilizing zone (D) and the colony diameter (d) were measured on the 7th day.

[0064] II. Experimental Results like Figure 5 As shown, strain QY25 grew well on organophosphate-SRB solid medium and formed obvious phosphate-solubilizing zones. The D / d ratio of strain QY25 was 2.75 ± 0.15, indicating that strain QY25 has phosphate-solubilizing ability.

[0065] Example 5: Sulfate-reducing bacteria combined with plants for the ecological restoration of acidic tailings. I. Experimental Methods 1. Sample collection and container loading: The acidic tailings were collected from the Dabao Mountain tailings pond in Shaoguan City, Guangdong Province. Test containers with a diameter of 16 cm, a height of 17.5 cm, and a bottom diameter of 13 cm were selected, and 5 kg of acidic tailings were placed in each container.

[0066] 2. Improvement of acidic tailings: Quicklime is added to neutralize the acidic tailings, and the equilibrium reaction is carried out for 2 weeks. Then, fermented chicken manure is added to improve the oligotrophic condition of the tailings, and the equilibrium reaction is carried out again for 2 weeks. The surface is then covered with rice straw. During this period, the soil oxidation-reduction potential is measured regularly using an OPR (oxidation-reduction potential) meter to obtain the improved tailings matrix. The added quicklime and fermented chicken manure are uniformly mixed with the tailings.

[0067] 3. Apply QY25 bacterial solution: When the oxidation-reduction potential of the improved tailings matrix is ​​below 300 mV, dig trenches 8-12 cm deep on the surface of the improved tailings matrix and apply sulfate-reducing bacteria solution (OD25). 600 =1.0) Apply evenly to the trench at a rate of 1% (v / v), backfill the trench, gently compact the surface, and seal the test pot with a film to allow the reaction to equilibrate for 12 weeks.

[0068] 5. Planting: According to 18 g / m 2 The amount of ryegrass seeds was sown in the improved tailings substrate treated in step 3. After sowing, the plants were watered regularly for maintenance. The germination rate and plant height of the plants were monitored, and the physicochemical properties of the tailings treated with the combined bacterial strain and plants were measured and compared with those of the untreated tailings.

[0069] II. Experimental Results Table 2. Plant growth after 12 weeks of treatment with QY25 sulfate-reducing bacteria solution. like Figure 6 As shown in Table 2, after applying QY25 sulfate-reducing bacteria solution to the improved tailings substrate, the ryegrass grew well, with a germination rate of 81.25%. Figure 6 a), plant height is 14.34 cm ( Figure 6 (b) Both the germination rate and plant height of the plants increased.

[0070] Table 3. Changes in physicochemical properties of tailings after treatment with QY25 sulfate-reducing bacteria solution combined with plant matter. *Note: ND indicates that the level is below the detection limit (<0.001 mg / Kg) and was not detected.

[0071] As shown in Table 3 and Figure 7 a to Figure 7 As shown in figure i, the ecological restoration experiment of acidic tailings lasted a total of 20 weeks, including 12 weeks of treatment with QY25 sulfate-reducing bacteria solution and 8 weeks of planting ryegrass. After the combined treatment with QY25 sulfate-reducing bacteria solution and vegetation, the pH of the tailings increased from the initial 2.18 to 8.27, and SO42- decreased. 2- The content decreased from 19.78 g / kg to 11.30 g / kg. Furthermore, the available forms of heavy metals in the tailings all decreased: available Fe decreased from 12767.69 mg / kg to 10.55 mg / kg, available Cu from 47.90 mg / kg to 2.32 mg / kg, available Pb and Zn from 3.02 mg / kg and 14.692 mg / kg to 0.34 mg / kg and 0.168 mg / kg, respectively, and available Cd from 0.0237 mg / kg to below the instrument detection limit. Simultaneously, strain QY25 was able to convert insoluble phosphorus in the soil into soluble phosphorus that plants can absorb. The available phosphorus in the tailings increased from an initial 0.328 mg / kg to 1.926 mg / kg, and acid phosphatase increased from 102.57 U / g to 362.25 U / g. In summary, the QY25 strain of this invention has strong dissimilatory sulfate reduction ability and phosphorus solubilization ability, providing a new and highly efficient biological strain for ecological restoration.

[0072] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A sulfate-reducing bacterium, characterized in that, The sulfate-reducing bacteria is Desulfosporosinus sp. QY25, which has been preserved in Guangdong Microbial Culture Collection Center on August 6, 2024, and the preservation number is GDMCC No: 64963.

2. Application of the sulfate-reducing bacteria and / or fermentation products thereof in claim 1 in soil ecological restoration.

3. Use according to claim 2, wherein the compound is ###0002### The soil ecological restoration includes at least one of recovering vegetation growth, neutralizing soil pH, reducing SO4 2- , reducing soil heavy metal pollution, improving soil acid phosphatase activity, and increasing soluble phosphorus content in the soil.

4. The use according to claim 3, wherein the compound is ###0002### The heavy metal includes at least one of Fe, Cu, Cd, Zn and Pb.

5. The use according to claim 2, wherein the compound is ###0002### The soil includes tailings and dump soil.

6. The use according to claim 2, wherein The vegetation includes at least one of Medicago sativa, Lolium perenne, Poa annua, Festuca ovina and Koeleria cristata.

7. A biological agent, characterized in that, The biological agent contains the sulfate-reducing bacteria and / or fermentation products thereof in claim 1.

8. Application of the biological agent in claim 7 in soil ecological restoration.

9. A method for soil ecological remediation, characterized in that, The sulfate-reducing bacteria in claim 1 or the biological agent in claim 7 is added to the soil for ecological restoration.

10. Use according to claim 9, wherein The adding mode includes at least one of irrigation, spraying and burying.

Images