Desoxyribonucleic acid synthesis method, desoxyribonucleic acid synthesis template and kit
By combining primers and DNA synthesis templates with DNA polymerase and nick enzyme cleavage, the problem of limited DNA length in chemical synthesis has been solved, enabling faster and longer DNA synthesis, reducing costs, and making it suitable for gene storage.
Patent Information
- Application Number
- CN202411074228.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-08-06
- Publication Date
- 2026-02-06
AI Technical Summary
Existing chemical methods for synthesizing DNA have limited length, are susceptible to signal crosstalk, and have low coupling efficiency, which limits the application of DNA.
DNA synthesis is achieved by using primers and a DNA synthesis template combined with DNA polymerase, and then forming and separating extended sequences through the cleavage action of the nick enzyme.
It increases the speed and length of DNA synthesis, reduces synthesis costs, and is environmentally friendly, making it suitable for gene storage technology.
Smart Images

Figure CN121472353A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of gene storage, more particularly, to a method for synthesizing deoxyribonucleic acid, a deoxyribonucleic acid synthesis template and a kit. BACKGROUND
[0002] Gene storage technology is a technology for storing data by using deoxyribonucleic acid (DNA) molecules. From the perspective of information storage, the sequence of DNA molecules has high flexibility, small volume and high storage density, and is a very potential molecular storage medium. DNA storage technology can be divided into information coding, DNA synthesis, DNA preservation, data acquisition, DNA sequencing, and DNA decoding. The synthesis of DNA is a key step in DNA storage technology, corresponding to the data writing process. The speed and quality of DNA synthesis will directly affect the efficiency and reliability of data storage.
[0003] At present, the chemical synthesis of DNA method has a long development period, and the synthesis principle system is relatively mature, so it becomes a commonly used method for DNA synthesis. However, the length of DNA chemical synthesis is limited, and it is easy to be affected by signal crosstalk, low coupling efficiency, and has side reactions, which greatly limits the actual application of DNA. Therefore, how to optimize the preparation method of DNA is a technical problem that needs to be solved in the gene storage technology at present. SUMMARY
[0004] In view of the above problems, the present application provides a method for synthesizing deoxyribonucleic acid, a deoxyribonucleic acid synthesis template and a kit. By using the method, the synthesis speed of DNA can be improved, the sequence length of DNA can be increased, and the synthesis cost of DNA can be reduced.
[0005] In a first aspect, a method for synthesizing deoxyribonucleic acid is provided, comprising: combining a primer and a deoxyribonucleic acid synthesis template to obtain a first sub-deoxyribonucleic acid, the primer being a first nucleic acid sequence, the binding region of the deoxyribonucleic acid synthesis template comprising a second nucleic acid sequence, the first nucleic acid sequence and the second nucleic acid sequence base pairing; adding a deoxyribonucleic acid polymerase, the 3' end of the first nucleic acid sequence forming an extension sequence in the extension region of the deoxyribonucleic acid synthesis template to obtain a second sub-deoxyribonucleic acid, the extension region comprising a third nucleic acid sequence and a fourth nucleic acid sequence, the third nucleic acid sequence and the fourth nucleic acid sequence base pairing, the extension sequence and the third nucleic acid sequence being structurally identical; adding a nicking enzyme to cut the termination site at the 3' end of the extension region, separating the first nucleic acid sequence and the extension sequence from the second sub-deoxyribonucleic acid to obtain the deoxyribonucleic acid.
[0006] With reference to the first aspect, in some implementations of the first aspect, the extension region further comprises a recognition region, and the cleaving the termination site at the 3' end of the extension region by the nicking enzyme comprises: the nicking enzyme recognizing the recognition region and cleaving the termination site.
[0007] With reference to the first aspect, in some implementations of the first aspect, the deoxyribonucleic acid synthesis template further comprises: a stem-loop structure comprising a first sub-nucleic acid sequence, a second sub-nucleic acid sequence, and a third sub-nucleic acid sequence; wherein the first sub-nucleic acid sequence and the third sub-nucleic acid sequence are base-paired stem nucleic acid sequences, and the second sub-nucleic acid sequence is a loop nucleic acid sequence.
[0008] With reference to the first aspect, in some implementations of the first aspect, the second sub-nucleic acid sequence is located between the first sub-nucleic acid sequence and the third sub-nucleic acid sequence; the first sub-nucleic acid sequence is connected to the 3' end of the third nucleic acid sequence, and the third sub-nucleic acid sequence is connected to the 5' end of the fourth nucleic acid sequence.
[0009] With reference to the first aspect, in some implementations of the first aspect, the deoxyribonucleic acid synthesis template further comprises a protection region at the 3' end of the deoxyribonucleic acid synthesis template, and the protection region is used to terminate the extension of the 3' end of the deoxyribonucleic acid synthesis template.
[0010] With reference to the first aspect, in some implementations of the first aspect, the nucleic acid sequence of the protection region is TTTTTTTTTT.
[0011] With reference to the first aspect, in some implementations of the first aspect, the synthesis method further comprises: performing a protection modification on the termination site.
[0012] With reference to the first aspect, in some implementations of the first aspect, the protection modification is a thio modification.
[0013] With reference to the first aspect, in some implementations of the first aspect, the deoxyribonucleic acid synthesis template comprises a first deoxyribonucleic acid synthesis template and a second deoxyribonucleic acid synthesis template, the primer comprises a first primer and a second primer, and the deoxyribonucleic acid comprises a first deoxyribonucleic acid and a second deoxyribonucleic acid, and the method further comprises: after the first deoxyribonucleic acid synthesis template synthesizes the first deoxyribonucleic acid with the first primer, the first deoxyribonucleic acid is used as the second primer to synthesize the second deoxyribonucleic acid with the second deoxyribonucleic acid synthesis template.
[0014] In a second aspect, there is provided two deoxyribonucleic acid synthesis templates, comprising: a binding region for binding to a primer, the primer being a first nucleic acid sequence, the binding region comprising a second nucleic acid sequence, the first nucleic acid sequence base pairing with the second nucleic acid sequence; an extension region for providing a template for an extension sequence of the primer, the extension region comprising a second nucleic acid sequence and a third nucleic acid sequence, the second nucleic acid sequence and the third nucleic acid sequence base pairing, the extension sequence being structurally identical to the third nucleic acid sequence; wherein a 3' end of the extension region comprises a termination site for terminating the extension of the extension sequence.
[0015] In combination with the second aspect, in some embodiments of the second aspect, the extension region further comprises a recognition region for being recognized by the gap enzyme, the extension of the extension sequence.
[0016] In combination with the second aspect, in some embodiments of the second aspect, the deoxyribonucleic acid synthesis template further comprises: a stem-loop structure; the stem-loop structure comprising a first sub-nucleic acid sequence, a second sub-nucleic acid sequence, and a third sub-nucleic acid sequence; wherein the first sub-nucleic acid sequence and the third sub-nucleic acid sequence are base-paired stem nucleic acid sequences, and the second sub-nucleic acid sequence is a loop nucleic acid sequence.
[0017] In combination with the second aspect, in some embodiments of the second aspect, the second sub-nucleic acid sequence is located between the first sub-nucleic acid sequence and the third sub-nucleic acid sequence; the first sub-nucleic acid sequence is connected to a 3' end of the third nucleic acid sequence, and the second sub-nucleic acid sequence is connected to a 5' end of the fourth nucleic acid sequence.
[0018] In combination with the second aspect, in some embodiments of the second aspect, the deoxyribonucleic acid synthesis template further comprises a protection region at a 3' end of the deoxyribonucleic acid synthesis template, the protection region being for terminating the extension of the 3' end of the deoxyribonucleic acid synthesis template.
[0019] In combination with the second aspect, in some embodiments of the second aspect, the nucleic acid sequence of the protection region is TTTTTTTTTT.
[0020] In combination with the second aspect, in some embodiments of the second aspect, the termination site comprises a protection modification.
[0021] In combination with the second aspect, in some embodiments of the second aspect, the protection modification comprises a thio modification.
[0022] In some implementations of the second aspect, the deoxyribonucleic acid synthesis template includes a first deoxyribonucleic acid synthesis template and a second deoxyribonucleic acid synthesis template, and the primer includes a first primer and a second primer; the first deoxyribonucleic acid synthesis template is configured to provide a first extension sequence template for the first primer, and the second deoxyribonucleic acid synthesis template is configured to provide a second extension sequence template for the second primer; and the second primer is the first primer and the first extension sequence.
[0023] In a third aspect, a kit is provided, including a deoxyribonucleic acid synthesis template for use in the method for synthesis of deoxyribonucleic acid according to any one of the first aspect of the present application, or the deoxyribonucleic acid synthesis template according to any one of the second aspect of the present application.
[0024] In some implementations of the third aspect, the kit further includes the primer, the deoxyribonucleic acid polymerase, and the nicking enzyme. BRIEF DESCRIPTION OF DRAWINGS
[0025] In order to more clearly illustrate the technical solutions of the embodiments of the present application, the drawings needed to be used in the embodiments of the present application will be briefly introduced as follows. Obviously, the drawings described below are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative effort on the basis of the drawings.
[0026] Figure 1 A flowchart of the method for synthesis of deoxyribonucleic acid according to an embodiment of the present application;
[0027] Figure 2 A nucleic acid sequence diagram of the deoxyribonucleic acid synthesis template according to an embodiment of the present application;
[0028] Figure 3 A flowchart of the method for synthesis of deoxyribonucleic acid according to another embodiment of the present application;
[0029] Figure 4 A flowchart of the method for synthesis of deoxyribonucleic acid according to yet another embodiment of the present application;
[0030] Figure 5 A deoxyribonucleic acid fragment analysis result diagram according to an embodiment of the present application;
[0031] Figure 6 A deoxyribonucleic acid product Sanger sequencing diagram according to an embodiment of the present application. DETAILED DESCRIPTION
[0032] For the purposes of the present application, the technical solutions and advantages thereof, the embodiments of the present application will be described in further detail below with reference to the drawings.
[0033] The ranges disclosed herein are defined by the endpoints as their lower and upper limits, given that the range is defined by selecting a lower limit and an upper limit, the selected lower limit and upper limit define the boundaries of a particular range. Ranges defined by endpoints are inclusive of the endpoint values and can be arbitrarily combined, i.e., any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60-120 and 80-110 are listed, it is understood that ranges of 60-110 and 80-120 are also contemplated. Furthermore, if a minimum range value of 1 and 2 is listed, and if a maximum range value of 3, 4, and 5 is listed, then the following ranges are all contemplated: 1-3, 1-4, 1-5, 2-3, 2-4, and 2-5. In the present application, unless otherwise stated, a numerical range "a-b" indicates a shorthand way of describing each and every intervening real number, a and b, between the upper and lower boundary values, a and b, inclusive. For example, the numerical range "0-5" indicates that all real numbers between "0-5" have been listed herein, "0-5" is merely a shorthand way of describing these numerical combinations. Additionally, when a parameter is stated to be an integer ≥ 2, it is equivalent to disclose that the parameter is, for example, an integer 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.
[0034] If not particularly stated, all the embodiments and optional embodiments of the present application can be combined with each other to form new technical solutions.
[0035] If not particularly stated, all the technical features and optional technical features of the present application can be combined with each other to form new technical solutions.
[0036] The terms used in the following embodiments are only for the purpose of describing specific embodiments and are not intended to be limiting of the present application. As used in the specification and the appended claims of the application, the singular forms "a," "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will also be understood that the term "at least one" or "one or more" as used in the specification and the claims indicates that one, two or more are meant unless the context clearly indicates otherwise. The term "and / or" used in the description refers to the association relationship of the associated objects, which means that there can be three relationships; for example, A and / or B can mean that A exists alone, A and B exist together, and B exists alone, where A and B can be singular or plural. The character " / " generally represents an "or" relationship between the associated objects.
[0037] Reference in the specification to "one implementation", "some implementations", "one embodiment" or "some embodiments", etc., means that a particular feature, structure, or characteristic described in connection with the implementation is included in at least one embodiment of the application. The appearances of the phrases "in one implementation", "in some implementations", "in other implementations", "in still other implementations", etc., in various places in the specification are not necessarily all referring to the same embodiment, unless otherwise specifically stated specifically.
[0038] In the description of the embodiments of the application, the technical terms "first", "second", etc. are only used to distinguish different description objects, and cannot be understood as indicating or implying relative importance or implicitly indicating the number, specific order or primary and secondary relationship of the indicated technical features. In the description of the embodiments of the application, the meaning of "multiple" is more than two, unless otherwise specifically limited.
[0039] The embodiments of the application will be described in more detail with reference to the accompanying drawings. In each of the drawings, the same elements are denoted by like reference numerals for the sake of clarity. In addition, some parts that are well known in the art can not be shown in the drawings.
[0040] The synthesis of DNA promotes the leap of life science research from observation, description and experience-based science to predictable quantification and engineering science, and is increasingly widely used in the fields of medical treatment, energy, industry, agriculture, environment, information, etc., with great potential, and has become a must-win place for the strategic layout of science and technology of each country. As a key basic technology of synthetic biology, the importance of DNA synthesis is comparable to that of sequencing technology in genomics. Innovation in synthesis technology will remove the rate-limiting step of DNA development, and the practical application demand is large. The autonomy of DNA synthesis technology will also mark a key breakthrough in the field of synthetic biology, and ensure the independent development of the life science industry.
[0041] As described above, the current DNA synthesis is mainly by chemical method, especially the solid-phase phosphoramidite triester synthesis method is the most mature and widely used, but chemical synthesis of DNA has many shortcomings, which greatly limits the application of DNA.
[0042] In view of the above problems, the present application provides a method for synthesizing deoxyribonucleic acid, a deoxyribonucleic acid synthesis template and a kit, which can obtain DNA products by primer extension with the aid of polymerase, nicking enzyme and based on the principle of base complementary pairing, and then cut by the action of nicking enzyme, so as to obtain DNA with longer synthesis length, and improve the synthesis speed and reduce the synthesis cost.
[0043] The ribonucleic acid synthesis template, the synthesis method of deoxyribonucleic acid and the kit will be described in detail below in combination with the drawings.
[0044] Figure 1 The flowchart of the synthesis method of deoxyribonucleic acid of an embodiment of the present application is shown. The synthesis method of deoxyribonucleic acid 100 (hereinafter referred to as “synthesis method 100”) comprises:
[0045] S110: combining a primer and a deoxyribonucleic acid synthesis template to obtain a first sub-deoxyribonucleic acid, the primer being a first nucleic acid sequence, the binding region of the deoxyribonucleic acid synthesis template comprising a second nucleic acid sequence, the first nucleic acid sequence being base-paired with the second nucleic acid sequence;
[0046] It should be understood that the primer is used as a starting point in the deoxyribonucleic acid synthesis reaction. The primer helps the deoxyribonucleic acid polymerase to start synthesizing a new deoxyribonucleic acid chain at a specific position by pairing with the nucleic acid sequence of the deoxyribonucleic acid synthesis template. In the deoxyribonucleic acid synthesis technology such as polymerase chain reaction, the primer is usually designed and synthesized according to the needs to ensure that they are completely complementary to the specific region of the target deoxyribonucleic acid sequence.
[0047] Specifically, the primer and the second nucleic acid sequence in the deoxyribonucleic acid synthesis template (hereinafter referred to as synthesis template) are in a base-paired state.
[0048] Specifically, in the synthesis of deoxyribonucleic acid, two hydrogen bonds are formed between base A and base T, and three hydrogen bonds are formed between base G and base C. Therefore, base A is always paired with base T, and base G is always paired with base C, that is, the base-pairing principle described in the embodiments of the present application.
[0049] It should be understood that the synthesis template refers to the one formed by the complementary base pairs meeting each other and forming hydrogen bond combination due to the folding of the deoxyribonucleic acid nucleic acid sequence by itself.
[0050] S120: adding a deoxyribonucleic acid polymerase, forming an extension sequence at the 3' end of the first nucleic acid sequence in the extension region of the deoxyribonucleic acid to obtain a second sub-deoxyribonucleic acid, the extension region comprising a third nucleic acid sequence and a fourth nucleic acid sequence, the third nucleic acid sequence being base-paired with the fourth nucleic acid sequence, and the extension sequence being structurally identical to the third nucleic acid sequence.
[0051] Specifically, in the embodiments of the present application, the synthesis template comprises a second nucleic acid sequence base-paired with the first nucleic acid sequence, an extension region comprising a third nucleic acid sequence and a fourth nucleic acid sequence base-paired with the third nucleic acid sequence. That is, the binding region in the primer and the synthesis template base-pairs, and the third nucleic acid sequence in the synthesis template base-pairs with the fourth nucleic acid sequence.
[0052] In the second sub-deoxyribonucleic acid synthesis process, the deoxyribonucleic acid polymerase adds bases one by one at the 3' end of the primer, i.e. forms an extension sequence at the extension region of the synthesis template.
[0053] Specifically, in the embodiments of the present application, the deoxyribonucleic acid polymerase adds bases one by one at the 3' end of the primer having the structure of the first nucleic acid sequence, and the added base sequence base-pairs with the fourth nucleic acid sequence in the synthesis template and has the same structure as the third nucleic acid sequence in the synthesis template, i.e. forms an extension sequence of the target deoxyribonucleic acid.
[0054] It should be understood that the third nucleic acid sequence in the synthesis template has the same structure as the extension sequence. In this synthesis process, the extension sequence is connected to the 3' end of the primer by adding the deoxyribonucleic acid polymerase, and the extension sequence replaces the position of the third nucleic acid sequence, so it can be said that the third nucleic acid sequence is pushed up by the extension sequence.
[0055] S130: adding a nicking enzyme to cut the termination site at the 3' end of the extension region, separating the first nucleic acid sequence and the extension sequence from the second sub-deoxyribonucleic acid to obtain a deoxyribonucleic acid.
[0056] It should be understood that the "deoxyribonucleic acid" described in the specific synthesis steps in the present application is the final target deoxyribonucleic acid or deoxyribonucleic acid product.
[0057] In the above steps, the first sub-deoxyribonucleic acid in the combined state is obtained by combining the synthesis template and the primer; the second sub-deoxyribonucleic acid comprising the synthesis template and the target deoxyribonucleic acid is formed by adding the deoxyribonucleic acid polymerase; and the separated deoxyribonucleic acid is obtained by adding the nicking enzyme to cut the second sub-deoxyribonucleic acid at a specific position, and at the same time, the third nucleic acid sequence returns to the original position because the extension sequence has left the position of the third nucleic acid sequence, and the synthesis template returns to the original state. That is, by cutting with the nicking enzyme, the desired deoxyribonucleic acid product and the original synthesis template can be obtained.
[0058] In the above scheme, by combining the primer and the synthesis template, and then adding the deoxyribonucleic acid polymerase, the primer can form an extension sequence in the extension region of the synthesis template to obtain a combination of the target deoxyribonucleic acid and the synthesis template; then by adding the nicking enzyme to cut the combination, the deoxyribonucleic acid product and the synthesis template can be obtained. By using the synthesis method to synthesize the deoxyribonucleic acid, the deoxyribonucleic acid can have a longer length, so that more information can be stored; the synthesis template can be reused, thereby reducing the synthesis cost; in addition, the synthesis method does not involve chemical reagents, is more environmentally friendly, and the steps are simple and easy to implement.
[0059] In some embodiments, the extension region further comprises a recognition region, and the step of adding the nicking enzyme to cut the termination site at the 3' end of the extension region comprises: after the nicking enzyme recognizes the recognition region, the termination site is cut.
[0060] As described above, when the second subribonucleic acid comprises the target product and the synthesis template, the nicking enzyme is added, and the nicking enzyme cuts the termination site at the 3' end of the extension region to separate the target product and the second subdeoxyribonucleic acid.
[0061] Specifically, the nicking enzyme can only realize the cutting effect after recognizing the recognition region of the extension region.
[0062] It should be noted here that how the nicking enzyme recognizes the recognition region and the termination site is the biological characteristics of the nicking enzyme, and the recognition region and the termination site of different nicking enzymes can be different, and the present application does not make too much description here.
[0063] In some embodiments, the nicking enzyme is Nt.BstNBI.
[0064] As described above, the specific base sequence recognized by each nicking enzyme and the cutting position are different, which is determined by the characteristics of each nicking enzyme. When the nicking enzyme is Nt.BstNBI, it recognizes the GATCG sequence, and breaks the phosphodiester bond at the fourth base position after the GATCG sequence.
[0065] Figure 2 The deoxyribonucleic acid synthesis template of an embodiment of the present application. As Figure 2As shown, the deoxyribonucleic acid synthesis template 200 (hereinafter referred to as the synthesis template 200) includes a binding region 210 for binding with a primer, the binding region 210 including a second nucleic acid sequence 2101, the primer being a first nucleic acid sequence, the first nucleic acid sequence and the second nucleic acid sequence being base-paired; an extension region 220 for providing an extension sequence template for the primer, the extension region 220 including a third nucleic acid sequence 2201 and a fourth nucleic acid sequence 2202, the third nucleic acid sequence 2201 and the fourth nucleic acid sequence 2202 being base-paired; wherein the 3' end of the extension region 220 includes a termination site 2203 for terminating the extension of the extension sequence. The synthesis template 200 further includes a recognition region 2204.
[0066] In some embodiments, the deoxyribonucleic acid synthesis template 200 further includes a stem-loop structure 230, the stem-loop structure 230 including a first sub-nucleic acid sequence 2301, a second sub-nucleic acid sequence 2302, and a third sub-nucleic acid sequence 2303, wherein the first sub-nucleic acid sequence 2301 and the third sub-nucleic acid sequence 2303 are base-paired stem nucleic acid sequences, and the second sub-nucleic acid sequence 2302 is a loop nucleic acid sequence.
[0067] In some embodiments, the second sub-nucleic acid sequence 2302 is located between the first sub-nucleic acid sequence 2301 and the third sub-nucleic acid sequence 2303; the first sub-nucleic acid sequence 2301 is connected to the 3' end of the third nucleic acid sequence 2303, and the third sub-nucleic acid sequence 2303 is connected to the 5' end of the fourth nucleic acid sequence 2202.
[0068] In the above scheme, by including the stem-loop structure 230 in the synthesis template 200, the stability of the synthesis template 200 can be increased.
[0069] Please continue to refer to Figure 2 In some embodiments, the deoxyribonucleic acid synthesis template 200 further includes a protection region 240 at the 3' end of the deoxyribonucleic acid synthesis template 200, the protection region 240 being used to terminate the extension of the 3' end of the deoxyribonucleic acid synthesis template 200.
[0070] In some embodiments, the nucleic acid sequence of the protection region 240 is TTTTTTTT.
[0071] The protection region 240 can prevent the 3' end of the synthesis template 200 from being extended incorrectly, and adding some modification groups that are not conducive to the extension reaction of the deoxyribonucleic acid polymerase, such as a poly T of multiple thymine repeats.
[0072] In the above scheme, by having the 3' end of the synthesis template 200 have the protection region 240 with the nucleic acid sequence TTTTTTTTTT, the probability of successful synthesis of deoxyribonucleic acid can be increased.
[0073] It should be understood that the molecular structure of the protection region 240 can also vary according to specific experimental requirements or product requirements.
[0074] It should also be noted here that the synthetic template 200 includes a second nucleic acid sequence 2101, a third nucleic acid sequence 2201, a fourth nucleic acid sequence 2202, a stem loop structure 230, and a protection region 240, wherein the stem loop structure 230 includes a first sub-nucleic acid sequence 2301, a second sub-nucleic acid sequence 2302, and a third sub-nucleic acid sequence 2303. As shown, the second nucleic acid sequence 2101 is a single-stranded structure, and the third nucleic acid sequence 2201 and the fourth nucleic acid sequence 2202 are both single-stranded structures, forming a double-stranded structure. Figure 2
[0075] As shown in the synthetic template 200, the nucleic acid sequence of the binding region 210 in the synthetic template 200, i.e., the second nucleic acid sequence 2101, is "AGCTTCAGAC"; the third nucleic acid sequence 2201 is "ACTAC…GAGTCGCGG", and the fourth nucleic acid sequence 2202 is "TGATG…CTCAGCGCC", both of which form the extension region 220 in the synthetic template 200. Figure 2
[0076] In some embodiments, the synthesis method 100 further includes: performing a protection modification on the termination site 2203.
[0077] In some embodiments, the protection modification is a thio modification.
[0078] The thio modification is to replace the non-bridging oxygen atom on the phosphate group of the nucleotide with a sulfur atom, and to modify the phosphodiester bond to a phosphorothioate bond. This modification can greatly increase the nucleic acid enzyme resistance of the oligonucleotide, so that it is not recognized and cut by the nicking enzyme.
[0079] In the above scheme, by performing a thio modification on the synthetic template 200, it can be avoided that other positions in the synthetic template 200 are incorrectly cut by the nicking enzyme, thereby destroying the reusable synthetic template 200.
[0080] It should be understood that the specific position of the termination site is the 3' end of the third nucleic acid sequence 2201 in the extension region 220, and the extension sequence has the same structure as the third nucleic acid sequence 2201, i.e., the 3' end of the extension sequence also has a termination site. When the termination site 2203 is thio-modified, the nicking enzyme will recognize the recognition region in the extension sequence and cut the termination site in the extension sequence to obtain the target deoxyribonucleic acid.
[0081] Figure 3 The flowchart of the synthesis method of the deoxyribonucleic acid of another embodiment of the present application is shown. In Figure 3 In the middle, F represents the first nucleic acid sequence, a represents the third nucleic acid sequence and the extension sequence, F' represents the second nucleic acid sequence, a' represents the fourth nucleic acid sequence, and F+a represents the final deoxyribonucleic acid product. As shown in Figure 3 The synthesis method 300 can be summarized as the following steps:
[0082] S310: primer hybridization, the primer and the synthesis template hybridize to form a double-stranded structure, i.e., the first sub-deoxyribonucleic acid;
[0083] S320: primer extension, adding deoxyribonucleic acid polymerase, adding bases one by one at the 3' of the primer, and then obtaining a connected with the primer F and base-paired with a', F+a becomes the extended primer and the extension sequence, the newly extended a (i.e., the extension sequence) replaces the a (i.e., the third nucleic acid sequence) in the synthesis template, the a in the synthesis template is lifted, and the second sub-deoxyribonucleic acid is obtained;
[0084] S330: product enzyme digestion, using a nicking enzyme to cut F+a from the second sub-deoxyribonucleic acid;
[0085] S340: product separation, i.e., the synthesis template and the deoxyribonucleic acid product are separated, and the final deoxyribonucleic acid product is obtained.
[0086] The synthesis method will be explained in detail below in combination with specific nucleic acid sequences.
[0087] Specifically, the first primer can be "5'-GGAGCTGCGGGTGCGC-3'" (for the convenience of understanding and representation, the 3' end and 5' end are omitted below, and the molecular chain is directly represented), the deoxyribonucleic acid synthesis template 200 can be "5'-CCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGATAA ACCATCCGTTTAATATTACCGGATGGTTTATCGGCATCGCGGAGGAGCCGCTTACGA GCTTGCGCAGGTGGGAGGCGAGGCGCACCCGCAGCTCCTTTTTTTTTT-3"; that is, the first nucleic acid sequence is 5'-GGAGCTGCGGGTGCGC-3', the second nucleic acid sequence is CCTCGACGCCCACGCG, the third nucleic acid sequence is CCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGC, and the fourth nucleic acid sequence is GCATCGCGGAGGAGCCGCTTACGAGCTTGCGCAGGTGGGAGGCGAG. Therefore, the extension sequence is CCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGAT, and the nucleic acid sequence of the final deoxyribonucleic acid product is 5'-GGAGCTGCGGGTGCGC CCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTCCGCGATGCCGAT-3'.
[0088] It should be noted here that in actual application, the molecular chain of the synthesis template can be designed according to the deoxyribonucleic acid molecular chain to be obtained. The nicking enzyme used here is Nt.BstNBI.
[0089] In some embodiments, the deoxyribonucleic acid synthesis template 200 includes a first deoxyribonucleic acid synthesis template and a second deoxyribonucleic acid synthesis template, the primer includes a first primer and a second primer, the deoxyribonucleic acid includes a first deoxyribonucleic acid and a second deoxyribonucleic acid, and the synthesis method 100 further includes: after the first deoxyribonucleic acid synthesis template and the first primer synthesize the first deoxyribonucleic acid, the first deoxyribonucleic acid is used as the second primer to synthesize the second deoxyribonucleic acid with the second deoxyribonucleic acid synthesis template.
[0090] Specifically, the synthesis of the second deoxyribonucleic acid is based on the first deoxyribonucleic acid. That is, in this embodiment, the primer is F+a, and the final deoxyribonucleic acid is a product obtained by further extension based on F+a. In this application, such a reaction can be referred to as a cascade reaction of deoxyribonucleic acid.
[0091] It should be understood that in the synthesis of deoxyribonucleic acid (DNA), the size of the DNA product fragment obtained from a single synthesis reaction is limited, and the amount of information stored is also relatively small. More information storage requires longer DNA sequences, which can be addressed by using cascade reactions to splice and integrate multiple DNA fragments.
[0092] Figure 4 This is a schematic flowchart illustrating a method for synthesizing deoxyribonucleic acid according to another embodiment of this application. Figure 4 As shown, in the cascade reaction, the first primer and the first deoxyribonucleic acid (DNA) synthesis template are used to synthesize the first DNA; then the first DNA is used as the second primer and the second DNA synthesis template are used to synthesize the second DNA; then the second DNA product is used as the third primer and the third DNA synthesis template are used to synthesize the third DNA product... Finally, after N reactions, the final DNA product is obtained.
[0093] It should be noted that, in Figure 4 In region A, the two purple single strands above and below correspond to the third and fourth nucleic acid sequences in the above embodiments, respectively. These two nucleic acid sequences are two single strands with base pairing. The use of the same color here is only to indicate that they belong to the same synthetic template 200, and does not mean that they are completely identical nucleic acid sequences. The structures in the first and third deoxyribonucleic acid synthetic templates are similar.
[0094] It should be noted that when the second primer synthesizes the second deoxyribonucleic acid (DNA) with the second DNA synthesis template, the nucleic acid sequence of the second primer can be completely paired with the second nucleic acid sequence in the second DNA synthesis template, or it can be partially paired. For example, only 5-10 bases may be in a paired state. Of course, this application does not impose any restrictions on this; adjustments can be made based on actual experiments.
[0095] In the above scheme, longer deoxyribonucleic acid molecular chains can be synthesized through cascade reactions to store more information.
[0096] The second aspect of the present application provides a deoxyribonucleic acid synthesis template 200, comprising: a binding region 210, configured to bind to a primer, the primer being a first nucleic acid sequence, the binding region 210 comprising a second nucleic acid sequence 2101, the first nucleic acid sequence base-pairing with the second nucleic acid sequence 2101; an extension region 220, configured to provide an extension sequence template for the primer, the extension region 220 comprising a third nucleic acid sequence 2201 and a fourth nucleic acid sequence 2202, the third nucleic acid sequence 2201 and the fourth nucleic acid sequence 2202 base-pairing, the extension sequence being structurally identical to the third nucleic acid sequence 2201; wherein a 3' end of the extension region comprises a termination site 2203, the termination site 2203 being configured to terminate the extension of the extension sequence.
[0097] In some embodiments, the extension region 220 further comprises a recognition region 2204, the recognition region 2204 being configured to be recognized by a nicking enzyme to terminate the extension of the extension sequence.
[0098] In some embodiments, the deoxyribonucleic acid synthesis template 200 further comprises: a stem-loop structure 230, the stem-loop structure 230 comprising a first sub-nucleic acid sequence 2301, a second sub-nucleic acid sequence 2302, and a third sub-nucleic acid sequence 2303; wherein the first sub-nucleic acid sequence 2301 and the third sub-nucleic acid sequence 2303 are base-paired stem nucleic acid sequences, and the second sub-nucleic acid sequence 2302 is a loop nucleic acid sequence.
[0099] In some embodiments, the second sub-nucleic acid sequence 2302 is located between the first sub-nucleic acid sequence 2301 and the third sub-nucleic acid sequence 2303; the first sub-nucleic acid sequence 2301 is connected to a 3' end of the third nucleic acid sequence 2303, and the third sub-nucleic acid sequence 2303 is connected to a 5' end of the fourth nucleic acid sequence 2202.
[0100] In some embodiments, the deoxyribonucleic acid synthesis template 200 further comprises a protection region 240 located at a 3' end of the deoxyribonucleic acid synthesis template, the protection region 240 being configured to terminate the extension of the 3' end of the deoxyribonucleic acid synthesis template 200.
[0101] In some embodiments, the nucleic acid sequence of the protection region 240 is TTTTTTTTTT.
[0102] In some embodiments, the termination site 2203 comprises a protection modification.
[0103] In some embodiments, the protection modification comprises a thio modification.
[0104] In some embodiments, the deoxyribonucleic acid synthesis template 200 comprises a first deoxyribonucleic acid synthesis template and a second deoxyribonucleic acid synthesis template, and the primer comprises a first primer and a second primer; the first deoxyribonucleic acid synthesis template is used to provide a first extension sequence template for the first primer, and the second deoxyribonucleic acid synthesis template is used to provide a second extension sequence template for the second primer; wherein the second primer is the first primer and the first extension sequence.
[0105] The third aspect of the present application provides a kit comprising the deoxyribonucleic acid synthesis template for the deoxyribonucleic acid synthesis method according to any one of the first aspect, or the deoxyribonucleic acid synthesis template according to any one of the second aspect.
[0106] In some embodiments, the kit further comprises a primer, a deoxyribonucleic acid polymerase, and a nicking enzyme.
[0107] The synthesis and analysis process of DNA will be briefly described below in combination with the embodiments of the primer and synthesis template described above, and the same technical solutions as the related art will not be described herein.
[0108] Synthesis of DNA: select a 0.2 mL PCR tube, configure the reaction system according to the concentration and volume in Table 1, operate on ice, and after pipetting and mixing, centrifuge briefly. Incubate at 55°C for 3h, and after the reaction is completed, heat the solution at 80°C for 20 minutes to inactivate the enzyme.
[0109] Table 1 Preparation of reaction system solution
[0110] Component Volume (μL) Concentration Bst DNA polymerase 1 50000 U / mL Nt.Bst NBI nicking enzyme 1 10000 U / mL 10x buffer 5 / dNTP mix solution 2 10 mM Primer 2 10 uM DNA synthesis template 2 10 uM Enzyme-free water 28 / Total volume 50
[0111] Purification of DNA: take all the reaction solution (50 μL), add 75 μL of AMPure XP magnetic beads (1.5x magnetic beads), mix well by blowing, and stand at room temperature for 5 minutes. Then place the PCR tube on the magnetic stand, stand for 5 minutes until the liquid becomes clear, and discard the supernatant. Add 200 μL of 80% ethanol, stand for 1 min, then discard the supernatant, and repeat once more. Stand at room temperature with the lid open until dry without liquid residue. Add 18 μL of enzyme-free water, mix well by blowing, and stand at room temperature for 5 min. Place on the magnetic stand, stand for 5 min until the liquid becomes clear, and transfer 20 μL of supernatant to a new 1.5 mL centrifuge tube.
[0112] Analysis of DNA fragments: take 2uL of the purified DNA solution, mix it with 2uL of
Agilent
[0113] DNA sequencing: take the primer and the purified product to a testing agency for Sanger sequencing.
[0114] DNA synthesis results: Based on the designed primers and synthesis template, the synthesized DNA fragment sequence is: 5'-GGAGCTGCGGGTGCGCCCTCGCCTCCCACCTGCGCAAGCTGCGTAAGCGGCTCCTC CGCGATGCCGAT-3', with an expected fragment size of 67bp. Figure 5 This is a diagram showing the analysis results of a deoxyribonucleic acid fragment according to an embodiment of this application, as shown. Figure 5 As shown, the peak value of the fragment is 63bp and the average fragment length is 64bp, which is consistent with the theoretical value. Figure 6 This is a Sanger sequencing image of the deoxyribonucleic acid product according to one embodiment of this application, which is consistent with the designed sequence.
[0115] Although this application has been described with reference to preferred embodiments, various modifications can be made thereto and components or steps can be replaced with equivalents without departing from the scope of this application. In particular, the technical features mentioned in the various embodiments can be combined in any manner, provided there is no conflict in structure or method steps. This application is not limited to the specific embodiments disclosed herein, but includes all technical solutions falling within the scope of the claims.
Claims
1. A method for synthesizing deoxyribonucleic acid, characterized in that, include: By combining primers and a deoxyribonucleic acid (DNA) synthesis template, a first deoxyribonucleic acid (DNA) is obtained. The primers are a first nucleic acid sequence, and the binding region of the DNA synthesis template includes a second nucleic acid sequence. The first nucleic acid sequence and the second nucleic acid sequence are base-paired. Adding deoxyribonucleic acid polymerase, the 3' end of the first nucleic acid sequence forms an extension sequence in the extension region of the deoxyribonucleic acid synthesis template to obtain a second deoxyribonucleic acid. The extension region includes a third nucleic acid sequence and a fourth nucleic acid sequence. The third nucleic acid sequence is base-paired with the fourth nucleic acid sequence. The extension sequence has the same structure as the third nucleic acid sequence. Add a cleavage enzyme to cleave the termination site at the 3' end of the extension region, and separate the first nucleic acid sequence and the extension sequence from the second deoxyribonucleic acid to obtain the deoxyribonucleic acid.
2. The synthesis method according to claim 1, characterized in that, The extended region further includes a recognition region, and the addition of the nick enzyme to cleave the termination site at the 3' end of the extended region includes: The nick enzyme recognizes the recognition region and cleaves the termination site.
3. The synthesis method according to claim 1, characterized in that, The deoxyribonucleic acid (DNA) synthesis template further includes a stem-loop structure, wherein the stem-loop structure comprises a first daughter nucleic acid sequence, a second daughter nucleic acid sequence, and a third daughter nucleic acid sequence; The first and third sub-nucleic acid sequences are base-paired stem nucleic acid sequences, and the second sub-nucleic acid sequence is a loop nucleic acid sequence.
4. The synthesis method according to claim 3, characterized in that, The second sub-nucleic acid sequence is located between the first sub-nucleic acid sequence and the third sub-nucleic acid sequence; The first sub-nucleic acid sequence is linked to the 3' end of the third nucleic acid sequence, and the third sub-nucleic acid sequence is linked to the 5' end of the fourth nucleic acid sequence.
5. The synthesis method according to claim 1, characterized in that, The deoxyribonucleic acid (DNA) synthesis template also includes a protective region located at the 3' end of the DNA synthesis template, the protective region being used to terminate the extension of the 3' end of the DNA synthesis template.
6. The synthesis method according to claim 5, characterized in that, The nucleic acid sequence of the protected region is TTTTTTTTTT.
7. The synthesis method according to any one of claims 1-6, characterized in that, The synthesis method further includes: The termination site is protected by a protective modification.
8. The synthesis method according to claim 7, characterized in that, The protective modification is a thiomodification.
9. The synthesis method according to claim 1, characterized in that, The deoxyribonucleic acid (DNA) synthesis template includes a first DNA synthesis template and a second DNA synthesis template; the primers include a first primer and a second primer; the DNA includes a first DNA and a second DNA; and the synthesis method further includes: After the first deoxyribonucleic acid (DNA) is synthesized using the first DNA synthesis template and the first primer, the first DNA is used as the second primer to synthesize the second DNA using the second DNA synthesis template.
10. A deoxyribonucleic acid (DNA) synthesis template, characterized in that, include: A binding region for binding to a primer, wherein the primer is a first nucleic acid sequence, and the binding region includes a second nucleic acid sequence, wherein the first nucleic acid sequence is base-paired with the second nucleic acid sequence. The extension region is used to provide an extension sequence template for the primer. The extension region includes a third nucleic acid sequence and a fourth nucleic acid sequence, wherein the third nucleic acid sequence and the fourth nucleic acid sequence are base-paired, and the extension sequence has the same structure as the third nucleic acid sequence. The 3' end of the extended region includes a termination site, which is used to terminate the extension of the extended sequence.
11. The deoxyribonucleic acid synthesis template according to claim 10, characterized in that, The extension region also includes a recognition region for recognition by the nick enzyme to terminate the extension of the extension sequence.
12. The deoxyribonucleic acid synthesis template according to claim 10, characterized in that, The deoxyribonucleic acid (DNA) synthesis template further includes a stem-loop structure, wherein the stem-loop structure comprises a first daughter nucleic acid sequence, a second daughter nucleic acid sequence, and a third daughter nucleic acid sequence; The first and third sub-nucleic acid sequences are base-paired stem nucleic acid sequences, and the second sub-nucleic acid sequence is a loop nucleic acid sequence.
13. The deoxyribonucleic acid synthesis template according to claim 12, characterized in that, The second sub-nucleic acid sequence is located between the first sub-nucleic acid sequence and the third sub-nucleic acid sequence; The first sub-nucleic acid sequence is linked to the 3' end of the third nucleic acid sequence, and the third sub-nucleic acid sequence is linked to the 5' end of the fourth nucleic acid sequence.
14. The deoxyribonucleic acid synthesis template according to claim 10, characterized in that, The deoxyribonucleic acid (DNA) synthesis template also includes a protective region located at the 3' end of the DNA synthesis template, the protective region being used to terminate the extension of the 3' end of the DNA synthesis template.
15. The deoxyribonucleic acid synthesis template according to claim 14, characterized in that, The nucleic acid sequence of the protected region is TTTTTTTTTT.
16. The deoxyribonucleic acid (DNA) synthesis template according to any one of claims 10-15, characterized in that, The termination site includes protective modifications.
17. The deoxyribonucleic acid synthesis template according to claim 16, characterized in that, The protective modifications include thiomodification.
18. The deoxyribonucleic acid synthesis template according to claim 10, characterized in that, The deoxyribonucleic acid (DNA) synthesis template includes a first DNA synthesis template and a second DNA synthesis template; the primers include a first primer and a second primer. The first deoxyribonucleic acid (DNA) synthesis template is used to provide a first extension sequence template for the first primer. The second deoxyribonucleic acid synthesis template is used to provide a second extension sequence template for the second primer; The second primer is the first primer and the first extended sequence.
19. A reagent kit, characterized in that, include: The deoxyribonucleic acid (DNA) synthesis template for a method of synthesizing DNA as described in any one of claims 1-9, or the DNA synthesis template for synthesizing DNA as described in any one of claims 10-18.
20. The reagent kit according to claim 19, characterized in that, The kit also includes the primers, the deoxyribonucleic acid polymerase, and the nicking enzyme.