Application of H1FX and inhibitor thereof in prostatic cancer treatment target and medicine

Abstract

The invention belongs to the technical field of biological medicine, and relates to application of H1FX as a therapeutic target and application of three compounds as H1FX inhibitors in preparation of drugs for preventing and / or treating prostatic cancer. Experimental results show that up-regulation of H1FX expression level can promote proliferation of prostate cancer cells, and knock-down of H1FX can inhibit proliferation of prostate cancer cells. H1FX expression up-regulation can significantly promote generation and development of prostate cancer cell line nude mouse subcutaneous tumor formation. Researches show that the three compounds are specifically combined with H1FX, and proliferation of prostate cancer cells and growth of subcutaneous tumors of nude mice with prostate cancer cell strains are inhibited. Therefore, the invention provides a new target for the design of new anti-prostatic cancer drugs, and provides a new thought for the development and preparation of prostatic cancer prevention and / or treatment drugs.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology and relates to the application of H1FX as a therapeutic target and different inhibitors of H1FX in the preparation of drugs for the prevention and / or treatment of prostate cancer. Background Technology

[0002] Prostate cancer is a major disease that ranks second in incidence among male malignant tumors worldwide and sixth in incidence among male malignant tumors in China. Its incidence rate increases rapidly with age. Although the prognosis for early-stage prostate cancer is good, there are currently no effective therapeutic targets or drugs for advanced-stage prostate cancer, and the median survival after diagnosis is less than five years. Therefore, finding ideal therapeutic targets for prostate cancer and developing effective therapeutic drugs based on these targets is an urgent clinical need for the treatment of prostate cancer.

[0003] H1FX (H1.10, H1.X) is a variant of connectomistin H1. Connectomistins, along with core histones that make up nucleosomes, are one of the five major histone families present in eukaryotic chromatin. Eleven variants of connectomistin H1, H1.0–H1.10, have been identified in the human genome. Studies have reported that some H1 variants, such as H1.0, H1.2, H1.3, and H1.4, play important roles in tumorigenesis and development; however, the role of H1FX in prostate cancer treatment has not yet been reported. Summary of the Invention

[0004] This invention addresses the problems existing in the traditional diagnosis and treatment of prostate cancer by proposing the application of H1FX as a therapeutic target and different inhibitors of H1FX in the preparation of drugs for the prevention and / or treatment of prostate cancer.

[0005] To achieve the above objectives, the present invention is implemented using the following technical solution: This invention utilizes H1FX overexpression and H1FX knockdown stable cell lines for cell proliferation experiments. Results show that upregulation of H1FX expression promotes prostate cancer cell proliferation, while H1FX knockdown inhibits it. Subcutaneous tumorigenesis experiments in nude mice using prostate cancer cell lines demonstrate that upregulation of H1FX expression significantly promotes the development and progression of subcutaneous tumors in these cells. This indicates that H1FX can serve as a target for prostate cancer treatment. Therefore, this invention proposes the application of H1FX as a target in screening prostate cancer diagnostic kits and in the development of preventative and / or therapeutic drugs, as well as the application of H1FX inhibitors in the preparation of prostate cancer preventative and / or therapeutic drugs.

[0006] This invention utilizes surface plasmon resonance (SPR) experiments on H1FX and the compounds, demonstrating that the three compounds specifically bind to H1FX. Cellular experiments further validated that the three compounds significantly inhibited the proliferation of prostate cancer cells, exhibiting even lower half-inhibitory concentrations (IC50) in cell lines with high H1FX expression. 50 This indicates that the three compounds inhibit the development and progression of prostate cancer by targeting H1FX. Animal experiments verified that the compounds significantly inhibited the growth of subcutaneous tumors of prostate cancer cell lines in nude mice.

[0007] This invention proposes that H1FX is expressed at higher levels in prostate cancer cells, and that inhibitors targeting H1FX, such as substances that inhibit H1FX activity, or substances that inhibit H1FX function, or substances that degrade H1FX, or gene tools that reduce H1FX expression levels, can be used to treat prostate cancer.

[0008] The three compounds of this invention are as follows.

[0009] The first compound, designated 0120-0018, is luteolin, scientifically known as 2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-4H-benzopyran-4-one, CAS number: 5373-11-5, and its structural formula is as follows. Experiments have verified that luteolin, by binding to H1FX, exhibits significant cytotoxicity against various human prostate cancer cells (22Rv1, LNCaP, and PC-3). Furthermore, the luteolin provided by this invention demonstrates a significant inhibitory effect on the tumor growth of human prostate cancer cells (22Rv1) inoculated into nude mice.

[0010] The second compound, designated D271-0003, is a pyrimidinone derivative named 2-propimercapto-5-(3,4-dihydroxyphenyl)-5,8-dihydropyridinepyridine[2,3-d]pyrimidin-4,7(3H,6H)-dione, with the following structural formula. Experiments have verified that pyrimidinone derivatives, by binding to H1FX, exhibit significant cytotoxicity against various human prostate cancer cells (22Rv1, LNCaP, and PC-3).

[0011] The third compound is designated N014-0003 and named (6-((3,4-dihydroxy-2,5-bis(hydroxymethyl)tetrahydrofuran-2-yl)oxy)-3,4,5-trihydroxytetrahydro-2H-pyran-2-yl)methyl-3-(1,3-dimethyl-2-(((2-oxo-2H-chromene-7-yl)oxy)methyl)-6-(prop-2-ylidene)cyclohexyl)propionate, with the following structural formula. Experiments have verified that compound N014-0003, by binding to H1FX, exhibits significant cytotoxicity against various human prostate cancer cells (22Rv1, LNCaP, and PC-3).

[0012] This invention proposes the use of any one or a combination of the above three compounds, as well as their enantiomers, diastereomers, racemates or mixtures, or pharmaceutically acceptable salts; and the use of pharmaceutically acceptable carriers in prostate cancer prevention and / or treatment medicaments.

[0013] Preferably, the above pharmaceutical composition contains 1-2000 mg of active ingredient per dose, more preferably, it contains 10-200 mg of active ingredient per dose. "One dose" refers to one tablet.

[0014] "Pharmaceutically acceptable salt" refers to a salt formed with any one or a combination of the following acids: hydrochloric acid, sulfuric acid, phosphoric acid, hydrobromic acid, acetic acid, trifluoroacetic acid, pyruvic acid, citric acid, tartaric acid, lactic acid, maleic acid, benzenesulfonic acid, or succinic acid, etc.

[0015] "Pharmaceutically acceptable carriers" refer to one or more compatible solid or liquid fillers or gel substances suitable for human use, and which must have sufficient purity and sufficiently low toxicity. "Compatibility" here means that the components in the composition can be mixed with the active ingredient of the present invention without significantly reducing the efficacy of the active ingredient. Pharmaceutically acceptable carriers include, for example, cellulose and its derivatives (such as sodium carboxymethyl cellulose, sodium ethyl cellulose, cellulose acetate, etc.), gelatin, talc, solid lubricants (such as stearic acid, magnesium stearate), calcium sulfate, vegetable oils (such as soybean oil, sesame oil, peanut oil, olive oil, etc.), polyols (such as propylene glycol, glycerin, mannitol, sorbitol, etc.), emulsifiers (such as Tween), lubricants (such as sodium dodecyl sulfate), colorants, flavoring agents, stabilizers, antioxidants, preservatives, pyrogen-free water, etc.

[0016] There are no particular limitations on the administration of the active ingredients or pharmaceutical compositions of the present invention. Representative administration methods include (but are not limited to): oral, intratumoral, rectal, parenteral (intravenous, intramuscular or subcutaneous), etc.

[0017] This invention proposes that H1FX inhibitors can also be H1FX shRNAs, with the following sequence: shH1FX-1-F: CCGGGATCTACACCGAGGCCAAGAACTCGAGTTCTTGGCCTCGGTGTAGATCTTTTTG, shH1FX-1-R: AATTCAAAAAGATCTACACCGAGGCCAAGAACTCGAGTTCTTGGCCTCGGTGTAGATC; shH1FX-3-F: CCGGCCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGGTTTTTG, shH1FX-3-R: AATTCAAAAACCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGG; shH1FX-6-F: CCGGCAACGGTTCCTTCAAGCTCAACTCGAGTTGAGCTTGAAGGAACCGTTGTTTTTG, shH1FX-6-R: AATTCAAAAACAACGGTTCCTTCAAGCTCAACTCGAGTTGAGCTTGAAGGAACCGTTG。

[0018] The H1FX inhibitor proposed in this invention can also be the siRNA of H1FX, and the sequences are as follows: siH1FX-1-F: CCUACCUCAAGUACUCGAUTT, siH1FX-1-R: AUCGAGUACUUGAGGUAGGTT; siH1FX-2-F: CUUCAAGCUCAACCGCAAGTT, siH1FX-2-R: CUUGCGGUUGAGCUUGAAGTT; siH1FX-3-F: ACCGCGCACAAAGCGAAGATT, siH1FX-3-R: UCUUCGCUUUGUGCGCGGUTT; siH1FX-4-F: CUGGCGCCAAGAAGGACAATT; siH1FX-4-R: UUGUCCUUCUUGGCGCCAGTT。

[0019] Compared with the prior art, the advantages and positive effects of the present invention are as follows: 1. This invention proposes the application of H1FX as a therapeutic target in the preparation of drugs for the prevention and / or treatment of prostate cancer. Studies in this invention show that upregulation of H1FX expression promotes the proliferation of prostate cancer cells, while knockdown of H1FX inhibits their proliferation. Upregulation of H1FX expression significantly promotes the development of subcutaneous tumors in nude mice containing prostate cancer cell lines, indicating that H1FX can serve as a target for prostate cancer therapeutic drugs, and can be used to prepare or screen drugs for the prevention and / or treatment of prostate cancer.

[0020] 2. This invention provides novel uses for different inhibitors of H1FX in the preparation of drugs for the prevention and / or treatment of prostate cancer, including two gene tools that reduce H1FX expression levels and three compounds that inhibit H1FX function. Studies in this invention show that the three compounds specifically bind to H1FX, inhibiting the proliferation of prostate cancer cells and the growth of subcutaneous tumors of prostate cancer cell lines in nude mice. This indicates that the three compounds inhibit the occurrence and development of prostate cancer by targeting H1FX.

[0021] Therefore, this invention provides new targets for the design of new drugs against prostate cancer and offers new ideas for the development and preparation of drugs for the prevention and / or treatment of prostate cancer. Attached Figure Description

[0022] Figure 1 The silencing effects of four H1FX-shRNAs in 22Rv1 cells and the silencing effects of two H1FX-shRNAs in LNCaP and PC-3 cells (at both gene and protein levels).

[0023] A: Results of q-PCR and Western blot analysis of H1FX gene knockdown in 22Rv1 cells; B: Results of q-PCR and Western blot analysis of H1FX gene knockdown in LNCaP cells; C: Results of q-PCR and Western blot analysis of H1FX gene knockdown in PC-3 cells. (Note: Compared with the control group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001).

[0024] Figure 2 The effects of knocking down H1FX with four H1FX-shRNAs on proliferation in 22Rv1 cells, and the effects of knocking down H1FX with two H1FX-shRNAs on proliferation in LNCaP and PC-3 cells.

[0025] Figure 3 The silencing effect (at the gene level) of four H1FX-siRNAs in 22Rv1 and LNCaP cells.

[0026] A: Results of q-PCR analysis of H1FX gene knockdown in 22Rv1 cells; B: Results of q-PCR analysis of H1FX gene knockdown in LNCaP cells. (Note: Compared with the control group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001).

[0027] Figure 4 The effects of H1FX overexpression on 22Rv1 and LNCaP cells (gene and protein levels).

[0028] A: Results of q-PCR and Western blot analysis of H1FX gene overexpression in 22Rv1 cells; B: Results of q-PCR and Western blot analysis of H1FX gene overexpression in LNCaP cells. (Note: Compared with the control group, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001).

[0029] Figure 5 The effect of H1FX overexpression on proliferation in 22Rv1 and LNCaP cells.

[0030] Figure 6 The effect of H1FX overexpression in 22Rv1 cells on subcutaneous tumorigenesis and development in nude mice.

[0031] Figure 7 The specific binding of three compounds to H1FX was analyzed using SPR experiments.

[0032] Figure A shows the response curve of compound 0120-0018 specifically binding to H1FX, Figure B shows the response curve of compound N014-0003 specifically binding to H1FX, and Figure C shows the response curve of compound D271-0003 specifically binding to H1FX.

[0033] Figure 8 The IC50 values ​​of the three compounds in 22Rv1, LNCaP-normal, and H1FX-overexpressing cells were compared. 50 Detection results image.

[0034] Figure 9 The effect of compound 0120-0018 on the subcutaneous tumorigenesis and development of 22Rv1 cells in nude mice. Detailed Implementation

[0035] To better understand the above-mentioned objectives, features, and advantages of the present invention, the present invention will be further described below with reference to specific embodiments. It should be noted that, unless otherwise specified, the embodiments and features described in these embodiments can be combined with each other.

[0036] Numerous specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways than those described herein, and therefore the invention is not limited to the specific embodiments disclosed in the following specification.

[0037] Example 1 H1FX-shRNA significantly knocked down the expression of the H1FX gene and protein in prostate cancer cells.

[0038] Studies have found that the expression level of the H1FX gene is significantly increased in prostate cancer patient cells, and the survival rate of patients with high H1FX expression is significantly reduced. Therefore, it is hypothesized that targeted inhibition of H1FX gene expression may have an inhibitory effect on prostate cancer cell proliferation. Based on the analysis of the full-length H1FX gene mRNA sequence, three 21-nucleotide sequences at bases 591-611, 616-636, and 714-734 of the full-length H1FX gene mRNA sequence (BC000426) were selected as targeted interference sequences. The specific sequences identified were GATCTACACCGAGGCCAAGAA, CCGTGGTTCGACCAGCAGAAT, and CAACGGTTCCTTCAAGCTCAA. Three highly specific shH1FX sequences were designed targeting the above sequences, as shown in Table 1, and synthesized by Beijing Qingke Biotechnology Co., Ltd. The transcribed H1FX-shRNA sequences are shown in Table 2.

[0039] Table 1 shH1FX sequence Table 2. Transcribed H1FX-shRNA sequences 1. Construction of H1FX-shRNA expression vector The sense and antisense strands of shH1FX from Table 1 were diluted with water to 10 μM, mixed thoroughly, incubated at 95°C for 5–10 minutes, and then allowed to cool naturally to room temperature to anneal into shH1FX double-stranded DNA. The pLKO.1 vector was double-digested with AgeI and EcoRI, and the linearized pLKO.1 vector and the annealed shH1FX fragments were ligated using T4 DNA ligase. Sequencing was then performed to ensure correct ligation. Sequencing results showed that the shH1FX fragments were correctly ligated into the eukaryotic expression vector pLKO.1. The constructed plasmids were labeled as pLKO.1 shH1FX-1, 3, and 6, respectively.

[0040] 2. Lentiviral Packaging Take 4 μg of pLKO.1 shCtrl plasmid, 3 μg of virus packaging plasmid psPAX2, and 1 μg of envelope plasmid pMD2.G and mix them in Opti-MEM medium. Follow the Lipofectamine 2000 instructions and collect the virus solution at 48h and 72h.

[0041] Follow the above steps to complete the lentivirus packaging for shH1FX-1, 3, and 6.

[0042] 3. Establishment of stable expression cell lines 22Rv1 prostate cancer cells in good growth condition (purchased from Wuhan Pronosei Life Science Technology Co., Ltd.) were used at a concentration of 5 × 10⁻⁶ cells / year. 5 Cells were seeded in six-well plates and cultured overnight until adherence. Then, shCtrl, shH1FX-1, shH1FX-3, and shH1FX-6 viral solutions were added. After 48 hours of stable culture, the cells were continuously screened for one week using medium containing 1 μg / mL puromycin to obtain cell lines stably expressing H1FX-shCtrl, H1FX-shRNA-1, H1FX-shRNA-3, and H1FX-shRNA-6 in 22Rv1 cells.

[0043] Following the above procedures, cell lines stably expressing H1FX-shCtrl, H1FX-shRNA-3, and H1FX-shRNA-6 in LNCaP and PC-3 were constructed.

[0044] 4. Transfection efficiency assessment Transfection efficiency was assessed using RT-qPCR and Western Blot results. The primer sequences used in the RT-qPCR experiment were as follows: β-Actin internal control primers were β-Actin-F and β-Actin-R; H1FX specific primers were H1FX-F and H1FX-R. The primer sequences were: β-Actin-F: CATGTACGTTGCTATCCAGGC, β-Actin-R: CTCCTTAATGTCACGCACGA, H1FX-F: TGGAGACCATCCGTAGGCTG, H1FX-R: GCTGCCTTCTTCGCTTTGTG. In the Western Blot experiment, the internal control antibody was β-Actin (Cell Signaling Rabbit mAb 4970), and the H1FX antibody was Santa Cruz Biotechnology (sc-514856).

[0045] The results are as follows Figure 1As shown, RT-qPCR results indicated that, compared with the control group (shCtrl) stably expressing H1FX-shCtrl, the expression level of H1FX was significantly downregulated in the knockdown stable transfected strains (shH1FX-1, shH1FX-3, and shH1FX-6) transfected with 22Rv1, LNCaP, and PC-3 (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). Western Blot results showed that, compared with the control group (shCtrl) stably expressing H1FX-shCtrl, the expression level of H1FX protein was significantly downregulated in the 22Rv1 (*P<0.05, **P<0.01, ***P<0.0001, ****P<0.0001). Figure 1 A), LNCaP ( Figure 1 B) and PC-3 Figure 1 C) The knockdown stabilized transfected cells (shH1FX-1, shH1FX-3, and shH1FX-6) showed a reduction in H1FX knockdown. This indicates that H1FX knockdown stabilized cell lines were successfully constructed in 22Rv1, LNCaP, and PC-3.

[0046] 5. Cell proliferation detection Cells in good growth condition were seeded at 5000 cells / 100μL / well in E-Plates and monitored in the iCELLigence system for about 100 hours to observe cell proliferation and growth, and a proliferation curve was plotted.

[0047] The results are as follows Figure 2 As shown, compared with the control group (shCtrl), 22Rv1 ( Figure 2 A, B), LNCaP ( Figure 2 C) and PC-3 Figure 2 D) Cell proliferation of H1FX knockdown stable transgenes (shH1FX-1, shH1FX-3 and shH1FX-6) was significantly reduced.

[0048] Example 2 H1FX-siRNA significantly knocked down the expression of the H1FX gene and protein in prostate cancer cells.

[0049] Four highly specific H1FX-siRNA sequences were designed targeting the human H1FX gene sequence. The specific sequences are shown in Table 3. These sequences were synthesized by Beijing Qingke Biotechnology Co., Ltd.

[0050] Table 3 H1FX-siRNA Sequence 1. Establishment of H1FX-siRNA transiently transfected cell lines 22Rv1 prostate cancer cells in good growth condition were harvested and processed at a concentration of 5 × 10⁻⁶ cells / year. 5Cells were seeded per well in six-well plates and cultured overnight until they adhered. H1FX-siRNA and NC-siRNA were added to the cells according to the Lipofectamine 2000 instructions. Samples were collected 48 hours after transfection to detect H1FX expression.

[0051] Following the above procedures, LNCaP cell lines transiently transfected with siH1FX and siNC were constructed.

[0052] 2. Transfection efficiency assessment The method for assessing transfection efficiency using RT-qPCR is the same as in Example 1.

[0053] The results are as follows Figure 3 As shown, RT-qPCR results indicated that, compared to the NC-siRNA control group (siNC), the H1FX expression level was significantly lower at 22Rv1 ( Figure 3 A) and LNCaP ( Figure 3 B) Significant downregulation was observed in the transfected knockdown transient strains (siH1FX_1, siH1FX_2, siH1FX_3 and siH1FX_4) (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001).

[0054] Example 3 H1FX overexpression significantly increases the expression of the H1FX gene and protein in prostate cancer cells.

[0055] 1. Construction of H1FX overexpression vector Amplification primers were designed based on the full length of the H1FX CDS region, and the primer sequences are as follows.

[0056] H1FX-EcoRI-F:CCGGAATTCCGGGCCACCATGTCCGTGGAGCTCGAGGAG, H1FX-BamHI-R:CGCGGATCCTTACTTGTCATCGTCGTCCTTGTAATCCTTG CGGCCCTTGGGCACTTT.

[0057] Total RNA was extracted from HEK-293T cells (purchased from Wuhan Pronosei Biotechnology Co., Ltd.) using a rapid total RNA extraction kit (Shanghai Feijie Biotechnology Co., Ltd.). cDNA was obtained via reverse transcription, and the H1FX CDS region was amplified by PCR. The vector pLVX-IRES-Puro and the PCR fragment were digested with restriction endonucleases EcoRI and BamHI, followed by ligation using T4 DNA ligase and sequencing to ensure correct ligation. Sequencing results showed that the H1FX CDS region was correctly ligated into the eukaryotic expression vector pLVX-IRES-Puro.

[0058] 2. Lentiviral Packaging Take 10 μg of pLVX-IRES-Puro plasmid, 1 μg of pLP1 plasmid, 1 μg of pLP2 plasmid and 1 μg of pLPVSVG plasmid and mix them in Opti-MEM medium. Follow the Lipofectamine 2000 instructions and collect the virus solution at 48 h and 72 h respectively as blank control group.

[0059] Following the above steps, complete the lentivirus packaging for the H1FX overexpression group.

[0060] 3. Establishment of stable expression cell lines The method for establishing a stable expression cell line is the same as in Example 1.

[0061] 4. Transfection efficiency assessment The methods for assessing transfection efficiency using RT-qPCR and Western Blot are the same as in Example 1.

[0062] The results are as follows Figure 4 As shown, RT-qPCR results indicated that, compared with the control group (EV), the expression level of H1FX was significantly upregulated in the 22Rv1 and LNCaP-transfected stable overexpression strains (H1FX-OE) (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). Western Blot results showed that, compared with the control group (EV), the expression level of H1FX protein was significantly upregulated in the 22Rv1 (… Figure 4 A) and LNCaP ( Figure 4 B) Increased H1FX-OE levels in the transfected stable overexpression cell line. This indicates that a stable H1FX overexpression cell line was successfully constructed in 22Rv1 and LNCaP.

[0063] 5. Cell proliferation detection The method for detecting cell proliferation is the same as in Example 1.

[0064] The results are as follows Figure 5 As shown, compared with the control group (EV), 22Rv1 ( Figure 5 A) and LNCaP ( Figure 5 B) The proliferation of H1FX overexpression stable transgene (H1FX-OE) cells is accelerated.

[0065] 6. H1FX overexpression promotes subcutaneous tumorigenesis of prostate cancer cell lines in nude mice. The male BALB / c nude mice (athymia-free, T-cell-deficient) used in the following examples were purchased from Vital River Laboratory Animal Co., Ltd., and housed in an SPF-grade animal laboratory. They were fed standard feed, with free access to food and water, and sufficient sleep. The experimental temperature was maintained at 18–28°C, with a daily temperature difference of ≤3°C, and suitable relative humidity. The experimental procedures strictly adhered to animal welfare ethics, and the experimental design was approved by the Animal Ethics Committee.

[0066] Under aseptic conditions, rapidly growing normal and H1FX-overexpressing human prostate cancer cells 22Rv1 were extracted and processed at a ratio of 10... 6 Cells per mouse were inoculated subcutaneously in the right axilla. Nude mice were housed in laminar flow racks. All feed, bedding, cages, and instruments used were autoclaved before use. Tumors were assessed in vitro every other day (tumor long axis a and short axis b were measured with calipers; tumor volume = 1 / 2 × a × b). 2 Dynamic measurements were performed. Approximately 5-6 weeks after inoculation, the maximum diameter of the tumor was observed to see if it exceeded ethical requirements. Following animal ethics, the nude mice were euthanized, and the subcutaneous tumor was removed, weighed, and photographed.

[0067] The results are as follows Figure 6 As shown, the tumor growth curve in the H1FX overexpression group was steeper than that in the control group, indicating a faster tumor growth rate. The tumor volume and tumor mass in the H1FX overexpression group were significantly increased compared to the control group (*P<0.05, **P<0.01, ***P<0.001, ****P<0.0001). The results of the subcutaneous tumor growth curve and tumor mass in nude mice indicate that upregulation of H1FX expression can significantly accelerate the occurrence and development of subcutaneous tumors of prostate cancer cell lines in nude mice.

[0068] Example 4 The binding ability of the compound to the target protein H1FX was detected.

[0069] Compounds 0120-0018, N014-0003, and D271-0003 used in this embodiment and other embodiments were all purchased from Shanghai Taoshu Biotechnology Co., Ltd. Compound 0120-0018 and luteolin are the same compound, CAS number 5373-11-5; compounds N014-0003 and D271-0003 do not have CAS numbers. The structural formulas of the three substances are shown in the invention summary section.

[0070] 1. H1FX codon optimization H1FX in Escherichia coli E. coli Codon optimization, gene synthesis, and H1FX-pET28a vector construction for heterologous expression in BL21 (DE3) were completed by Beijing Qingke Biotechnology Co., Ltd.

[0071] 2. Purification of recombinant H1FX protein The bacterial culture was inoculated into LB medium at a volume fraction of 2%, and cultured in a shaker at 37°C for 3 h. IPTG was added to the final concentration of 0.1 mM, and the culture was incubated at 16°C and 120 rpm for 12 h.

[0072] The collected bacterial cells were washed twice with phosphate buffer (50 mM, pH 7.0), resuspended, sonicated, and centrifuged at 12,000 rpm for 20 min. The supernatant was the cell-free crude enzyme solution of recombinant H1FX.

[0073] After equilibrating the nickel affinity chromatography resin column with binding buffer, the prepared cell-free crude enzyme solution was loaded and washed with washing buffer. The target protein was eluted with elution buffer and concentrated by desalting through a 30 kDa ultrafiltration tube.

[0074] The flow rate for each buffer solution was 1 mL / min.

[0075] Binding buffer: 0.5 M NaCl, 50 mM KPB, pH 7.0.

[0076] Washing buffer: 50 mM imidazole, 0.5 M NaCl, 50 mM KPB, pH 7.0.

[0077] Elution buffer: 200 mM imidazole, 0.5 M NaCl, 50 mM KPB, pH 7.0.

[0078] The protein concentration was determined by measuring the light absorption at 280 nm using a NanoDrop 2000 (Thermo) and combining this with the predicted molecular weight and optical rotation coefficient from http: / / www.expasy.Org / .

[0079] 3. Gradient dilution of compounds Compound 0120-0018 was dissolved in PBS containing 5% DMSO (v / v) to a concentration of 333.3 mM, and then diluted with PBS containing 5% DMSO (v / v) to concentrations of 111.1 μM, 37 μM, 12.3 μM, 4.1 μM, 1.37 μM, 0.45 μM, 0.15 μM, and 0.05 μM. Compounds N014-0003 and D271-0003 were dissolved in PBS containing 5% DMSO (v / v) to a concentration of 1 mM, and then diluted with PBS containing 5% DMSO (v / v) to concentrations of 333.3 μM, 111.1 μM, 37 μM, 12.3 μM, 4.1 μM, 1.37 μM, 0.45 μM, 0.15 μM, and 0.05 μM.

[0080] 4. SPR Analysis The CM5 chip (Cytiva, BR-1005-30) was activated with ethanolamine, and the protein was diluted to 50 μg / mL with sodium acetate (pH 5.0) before ligand conjugation. The conjugation amount R max =(analysate M W / ligand M W )×R L ×S m , where R max This represents the maximum binding capacity on the chip surface, typically 100 RU in small molecule assays. Analyte M W and ligand M W These represent the molecular weights of small molecules and proteins, respectively, S. m For stoichiometry, choose 1 if the ratio is unknown. R L For ligand coupling level, the actual coupling amount in the experiment was 1.5 times R. L After protein coupling is completed, the protein is blocked by mixing carbodiimide and N-hydroxysuccinimide in a 1:1 ratio.

[0081] The serially diluted compounds were placed on a sample holder and subjected to multiple cycles of detection. Affinity constant (KD) fitting was performed using Biacore offline software.

[0082] SPR analysis results are as follows Figure 7 As shown, compounds 0120-0018, N014-0003, and D271-0003 can specifically bind to H1FX. Among them, Figure 7 A represents the response curve of the specific binding of compound 0120-0018 to H1FX. Figure 7 B represents the response curve of the specific binding of compound N014-0003 to H1FX. Figure 7C represents the response curve of the specific binding of compound D271-0003 to H1FX. According to the detection results, the affinity constant of 0120-0018 to H1FX is 51 μM, the affinity constant of N014-0003 to H1FX is 110 μM, and the affinity constant of D271-0003 to H1FX is 32 μM.

[0083] Example 5 CCK-8 assay for half-maximal inhibitory concentration (IC50) 50 ).

[0084] Compounds 0120-0018, N014-0003, and D271-0003 were dissolved in DMSO to 40 mM, and then diluted to 500 μM, 400 μM, 200 μM, 100 μM, 50 μM, 10 μM, and 1 μM, respectively, with 1640 medium (containing 10% FBS and 1% penicillin-streptomycin antibiotics, volume fraction).

[0085] Prostate cancer cells were seeded at 5000 cells / well in 96-well plates and cultured overnight until the cells adhered. Then, diluted medication was added to each well, and the cells were cultured for 48 hours. 10 μL of CCK-8 solution was added to each well, and the cells were incubated for 1–4 hours. The absorbance at 450 nm was measured using a microplate reader.

[0086] Analysis of experimental results: Inhibition rate = [OD(0 with drug) - OD(with drug)] / [OD(0 with drug) - OD(blank)] × 100%.

[0087] OD (drug addition): The absorbance of the well containing cells, culture medium, CCK-8 solution and drug solution.

[0088] OD (blank): Absorbance of pores containing culture medium, CCK-8 solution, and no cells.

[0089] OD (0 drug): The absorbance of wells containing cells, culture medium, CCK-8 solution, but no drug solution.

[0090] IC 50 The inhibition rate was calculated using Prism GraphPad 7.0.

[0091] IC50 of various compounds against multiple prostate cancer cells was obtained. 50 Summary Figure 8 And the following Table 4.

[0092] Table 4. IC50 of compounds inhibiting the proliferation of different tumor cells 50 From the table above Figure 8 It can be seen that the three compounds 0120-0018, N014-0003 and D271-0003 have a significant inhibitory effect on the proliferation of prostate cancer cell lines.

[0093] Example 6 Animal experiments showed that three compounds inhibited subcutaneous tumor formation in nude mouse prostate cancer cell lines.

[0094] The nude mice were housed under the same conditions as in Example 2. The tumors were allowed to grow to approximately 50 mm. 3 Intraperitoneal administration began approximately 19 days after tumor cell inoculation. The drug was dissolved in PBS containing 10% DMSO (volume percentage), and the dosage was 25 mg / kg, administered every other day. A blank control was prepared (PBS containing 10% DMSO, administered 8 days apart). Tumors were assessed in vitro every other day (tumor long axis a and short axis b were measured with calipers; tumor volume = 1 / 2 × a × b). 2 Dynamic measurements were performed. Approximately 5-6 weeks after inoculation, the maximum diameter of the tumor was observed to see if it exceeded ethical requirements. Following animal ethics, the nude mice were euthanized, and the subcutaneous tumor was removed, weighed, and photographed.

[0095] Experimental results The results are as follows Figure 9 As shown, the tumor growth curve of the 0120-0018 drug injection was flatter than that of the control group (PBS containing 10% DMSO by volume), and the tumor growth rate was slower. The tumor volume and tumor mass of the 0120-0018 drug injection group were significantly smaller than those of the PBS-injected control group (*P<0.05; **P<0.01). The results of the subcutaneous tumor growth curve and tumor mass in nude mice indicate that the 0120-0018 drug injection can significantly inhibit the occurrence and development of subcutaneous tumors of prostate cancer cell lines in nude mice.

[0096] The results show that knocking down H1FX significantly inhibits prostate cancer cell proliferation, while upregulation of H1FX expression promotes prostate cancer cell proliferation and the development of subcutaneous tumors in nude mice. Three compounds, 0120-0018, N014-0003, and D271-0003, specifically bind to H1FX, inhibiting prostate cancer cell proliferation and the development of subcutaneous tumors in nude mice. This indicates that H1FX can serve as a therapeutic target for the preparation or screening of drugs for the prevention and / or treatment of prostate cancer. Two gene tools for reducing H1FX expression, H1FX-shRNA and H1FX-siRNA, and three compounds that inhibit H1FX function, 0120-0018, N014-0003, and D271-0003, can be used as H1FX inhibitors for the preparation of drugs for the prevention and / or treatment of prostate cancer.

[0097] The above description is merely a preferred embodiment of the present invention and is not intended to limit the present invention in any other way. Any person skilled in the art may make changes or modifications to the above-disclosed technical content to create equivalent embodiments for application in other fields. However, any simple modifications, equivalent changes, and modifications made to the above embodiments based on the technical essence of the present invention without departing from the scope of the present invention shall still fall within the protection scope of the present invention.

Claims

1. Application of H1FX as a target in screening of a prostate cancer diagnosis kit and a prevention and / or treatment drug.

2. Application of an inhibitor of H1FX in preparation of a prostate cancer prevention and / or treatment drug.

3. Use according to claim 2, characterized in that, The inhibitor is any one or several compounds shown in the following structural formula: 、 、 。 4. Use according to claim 3, characterized in that, The any one or several compounds take H1FX as a therapeutic target.

5. A pharmaceutical composition for prostate cancer, characterized by comprising the compound of claim 1 or 2 as an active ingredient. The any one or several compounds of claim 3, an enantiomer, diastereoisomer, racemate or mixture thereof, or a pharmaceutically acceptable salt; and a pharmaceutically acceptable carrier.

6. The use according to claim 2, characterized in that, The H1FX inhibitor is an shRNA of H1FX, the sequence is: shH1FX-1-F: CCGGGATCTACACCGAGGCCAAGAACTCGAGTTCTTGGCCTCGGTGTAGATCTTTTTG, shH1FX-1-R: AATTCAAAAAGATCTACACCGAGGCCAAGAACTCGAGTTCTTGGCCTCGGTGTAGATC; shH1FX-3-F: CCGGCCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGGTTTTTG, shH1FX-3-R: AATTCAAAAACCGTGGTTCGACCAGCAGAATCTCGAGATTCTGCTGGTCGAACCACGG; shH1FX-6-F: CCGGCAACGGTTCCTTCAAGCTCAACTCGAGTTGAGCTTGAAGGAACCGTTGTTTTTG, shH1FX-6-R: AATTCAAAAACAACGGTTCCTTCAAGCTCAACTCGAGTTGAGCTTGAAGGAACCGTTG.

7. Use according to claim 2, characterized in that, The H1FX inhibitor is an siRNA of H1FX, the sequence is: siH1FX-1-F: CCUACCUCAAGUACUCGAUTT, siH1FX-1-R: AUCGAGUACUUGAGGUAGGTT; siH1FX-2-F: CUUCAAGCUCAACCGCAAGTT, siH1FX-2-R: CUUGCGGUUGAGCUUGAAGTT; siH1FX-3-F: ACCGCGCACAAAGCGAAGATT, siH1FX-3-R: UCUUCGCUUUGUGCGCGGUTT; siH1FX-4-F: CUGGCGCCAAGAAGGACAATT; siH1FX-4-R: UUGUCCUUCUUGGCGCCAGTT.

Images