Composition for detecting liver cancer and application thereof
By detecting the methylation status of RNF135, CHFR, SPINT2, SPDYA, PAX5, and VASH2 genes, this method addresses the insufficient sensitivity and specificity of existing technologies for early diagnosis of liver cancer, providing a highly sensitive and accurate method for liver cancer detection that is applicable to the detection of cell-free DNA in peripheral blood.
Patent Information
- Application Number
- CN202310467788.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-04-26
- Publication Date
- 2026-02-06
AI Technical Summary
Existing technologies lack sufficient sensitivity and specificity in the early diagnosis of liver cancer. Imaging tests have a high false positive rate and high equipment costs. Traditional serum tumor marker tests have low sensitivity, and there is a lack of efficient methylation gene detection technology.
A method based on the methylation status of RNF135, CHFR, SPINT2, SPDYA, PAX5, and VASH2 genes was used to detect the methylation status of liver cancer-related genes by using nucleic acid compositions and kits, treating DNA with bisulfite reagent, and combining DNA polymerase and probes.
It achieves sensitive and specific detection of liver cancer, reduces the harm of invasive testing, improves the early diagnosis rate of liver cancer, has high sensitivity and accuracy, and is suitable for the detection of cell-free DNA in peripheral blood.
Smart Images

Figure BDA0004206677850000241 
Figure BDA0004206677850000251 
Figure BDA0004206677850000261
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular biology, and relates to gene detection, in particular to a nucleic acid composition for detecting liver cancer related gene methylation and a corresponding kit and use thereof. BACKGROUND
[0002] Liver cancer is a cancer with very high malignancy. An important factor leading to high mortality of liver cancer is the low rate of early liver cancer diagnosis. The cure rate of early liver cancer is much higher than that of middle and advanced liver cancer. However, most patients are diagnosed at the middle and advanced stage because early liver cancer lacks obvious and specific symptoms. Clinical studies have found that the process from the formation of a cancer lesion to the appearance of clinical symptoms in patients takes an average of several years, which provides an effective window period for the discovery of early liver cancer and the improvement of the diagnosis rate of early liver cancer. Making full use of this window period is expected to improve the treatment effect of liver cancer and reduce the mortality of liver cancer.
[0003] Currently, the main technology used in clinical diagnosis and screening of early liver cancer is imaging detection technology, including X-ray chest radiography and low-dose spiral CT (LD-CT). However, large-scale clinical data analysis has found that X-ray chest radiography has no significant effect on reducing liver cancer mortality; although LD-CT has a significant effect on reducing liver cancer mortality, it has a very high false positive rate (90%), thus there is a risk of over-diagnosis leading to over-treatment. In addition, the limitations of imaging examination in terms of equipment cost, operation technology and radioactivity make it difficult to be widely promoted as a liver cancer screening technology.
[0004] Traditional serum tumor markers (such as Cyfra21-SCC, CEA, etc.) have low sensitivity for liver cancer detection, especially for early liver cancer detection, which cannot fully meet the requirements of early cancer screening.
[0005] Recent studies have shown that epigenetics plays an important role in the occurrence and development of cancer. As an important mechanism of epigenetics, the regulation of DNA methylation in various cancers has been extensively studied. Research data shows that the regulation of gene methylation is related to biological mechanisms such as chromatin structure and gene expression regulation; changes in cellular gene methylation occur in the early stages of tumor formation and throughout the occurrence and development of cancer; methylation of tumor suppressor genes is an important molecular mechanism for the transformation of precancerous lesion tissue into malignant tumor cells. However, there is currently a lack of detection techniques, methods and products for detecting liver cancer methylation genes. Therefore, there is a need for methylation gene markers with high sensitivity and specificity for liver cancer detection. SUMMARY
[0006] Based on the problems existing in the current liver cancer detection, the purpose of the present application is to provide a composition, a kit and the use thereof for detecting liver cancer in vitro, a method for detecting based on the kit, and the use for detecting liver cancer.
[0007] The specific technical scheme of the present application is as follows:
[0008] 1. A composition for detecting liver cancer in vitro, the composition comprising:
[0009] a nucleic acid for detecting the methylation state of a target gene,
[0010] wherein the methylation state of the target gene is characterized by the methylation of a target sequence of the target gene,
[0011] wherein the target gene is one or more of RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene and VASH2 gene.
[0012] 2. The composition according to item 1, wherein the target sequence of the RNF135 gene is as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the target sequence of the RNF135 gene comprises the sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4.
[0013] 3. The composition according to item 1, wherein the target sequence of the CHFR gene is as shown in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the target sequence of the CHFR gene comprises the sequence as shown in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8.
[0014] 4. The composition according to item 1, wherein the target sequence of the SPINT2 is as shown in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the target sequence of the SPINT2 comprises the sequence as shown in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12.
[0015] 5. The composition of item 1, wherein the target sequence of the SPDYA gene is set forth in SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the target sequence of the SPDYA gene comprises the sequence set forth in SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16.
[0016] 6. The composition of item 1, wherein the target sequence of the PAX5 gene is set forth in SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the target sequence of the PAX5 gene comprises the sequence set forth in SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20.
[0017] 7. The composition of item 1, wherein the target sequence of the VASH2 gene is set forth in SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the target sequence of the VASH2 gene comprises the sequence set forth in SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24.
[0018] 8. The composition of any one of items 1-7, wherein the nucleic acid for detecting the methylation status of the target gene comprises:
[0019] a primer that is a fragment of at least 9 nucleotides of the target sequence of the target gene, the fragment comprising at least one CpG dinucleotide sequence.
[0020] 9. The composition of any one of items 1-8, wherein the nucleic acid for detecting the methylation status of the target gene comprises:
[0021] a probe that hybridizes to a fragment of at least 15 nucleotides of the target sequence of the target gene under medium stringency or high stringency conditions,
[0022] the fragment comprising at least one CpG dinucleotide sequence.
[0023] 10. The composition of any one of items 1-9, further comprising:
[0024] an agent that converts a 5-position unmethylated cytosine base of the target sequence of the target gene to a uracil.
[0025] 11. The composition according to any one of items 1-10, wherein the nucleic acid for detecting the methylation state of the target gene further comprises:
[0026] a blocker that preferentially binds to the target sequence in the unmethylated state.
[0027] 12. The composition according to item 11, wherein,
[0028] the fragment of at least 9 nucleotides is the sequence of SEQ ID NO: 25 and SEQ ID NO: 26, or the sequence of SEQ ID NO: 28 and SEQ ID NO: 29, or the sequence of SEQ ID NO: 31 and SEQ ID NO: 32, or the sequence of SEQ ID NO: 34 and SEQ ID NO: 35, or the sequence of SEQ ID NO: 37 and SEQ ID NO: 38, or the sequence of SEQ ID NO: 40 and SEQ ID NO: 41;
[0029] the fragment of at least 15 nucleotides is the sequence of SEQ ID NO: 27, or the sequence of SEQ ID NO: 30, or the sequence of SEQ ID NO: 33, or the sequence of SEQ ID NO: 36, or the sequence of SEQ ID NO: 39, or the sequence of SEQ ID NO: 42.
[0030] 13. An oligonucleotide for detecting liver cancer in vitro, comprising:
[0031] a fragment of at least 9 nucleotides in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0032] a fragment of at least 9 nucleotides in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0033] a fragment of at least 9 nucleotides in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0034] a fragment of at least 9 nucleotides from the SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0035] a fragment of at least 9 nucleotides from the SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0036] a fragment of at least 9 nucleotides from the SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the complement thereof and comprising at least one CpG dinucleotide sequence.
[0037] 14. The oligonucleotide according to item 13, further comprising:
[0038] a fragment of at least 15 nucleotides from the SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the complement thereof and comprising at least one CpG dinucleotide sequence, hybridizing under conditions of intermediate stringency or high stringency; and / or
[0039] a fragment of at least 15 nucleotides from the SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the complement thereof and comprising at least one CpG dinucleotide sequence, hybridizing under conditions of intermediate stringency or high stringency; and / or
[0040] a fragment of at least 15 nucleotides from the SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the complement thereof and comprising at least one CpG dinucleotide sequence, hybridizing under conditions of intermediate stringency or high stringency; and / or
[0041] a fragment of at least 15 nucleotides from the SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the complement thereof and comprising at least one CpG dinucleotide sequence, hybridizing under conditions of intermediate stringency or high stringency; and / or
[0042] a fragment of at least 15 nucleotides in the SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the complement thereof and comprising at least one CpG dinucleotide sequence, under conditions of medium stringency or high stringency; and / or
[0043] a fragment of at least 15 nucleotides in the SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the complement thereof and comprising at least one CpG dinucleotide sequence, under conditions of medium stringency or high stringency.
[0044] 15. The oligonucleotide according to item 14, further comprising:
[0045] a blocker that binds preferentially to the target sequence in the unmethylated state.
[0046] 16. An oligonucleotide for use in the in vitro detection of liver cancer, comprising:
[0047] the sequence of SEQ ID NO: 25 and SEQ ID NO: 26.
[0048] 17. The oligonucleotide according to item 16, further comprising:
[0049] the sequence of SEQ ID NO: 27.
[0050] 18. An oligonucleotide for use in the in vitro detection of liver cancer, comprising:
[0051] the sequence of SEQ ID NO: 28 and SEQ ID NO: 29.
[0052] 19. The oligonucleotide according to item 18, further comprising:
[0053] the sequence of SEQ ID NO: 30.
[0054] 20. An oligonucleotide for use in the in vitro detection of liver cancer, comprising:
[0055] the sequence of SEQ ID NO: 31 and SEQ ID NO: 32.
[0056] 21. The oligonucleotide according to item 20, further comprising:
[0057] the sequence of SEQ ID NO: 33.
[0058] 22. An oligonucleotide for use in the in vitro detection of liver cancer, comprising:
[0059] the sequence of SEQ ID NO: 34 and SEQ ID NO: 35.
[0060] 23. The oligonucleotide of item 22, further comprising:
[0061] the sequence of SEQ ID NO: 36.
[0062] 24. An oligonucleotide for use in detecting liver cancer in vitro, comprising:
[0063] the sequence of SEQ ID NO: 37 and SEQ ID NO: 38.
[0064] 25. The oligonucleotide of item 24, further comprising:
[0065] the sequence of SEQ ID NO: 39.
[0066] 26. An oligonucleotide for use in detecting liver cancer in vitro, comprising:
[0067] the sequence of SEQ ID NO: 40 and SEQ ID NO: 41.
[0068] 27. The oligonucleotide of item 26, further comprising:
[0069] the sequence of SEQ ID NO: 42.
[0070] 28. A kit comprising the composition of any one of items 1-12 or the oligonucleotide of any one of items 13-27.
[0071] 29. The kit of item 28, further comprising at least one additional component selected from the group consisting of:
[0072] nucleotides, a DNA polymerase, and a buffer required for the function of the DNA polymerase.
[0073] 30. The kit of item 28 or 29, wherein the sample for detection comprises a cell line, a histological section, a tissue biopsy / paraffin-embedded tissue, a body fluid, feces, colonic effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof.
[0074] 31. The kit of any one of items 28-30, further comprising an instruction manual.
[0075] 32. Use of the composition of any one of items 1-12 or the oligonucleotide of any one of items 13-27 for the manufacture of a kit for detecting liver cancer in vitro.
[0076] 33. The use according to item 32, wherein the kit for detecting liver cancer in vitro detects liver cancer by a method comprising the steps of:
[0077] 1) isolating a DNA sample including a target sequence of a target gene or a fragment thereof from a biological sample to be tested;
[0078] 2) determining the methylation state of the target sequence of the target gene;
[0079] 3) determining the state of the biological sample by the detection result of the methylation state of the target sequence of the target gene, thereby achieving in vitro detection of liver cancer.
[0080] 34. The use according to item 33, wherein the method comprises the steps of:
[0081] extracting genomic DNA from a biological sample to be tested;
[0082] treating the extracted genomic DNA with a reagent to convert 5 unmethylated cytosine bases to uracil or other bases;
[0083] contacting the DNA sample treated with the reagent with a DNA polymerase and primers for the target sequence of the target gene, and performing a DNA polymerization reaction;
[0084] detecting the amplification product with a probe; and
[0085] determining the methylation state of at least one CpG dinucleotide of the target sequence of the target gene based on the presence or absence of the amplification product.
[0086] 35. The use according to item 34, wherein the reagent is a bisulfite reagent.
[0087] 36. A method of detecting liver cancer, comprising the steps of:
[0088] isolating a DNA sample including a target sequence of a target gene or a fragment thereof from a biological sample to be tested;
[0089] determining the methylation state of the target sequence of the target gene; and
[0090] determining the state of the biological sample by the detection result of the methylation state of the target sequence of the target gene, thereby achieving in vitro detection of liver cancer.
[0091] 37. A method of detecting liver cancer, comprising the steps of:
[0092] extracting genomic DNA from a biological sample to be tested;
[0093] treating the extracted genomic DNA with a reagent to convert 5 unmethylated cytosine bases to uracil or other bases;
[0094] contacting the reagent-treated DNA sample with a DNA polymerase and primers for the target sequence of the target gene, and performing a DNA polymerization reaction;
[0095] detecting the amplified product with a probe; and
[0096] determining the methylation state of at least one CpG dinucleotide of the target sequence of the target gene based on whether the amplified product is present or not.
[0097] 38. The method according to item 36 or 37, wherein,
[0098] the target gene is one or two or more of RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene, and VASH2 gene.
[0099] 39. The method according to item 38, wherein the target sequence of the RNF135 gene is as set forth in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4.
[0100] 40. The method according to item 38, wherein the target sequence of the CHFR gene is as set forth in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8.
[0101] 41. The method according to item 38, wherein the target sequence of the SPINT2 gene is as set forth in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12.
[0102] 42. The method according to item 38, wherein the target sequence of the SPDYA gene is as set forth in SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16.
[0103] 43. The method according to item 38, wherein the target sequence of the PAX5 gene is as set forth in SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20.
[0104] 44. The method of item 38, wherein the target sequence of the VASH2 gene is set forth in SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24.
[0105] 45. The method of item 37, wherein the reagent is a bisulfite reagent.
[0106] 46. The method of item 37, wherein the primer is:
[0107] a fragment of at least 9 nucleotides of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or a complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0108] a fragment of at least 9 nucleotides of SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or a complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0109] a fragment of at least 9 nucleotides of SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or a complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0110] a fragment of at least 9 nucleotides of SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or a complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0111] a fragment of at least 9 nucleotides of SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or a complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0112] a fragment of at least 9 nucleotides of SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or a complement thereof and comprising at least one CpG dinucleotide sequence.
[0113] 47. The method of item 37, wherein the probe is:
[0114] a fragment of at least 15 nucleotides in the SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0115] a fragment of at least 15 nucleotides in the SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0116] a fragment of at least 15 nucleotides in the SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0117] a fragment of at least 15 nucleotides in the SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0118] a fragment of at least 15 nucleotides in the SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or
[0119] a fragment of at least 15 nucleotides in the SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the complement thereof and comprising at least one CpG dinucleotide sequence.
[0120] 48. The method of item 46, wherein the primers are the sequences of SEQ ID NO: 25 and SEQ ID NO: 26, or the sequences of SEQ ID NO: 28 and SEQ ID NO: 29, or the sequences of SEQ ID NO: 31 and SEQ ID NO: 32, or the sequences of SEQ ID NO: 34 and SEQ ID NO: 35, or the sequences of SEQ ID NO: 37 and SEQ ID NO: 38, or the sequences of SEQ ID NO: 40 and SEQ ID NO: 41.
[0121] 49. The method of item 47, wherein the probe is a sequence of SEQ ID NO: 27, or a sequence of SEQ ID NO: 30, or a sequence of SEQ ID NO: 33, or a sequence of SEQ ID NO: 36, or a sequence of SEQ ID NO: 39, or a sequence of SEQ ID NO: 42.
[0122] The present application has the following beneficial effects:
[0123] The present application screens 6 markers capable of sensitively and specifically detecting liver cancer, and determines the methylation region of the related markers. By detecting the target sequence of the methylation genes of RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene and VASH2 gene, the methylation state of the genes can be sensitively and specifically detected, so as to be used for the detection of peripheral blood free DNA. Through the detection of peripheral blood samples of liver cancer patients and normal control individuals, it is shown that the composition and detection method described in the present application can sensitively and specifically detect liver cancer, so as to ensure the correctness and reliability of the detection results. Therefore, the present application provides a composition, kit and detection method for detecting liver cancer in vitro, which can conveniently, quickly and effectively detect liver cancer, and has important clinical application value.
[0124] Other features and advantages of the present application will be described in detail by the following specific description and claims.
[0125] Effects of the invention
[0126] The present application uses epigenome and bioinformatics technology, finds a plurality of methylation genes related to liver cancer by analyzing the genomic methylation data of liver cancer, and determines the target sequence of the methylation abnormality of liver cancer methylation gene. And through the target sequence of this methylation gene, the methylation state of the gene can be sensitively and specifically detected, so as to be used for the detection of peripheral blood free DNA.
[0127] The composition described in the present application is used for screening of asymptomatic population in a non-invasive manner, reduces the harm caused by invasive detection, and has higher sensitivity and accuracy, so that real-time monitoring can be realized. DETAILED DESCRIPTION
[0128] The present application will be described in detail below. Although specific embodiments of the present application are shown, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to enable a more thorough understanding of the present application and to fully convey the scope of the present application to those skilled in the art.
[0129] The practice of the present application will employ, unless otherwise indicated, conventional molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and genetic techniques within the skill of the art. Such techniques are explained fully in the literature, such as, Molecular Cloning: A Laboratory Manual, second edition (Sambrook et al., 1989); Oligonucleotide Synthesis (M. J. Gait, 1984); Animal Cell Culture (R. I. Freshney, 1987); the Methods in Enzymology series (Academic Press, Inc.); Current Protocols in Molecular Biology (F. M. Ausubel et al., 1987, and periodic updates); PCR: The Polymerase Chain Reaction (Mullis et al., 1994). Primers, probes, blockers and kits used in the present application can be prepared using standard techniques known in the art.
[0130] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
[0131] Definitions
[0132] "Pre-cancerous" as used herein refers to a cell that is in an early stage of transformation into a cancer cell or that is predisposed to transform into a cancer cell. Such a cell can exhibit one or more phenotypic traits characteristic of a cancer cell.
[0133] "Stringent hybridization conditions" and "high stringency" in the present application refer to conditions under which a probe will hybridize to its target subsequence, typically in a complex mixture of nucleic acids. Stringent conditions are sequence dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids can be found in Tijssen, Techniques in Biochemistry and Molecular Biology - Hybridization of Nucleic Acids, "Overview of principles of hybridization and the strategy of nucleic acid assays using hybridization." Typically, stringency conditions will be those which allow binding of the probe to its target sequence in the presence of a defined ionic strength at a defined pH, and at temperatures of less than about 5-10°C below the melting point (Tm) of the specific nucleic acid. At Tm, 50% of the probe will hybridize to the target sequence. Stringent conditions can also be achieved with the addition of destabilizing agents, such as formamide. For selective or specific hybridization, a positive signal is at least twice the background hybridization, preferably 10 times the background hybridization. Exemplary stringency hybridization conditions are as follows: hybridization in 50% formamide, 5x SSC and 1% SDS at 42°C, or hybridization in 5x SSC and 1% SDS at 65°C, followed by washing in 0.2x SSC and 0.1% SDS at 65°C.
[0134] Also, nucleic acids encoding polypeptides that are substantially similar can still be substantially similar even if they do not hybridize under stringent conditions. In this case, typically, the nucleic acids are hybridized under moderately stringent hybridization conditions. Exemplary "moderately stringent hybridization conditions" include hybridization in a solution of 40% formamide, 1 M NaCl and 1% SDS at 37°C, and washing in a solution of 1 x SSC at 45°C. Guidance for obtaining conditions which achieve the same stringency can be found in the art for the conditions. For PCR, temperatures of around 36°C are typically used for low stringency amplification, while annealing temperatures range from 32°C to 48°C depending on the length of the primers. For high stringency PCR amplification, 62°C is typical, while annealing temperatures for high stringency hybridization range from 50°C to 65°C depending on the length and specificity of the primers. Cycling conditions for high stringency and low stringency amplification typically include: denaturation at 90-95°C for 30 seconds to 2 minutes, annealing for 30 seconds to 2 minutes, and extension at about 72°C for 1 to 2 minutes. Tools and guidance for low and high stringency amplification reactions can be found in the art.
[0135] An "oligonucleotide" in the present application refers to a molecule composed of two or more nucleotides, preferably three or more nucleotides, the precise size of which can depend on a number of factors, which in turn are determined by the ultimate function and use of the oligonucleotide. In certain embodiments, an oligonucleotide can include a length of 10 nucleotides to 100 nucleotides. In certain embodiments, an oligonucleotide can include a length of 10 nucleotides to 30 nucleotides, or can have a length of 20 and 25 nucleotides. In some particular embodiments, oligonucleotides shorter than these lengths are also suitable.
[0136] A "primer" in the present application refers to an oligonucleotide, whether occurring in nature or synthesized, which, when placed under conditions in which synthesis of a primer extension product in which it is complementary to a nucleic acid strand is induced, i.e., in the presence of nucleotides and an agent, such as a DNA or RNA polymerase, and at an appropriate temperature and pH, is capable of acting as a point of initiation of synthesis. The primer can be either single-stranded or double-stranded, and must be sufficiently long to prime the synthesis of the desired extension product in the presence of the inducing agent. The precise length of the primer will depend on many factors, including temperature, source of primer and method used. For diagnostic and prognostic applications, for example, oligonucleotide primers typically contain at least or more than about 9, 10, or 15, or 20, or 25 or more nucleotides, depending on the complexity of the target sequence, although they can contain fewer or more nucleotides. Factors involved in determining the appropriate length of a primer are well known to those skilled in the art.
[0137] A "primer pair" in the present application refers to a pair of primers that hybridize to opposite strands of a target DNA molecule or to regions flanking a target DNA region to which nucleotide sequences are to be amplified.
[0138] A "primer site" in the present application refers to the region of a target DNA or other nucleic acid to which a primer hybridizes.
[0139] A "probe", when referring to a nucleic acid sequence, is used in its conventional sense to refer to a selected nucleic acid sequence that hybridizes to a target sequence under specified conditions and can be used to detect the presence of that target sequence. Those skilled in the art will appreciate that in some instances a probe can also be used as a primer, and a primer can be used as a probe.
[0140] "DNA methylation" of the present application refers to the addition of a methyl group to the 5 position of a cytosine (C), which is typically (but not necessarily) in the context of a CpG (cytosine followed by guanine) dinucleotide. "Increased methylation" or "significant methylation" as used herein refers to the presence of at least one methylated cytosine nucleotide in a DNA sequence, where the corresponding C in a normal control sample (e.g., a DNA sample extracted from a non-cancerous cell or tissue sample or a DNA sample treated for methylation of DNA residues) is unmethylated, and in certain embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, 10 or more C's can be methylated, where the C's at these positions in the control DNA sample are unmethylated.
[0141] In embodiments, a variety of different methods can be used to detect DNA methylation alterations. Methods for detecting DNA methylation include, for example, methylation sensitive restriction endonuclease (MSRE) assays using southern or polymerase chain reaction (PCR) analysis, methylation specific or methylation sensitive PCR (MS-PCR), methylation sensitive single nucleotide primer extension (Ms-SnuPE), high resolution melting (HRM) analysis, bisulfite sequencing, pyrosequencing, methylation specific single strand conformation analysis (MS-SSCA), combined bisulfite restriction analysis (COBRA), methylation specific denaturing gradient gel electrophoresis (MS-DGGE), methylation specific melting curve analysis (MS-MCA), methylation specific denaturing high performance liquid chromatography (MS-DHPLC), methylation specific oligo (MSO). These assays can be PCR based, quantitative using fluorescent labels, or southern blotting based.
[0142] "Methylation assay" of the present application refers to any assay that determines the methylation status of one or more CpG dinucleotide sequences within a DNA sequence.
[0143] "Detecting" of the present application means any process of observing a marker or a change in a marker (e.g., a change in the methylation status of a marker or the expression level of a nucleic acid or protein sequence) in a biological sample, whether or not the marker or change in the marker is actually detected. In other words, the act of probing a sample for a marker or change in a marker is "detecting," even if the marker is determined to be absent or below the level of sensitivity. Detection can be quantitative, semi-quantitative, or non-quantitative observation, and can be based on comparison to one or more control samples. It will be appreciated that detecting a liver cancer includes detecting precancerous cells that are beginning to develop into or will develop into liver cancer cells, or have an increased propensity to develop into liver cancer cells. Detecting a liver cancer can also include detecting a possible mortality probability or a possible prognosis of a disease condition.
[0144] "Identity" and "similarity" in the context of the present application refer to sequence similarity between two nucleic acid molecules. "Identity" or "similarity" can be measured by comparing the positions in each sequence that are aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base, then the molecules are identical at that position. When the same or a similar amino acid (e.g., similar in steric properties or charge properties) occupies a position in the compared sequences, the molecules can be referred to as homologous (similar) at that position. Expression as a percentage of homology / similarity or identity refers to the number of identical or similar amino acids at positions shared by the compared sequences as a function of the number of positions in the compared sequences. "Unrelated" or "nonhomologous" sequences share less than 40% identity, preferably less than 25% identity, with the sequences of the present application. In comparing two sequences, the presence of gaps or the presence of extra residues in one sequence relative to the other sequence also decreases the identity and homology / similarity. In specific embodiments, two or more sequences or subsequences are substantially or significantly homologous, similar or identical when, according to determination using the BLAST or BLAST 2.0 sequence comparison algorithms with default parameters described below, or by manual alignment and visual inspection, as provided on-line by the National Center for Biotechnology Information (NCBI), they share about 60% identity, or about 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more identity in a comparison window, or designated region, when compared and aligned for maximum correspondence over the comparison window or designated region. The definition also relates to or can be used to test the complement of a sequence. Thus, in contexts where the degree of identity allows, e.g., if a nucleotide sequence can be predicted to occur naturally in a DNA duplex, or can occur naturally as one or both of the complementary strands, a nucleotide sequence complementary to a specified target sequence or variant thereof is itself considered "similar" to the target sequence, and when reference is made to "similar" nucleic acid sequences, includes single-stranded sequences, their complements, duplexed strands, sequences capable of encoding the same or similar polypeptide products, and any permissible variants of any of the foregoing. Cases where similarity must be limited to analysis of a single nucleic acid strand sequence can include, e.g., detection and quantitation of expression of a particular RNA sequence or coding sequence in a cell. The definition also includes sequences with deletions and / or additions that result in the deletion or addition of a single amino acid.In embodiments, the identity or similarity can be over a region of at least about 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 10, 21, 22, 23, 24, 25, or more nucleotides in length, or over a region of more than about 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or more than about 100 nucleotides in length.
[0145] "Amplification" as used herein refers to the process of obtaining multiple copies of a particular locus of nucleic acid, such as genomic DNA or cDNA. Amplification can be achieved using any of a variety of known means, including but not limited to polymerase chain reaction (PCR), transcription-based amplification, and strand displacement amplification (SDA).
[0146] "Fluorescence-based real-time PCR" as used herein refers to a method in which a fluorescent moiety is added to the PCR reaction mixture, the entire PCR process is monitored in real time using the accumulation of fluorescence signal, and unknown templates are quantified by standard curves at the end of the PCR. In this PCR technique, there is an important concept, cycle threshold, also called Ct value. C stands for Cycle, t stands for threshold, and the meaning of Ct value is: the cycle number when the fluorescence signal in each reaction tube reaches the set threshold. For example, the method of setting the fluorescence threshold is as follows: the fluorescence signal of the first 15 cycles of PCR reaction is taken as the fluorescence background signal, and the default setting of the fluorescence threshold is 10 times the standard deviation of the fluorescence signal of 3-15 cycles.
[0147] "Cut off value" of real-time PCR as used herein refers to a critical Ct value for judging the sample as positive or negative for a certain biomarker. According to certain specific real-time methods of the present application, "the critical Ct value (Cut Off value) is obtained based on statistical processing according to a certain amount of sample data", and the critical Ct value can be different according to the required sensitivity or specificity requirements.
[0148] "Sensitivity" as used herein refers to the proportion of cancer detected from a certain cancer sample, and the calculation formula is: Sensitivity = (cancer detected / all cancer), and "specificity" refers to the proportion of normal detected from a certain normal sample, and the calculation formula is: Specificity = (negative detected / total negative).
[0149] A "label" or "detectable moiety" of the present application is a component that can be detected by spectroscopic, photochemical, biochemical, immunochemical, chemical or other physical means. For example, useful labels include32P, fluorescent dyes, electron-dense reagents, enzymes (for example, as commonly used in an ELISA), biotin, digoxigenin or haptens and can be made detectable by incorporating radiolabels into peptides or by using antibodies that are specifically reactive with the peptides.
[0150] A variety of different methods can be used to detect nucleic acid molecules. Nucleic acid detection methods include, for example, PCR and nucleic acid hybridization (e.g., Southern blot, Northern blot, or in situ hybridization). In particular, oligonucleotides (e.g., oligonucleotide primers) capable of amplifying a target nucleic acid can be used in a PCR reaction. PCR methods generally include the steps of obtaining a sample, isolating nucleic acid (e.g., DNA, RNA, or both) from the sample, and contacting the nucleic acid with one or more oligonucleotide primers that specifically hybridize to the template nucleic acid under conditions that allow amplification of the template nucleic acid to occur. In the presence of the template nucleic acid, an amplification product is produced. Conditions for nucleic acid amplification and detection of amplification products are known to those of skill in the art. A variety of modifications to basic PCR technology have been developed, including, but not limited to, anchor PCR, RACE PCR, RT-PCR, and ligase chain reaction (LCR). Primer pairs in amplification reactions must anneal to opposite strands of the template nucleic acid and should be held at an appropriate distance from one another so that a polymerase can efficiently polymerize across the region and so that the amplification product can be readily detected, e.g., using electrophoresis. For example, computer programs such as OLIGO (Molecular Biology Insights Inc., Cascade, Colo.) can be used to design oligonucleotide primers to aid in the design of primers with similar melting temperatures. Typically, oligonucleotide primers are 9-30 or 40 or 50 nucleotides in length (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length), although oligonucleotide primers can be longer or shorter, provided that appropriate amplification conditions are used.
[0151] Detection of amplification products or hybridization complexes is typically accomplished using a detectable label. The term "label", when referring to a nucleic acid, is intended to include direct labeling of a nucleic acid by coupling (i.e., physically linking) a detectable substance to the nucleic acid, as well as indirect labeling of the nucleic acid by reactivity with another reagent that is directly labeled with a detectable substance. Detectable substances include various enzymes, prosthetic groups, fluorescent materials, luminescent materials, bioluminescent materials, and radioactive materials. Examples of suitable enzymes include horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase; examples of suitable prosthetic groups include streptavidin / biotin and avidin / biotin; examples of suitable fluorescent materials include umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; examples of luminescent materials include luminol; examples of bioluminescent materials include luciferase, luciferin, and aequorin. An example of indirect labeling includes terminal labeling of a nucleic acid with biotin so that it can be detected with fluorescently labeled streptavidin.
[0152] SUMMARY
[0153] In one aspect, the present application provides a composition for detecting liver cancer in vitro, the composition comprising a nucleic acid for detecting methylation status within a target sequence of a target gene, wherein the target gene methylation status is characterized by methylation of the target sequence of the target gene, and wherein the target gene is one or more of CRNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene, and VASH2 gene.
[0154] The application provides a group of target sequences of target genes abnormally methylated in liver cancer, including target sequences of one or more than two of RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene and VASH2 gene, the target sequence of the RNF135 gene is as shown in any one of SEQ ID NO: 1-4 or comprises the sequence as shown in any one of SEQ ID NO: 1-4, the target sequence of the CHFR gene is as shown in any one of SEQ ID NO: 5-8 or comprises the sequence as shown in any one of SEQ ID NO: 5-8, the target sequence of the SPINT2 gene is as shown in any one of SEQ ID NO: 9-12 or comprises the sequence as shown in any one of SEQ ID NO: 9-12, the target sequence of the SPDYA gene is as shown in any one of SEQ ID NO: 13-16 or comprises the sequence as shown in any one of SEQ ID NO: 13-16, the target sequence of the PAX5 gene is as shown in any one of SEQ ID NO: 17-20 or comprises the sequence as shown in any one of SEQ ID NO: 17-20, and the target sequence of the VASH2 gene is as shown in any one of SEQ ID NO: 21-24 or comprises the sequence as shown in any one of SEQ ID NO: 21-24.
[0155] It is also understood by those skilled in the art that the target sequences of the RNF135 gene, the CHFR gene, the SPINT2 gene, the SPDYA gene, the PAX5 gene and the VASH2 gene are not limited to the specific sequences listed above. The target sequences of the RNF135 gene should cover the sequences comprising one or two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 1-4, but substantially still the same in essential function, also cover the sequences having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 1-4, also cover the sequences having 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 1-4 on the basis of deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides from the nucleotide sequence shown in any one of SEQ ID NOs: 1-4. The target sequences of the CHFR gene should cover the sequences comprising one or two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 5-8, but substantially still the same in essential function, also cover the sequences having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 5-8, also cover the sequences having 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 5-8 on the basis of deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides from the nucleotide sequence shown in any one of SEQ ID NOs: 5-8. The target sequences of the SPINT2 gene should cover the sequences comprising one or two or three or more nucleotide mutations compared to the sequence shown in any one of SEQ ID NOs: 9-12, but substantially still the same in essential function, also cover the sequences having 95%, 96%, 97%, 98% or 99% sequence identity compared to the sequence shown in any one of SEQ ID NOs: 9-12, also cover the sequences having 90%, 91%, 92%, 93%, 94%, 95% or 96% or 97% or 98% or 99% identity to the nucleotide sequence shown in any one of SEQ ID NOs: 9-12 on the basis of deleting one or more nucleotides, adding one or more nucleotides, or replacing one or more nucleotides from the nucleotide sequence shown in any one of SEQ ID NOs: 9-12.Target sequences for the SPDYA gene should encompass a sequence comprising one or two or three or more nucleotide mutations compared to the sequence set forth in any one of SEQ ID NOs: 13-16, but which is substantially functionally equivalent thereto, also encompassing a sequence having 95%, 96%, 97%, 98%, or 99% sequence identity compared to the sequence set forth in any one of SEQ ID NOs: 13-16, also encompassing a sequence which deletes one or more nucleotides, adds one or more nucleotides, or substitutes one or more nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 13-16, but which has 90%, 91%, 92%, 93%, 94%, 95%, or 96% or 97% or 98% or 99% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 13-16. Target sequences for the PAX5 gene should encompass a sequence comprising one or two or three or more nucleotide mutations compared to the sequence set forth in any one of SEQ ID NOs: 17-20, but which is substantially functionally equivalent thereto, also encompassing a sequence having 95%, 96%, 97%, 98%, or 99% sequence identity compared to the sequence set forth in any one of SEQ ID NOs: 17-20, also encompassing a sequence which deletes one or more nucleotides, adds one or more nucleotides, or substitutes one or more nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 17-20, but which has 90%, 91%, 92%, 93%, 94%, 95%, or 96% or 97% or 98% or 99% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 17-20. Target sequences for the VASH2 gene should encompass a sequence comprising one or two or three or more nucleotide mutations compared to the sequence set forth in any one of SEQ ID NOs: 21-24, but which is substantially functionally equivalent thereto, also encompassing a sequence having 95%, 96%, 97%, 98%, or 99% sequence identity compared to the sequence set forth in any one of SEQ ID NOs: 21-24, also encompassing a sequence which deletes one or more nucleotides, adds one or more nucleotides, or substitutes one or more nucleotides from the nucleotide sequence set forth in any one of SEQ ID NOs: 21-24, but which has 90%, 91%, 92%, 93%, 94%, 95%, or 96% or 97% or 98% or 99% identity to the nucleotide sequence set forth in any one of SEQ ID NOs: 21-24.
[0156] Target sequences for the RNF135 gene (5'-3') are as follows:
[0157] TGGTTTCCCAGGGCAAGAGGCCGCCACTGAAGGTCAGCTCTGTCTTTCCAGCTGGGCACTGGAGGCTCTAAGTCTGTTTTCAGCAGGATCGGAGGAAGGAGACGGGGTGGCGCCAAGGAAGGAGGAGAAAAGGCGGCCGAGAAAAGGAGGAGGGCAAGGGGAAGAGGAAGGGCGAGGGAGGAGCCTGAGGAGACTCGCCCGGCTCAACCCCGACGTCCGCGCCCCGGCCGCCTGTTGGCCATGGCGGGCCTGGGCCTGGGCTCCGCCGTTCCCGTGTGGCTGGCCGAGGACGACCTCGGCTGCATCATCTGCCAGGGGCTGCTGGACTGGCCCGCCACGCTGCCCTGCGGCCACAGCTTCTGCCGCCACTGCCTGGAGGCCCTGTGGGGCGCCCGCGACGCCCGCCGCTGGGCCTGCCCCACTTGCCGCCAGGGCGCCGCGCAGCAGCCGCACCTGCGGAAGAACACGCTACTGCAGGACCTGGCCGACAAGTACCGCCGCGCCGCACGCGAGATACAGGCGGGCTCCGACCCTGCCCACTGCCCCTGCCCGGGCTCCAGTTCCCTCTCCAGCG (SEQ ID NO: 1)
[0158] The sequence of the target sequence of the RNF135 gene after bisulfite treatment (5’-3’) is as follows:
[0159] TGGTTTTTTAGGGTAAGAGGTCGTTATTGAAGGTTAGTTTTGTTTTTTTAGTTGGGTATTGGAGGTTTTAAGTTTGTTTTTAGTAGGATCGGAGGAAGGAGACGGGGTGGCGTTAAGGAAGGAGGAGAAAAGGCGGTCGAGAAAAGGAGGAGGGTAAGGGGAAGAGGAAGGGCGAGGGAGGAGTTTGAGGAGATTCGTTCGGTTTAATTTCGACGTTCGCGTTTCGGTCGTTTGTTGGTTATGGCGGGTTTGGGTTTGGGTTTCGTCGTTTTCGTGTGGTTGGTCGAGGACGATTTCGGTTGTATTATTTGTTAGGGGTTGTTGGATTGGTTCGTTACGTTGTTTTGCGGTTATAGTTTTTGTCGTTATTGTTTGGAGGTTTTGTGGGGCGTTCGCGACGTTCGTCGTTGGGTTTGTTTTATTTGTCGTTAGGGCGTCGCGTAGTAGTCGTATTTGCGGAAGAATACGTTATTGTAGGATTTGGTCGATAAGTATCGTCGCGTCGTACGCGAGATATAGGCGGGTTTCGATTTTGTTTATTGTTTTTGTTCGGGTTTTAGTTTTTTTTTTAGCG (SEQ ID NO: 2)
[0160] The complement of the target sequence of the RNF135 gene (5’-3’) is as follows:
[0161] CGCTGGAGAGGGAACTGGAGCCCGGGCAGGGGCAGTGGGCAGGGTCGGAGCCCGCCTGTATCTCGCGTGCGGCGCGGCGGTACTTGTCGGCCAGGTCCTGCAGTAGCGTGTTCTTCCGCAGGTGCGGCTGCTGCGCGGCGCCCTGGCGGCAAGTGGGGCAGGCCCAGCGGCGGGCGTCGCGGGCGCCCCACAGGGCCTCCAGGCAGTGGCGGCAGAAGCTGTGGCCGCAGGGCAGCGTGGCGGGCCAGTCCAGCAGCCCCTGGCAGATGATGCAGCCGAGGTCGTCCTCGGCCAGCCACACGGGAACGGCGGAGCCCAGGCCCAGGCCCGCCATGGCCAACAGGCGGCCGGGGCGCGGACGTCGGGGTTGAGCCGGGCGAGTCTCCTCAGGCTCCTCCCTCGCCCTTCCTCTTCCCCTTGCCCTCCTCCTTTTCTCGGCCGCCTTTTCTCCTCCTTCCTTGGCGCCACCCCGTCTCCTTCCTCCGATCCTGCTGAAAACAGACTTAGAGCCTCCAGTGCCCAGCTGGAAAGACAGAGCTGACCTTCAGTGGCGGCCTCTTGCCCTGGGAAACCA (SEQ ID NO: 3)
[0162] The sequence of the complementary sequence of the target sequence of the RNF135 gene after bisulfite treatment (5'-3') is as follows:
[0163] CGTTGGAGAGGGAATTGGAGTTCGGGTAGGGGTAGTGGGTAGGGTCGGAGTTCGTTTGTATTTCGCGTGCGGCGCGGCGGTATTTGTCGGTTAGGTTTTGTAGTAGCGTGTTTTTTCGTAGGTGCGGTTGTTGCGCGGCGTTTTGGCGGTAAGTGGGGTAGGTTTAGCGGCGGGCGTCGCGGGCGTTTTATAGGGTTTTTAGGTAGTGGCGGTAGAAGTTGTGGTCGTAGGGTAGCGTGGCGGGTTAGTTTAGTAGTTTTTGGTAGATGATGTAGTCGAGGTCGTTTTCGGTTAGTTATACGGGAACGGCGGAGTTTAGGTTTAGGTTCGTTATGGTTAATAGGCGGTCGGGGCGCGGACGTCGGGGTTGAGTCGGGCGAGTTTTTTTAGGTTTTTTTTTCGTTTTTTTTTTTTTTTTTGTTTTTTTTTTTTTTTCGGTCGTTTTTTTTTTTTTTTTTGGCGTTATTTCGTTTTTTTTTTTCGATTTTGTTGAAAATAGATTTAGAGTTTTTAGTGTTTAGTTGGAAAGATAGAGTTGATTTTTAGTGGCGGTTTTTTGTTTTGGGAAATTA (SEQ ID NO:4)
[0164] The target sequence of the CHFR gene (5'-3') is as follows:
[0165] AGAGGGGCGGGTCGGGGCGGAGAGCCGCGCCCAAAGGCAATGGGAGCCGCACGCTGCTAGGCAACATGCTGTCTCCCGGCAACGTAGAGGCGGGGAATTCGCCAACGTGTCTGAAACAGACAACAATTTTAGCCAACGGCTGCGTGGGCCTTGGGCGTCCTGGCCAATGGGAATAGTGAGGGGCCTGTCACTAAGAAACCTGTCCCTGAGCAACGCATAGGAGGGGTGGAACCCAGCAGCGCTGACTGAGCCGCCGCGAAGTGCCGGAACGTATTACCTGGGAGCCAAATTTCAGAGCGTCGTTTGTCTTCCCAAGCCCACCAGCTTTCAGCGTTCTCCAGCCTCGCCACACCCCCGCCTCGGGCCGTCCCCGCCCAGACGCTTGTCCCCGCGAGAAGCTGAGCGCACTGAAGTGAGCCCGGCGGCTGCCGCCGGAGGAGGAGCCCGGCTCTGGACACGGCCGTCA (SEQ ID NO: 5)
[0166] The sequence of the target sequence of the CHFR gene after bisulfite treatment (5'-3') is as follows:
[0167] AGAGGGGCGGGTCGGGGCGGAGAGTCGCGTTTAAAGGTAATGGGAGTCGTACGTTGTTAGGTAATATGTTGTTTTTCGGTAACGTAGAGGCGGGGAATTCGTTAACGTGTTTGAAATAGATAATAATTTTAGTTAACGGTTGCGTGGGTTTTGGGCGTTTTGGTTAATGGGAATAGTGAGGGGTTTGTTATTAAGAAATTTGTTTTTGAGTAACGTATAGGAGGGGTGGAATTTAGTAGCGTTGATTGAGTCGTCGCGAAGTGTCGGAACGTATTATTTGGGAGTTAAATTTTAGAGCGTCGTTTGTTTTTTTAAGTTTATTAGTTTTTAGCGTTTTTTAGTTTCGTTATATTTTCGTTTCGGGTCGTTTTCGTTTAGACGTTTGTTTTCGCGAGAAGTTGAGCGTATTGAAGTGAGTTCGGCGGTTGTCGTCGGAGGAGGAGTTCGGTTTTGGATACGGTCGTTA (SEQ ID NO: 6)
[0168] The complement of the target sequence of the CHFR gene (5'-3') is as follows:
[0169] TGACGGCCGTGTCCAGAGCCGGGCTCCTCCTCCGGCGGCAGCCGCCGGGCTCACTTCAGTGCGCTCAGCTTCTCGCGGGGACAAGCGTCTGGGCGGGGACGGCCCGAGGCGGGGGTGTGGCGAGGCTGGAGAACGCTGAAAGCTGGTGGGCTTGGGAAGACAAACGACGCTCTGAAATTTGGCTCCCAGGTAATACGTTCCGGCACTTCGCGGCGGCTCAGTCAGCGCTGCTGGGTTCCACCCCTCCTATGCGTTGCTCAGGGACAGGTTTCTTAGTGACAGGCCCCTCACTATTCCCATTGGCCAGGACGCCCAAGGCCCACGCAGCCGTTGGCTAAAATTGTTGTCTGTTTCAGACACGTTGGCGAATTCCCCGCCTCTACGTTGCCGGGAGACAGCATGTTGCCTAGCAGCGTGCGGCTCCCATTGCCTTTGGGCGCGGCTCTCCGCCCCGACCCGCCCCTCT (SEQ ID NO: 7)
[0170] The sequence of the complementary sequence of the target sequence of the CHFR gene after bisulfite treatment (5'-3') is as follows:
[0171] TGACGGTCGTGTTTAGAGTCGGGTTTTTTTTTCGGCGGTAGTCGTCGGGTTTATTTTAGTGCGTTTAGTTTTTCGCGGGGATAAGCGTTTGGGCGGGGACGGTTCGAGGCGGGGGTGTGGCGAGGTTGGAGAACGTTGAAAGTTGGTGGGTTTGGGAAGATAAACGACGTTTTGAAATTTGGTTTTTAGGTAATACGTTTCGGTATTTCGCGGCGGTTTAGTTAGCGTTGTTGGGTTTTATTTTTTTTATGCGTTGTTTAGGGATAGGTTTTTTAGTGATAGGTTTTTTATTATTTTTATTGGTTAGGACGTTTAAGGTTTACGTAGTCGTTGGTTAAAATTGTTGTTTGTTTTAGATACGTTGGCGAATTTTTCGTTTTTACGTTGTCGGGAGATAGTATGTTGTTTAGTAGCGTGCGGTTTTTATTGTTTTTGGGCGCGGTTTTTCGTTTCGATTCGTTTTTTT (SEQ ID NO: 8)
[0172] The target sequence of the SPINT2 gene (5'-3') is as follows:
[0173] CGCCCCGCCCCGCCAGGTTCTGTTGGGGGCGAGGCCCGCGCAAGCCCCGCCTCTTCCCCGGCACCAGGGGCGGGCCCAGGTGCGCCCAGGGCCGGGGAGCGGCCGCGCAGGTGCCTGCCCTTTGCGCCTGCGCCCAGCTCGCCCTGCCTAGCCAGGTGCGCCCCGCCCCCTGCCTGCCCGGCCACCTTCGGGAGCCGCTTCCAATAGGCGTTCGCCATTGGCTCTGGCGACCTCCGCGCGTTGGGAGGTGTAGCGCGGCTCTGAACGCGCTGAGGGCCGTTGAGTGTCGCAGGCGGCGAGGGCGCGAGTGAGGAGCAGACCCAGGCATCGCGCGCCGAGAAGGCCGGGCGTCCCCACACTGAAGGTCCGGAAAGGCGACTTCCGGGGGCTTTGGCACCTGGCGGACCCTCCCGGAGCGTCGGCACCTGAACGCGAGGCGCTCCATTGCGCGTGCGCGTTGAGGGGCT (SEQ ID NO: 9)
[0174] The sequence of the target sequence of the SPINT2 gene after bisulfite treatment (5' - 3') is as follows:
[0175] CGTTTCGTTTCGTTAGGTTTTGTTGGGGGCGAGGTTCGCGTAAGTTTCGTTTTTTTTTCGGTATTAGGGGCGGGTTTAGGTGCGTTTAGGGTCGGGGAGCGGTCGCGTAGGTGTTTGTTTTTTGCGTTTGCGTTTAGTTCGTTTTGTTTAGTTAGGTGCGTTTCGTTTTTTGTTTGTTCGGTTATTTTCGGGAGTCGTTTTTAATAGGCGTTCGTTATTGGTTTTGGCGATTTTCGCGCGTTGGGAGGTGTAGCGCGGTTTTGAACGCGTTGAGGGTCGTTGAGTGTCGTAGGCGGCGAGGGCGCGAGTGAGGAGTAGATTTAGGTATCGCGCGTCGAGAAGGTCGGGCGTTTTTATATTGAAGGTTCGGAAAGGCGATTTTCGGGGGTTTTGGTATTTGGCGGATTTTTTCGGAGCGTCGGTATTTGAACGCGAGGCGTTTTATTGCGCGTGCGCGTTGAGGGGTT (SEQ ID NO: 10)
[0176] The complement of the target sequence of the SPINT2 gene (5'-3') is as follows:
[0177] AGCCCCTCAACGCGCACGCGCAATGGAGCGCCTCGCGTTCAGGTGCCGACGCTCCGGGAGGGTCCGCCAGGTGCCAAAGCCCCCGGAAGTCGCCTTTCCGGACCTTCAGTGTGGGGACGCCCGGCCTTCTCGGCGCGCGATGCCTGGGTCTGCTCCTCACTCGCGCCCTCGCCGCCTGCGACACTCAACGGCCCTCAGCGCGTTCAGAGCCGCGCTACACCTCCCAACGCGCGGAGGTCGCCAGAGCCAATGGCGAACGCCTATTGGAAGCGGCTCCCGAAGGTGGCCGGGCAGGCAGGGGGCGGGGCGCACCTGGCTAGGCAGGGCGAGCTGGGCGCAGGCGCAAAGGGCAGGCACCTGCGCGGCCGCTCCCCGGCCCTGGGCGCACCTGGGCCCGCCCCTGGTGCCGGGGAAGAGGCGGGGCTTGCGCGGGCCTCGCCCCCAACAGAACCTGGCGGGGCGGGGCG (SEQ ID NO: 11)
[0178] The sequence of the complementary sequence of the target sequence of the SPINT2 gene after bisulfite treatment (5' - 3') is as follows:
[0179] AGTTTTTTAACGCGTACGCGTAATGGAGCGTTTCGCGTTTAGGTGTCGACGTTTCGGGAGGGTTCGTTAGGTGTTAAAGTTTTCGGAAGTCGTTTTTTCGGATTTTTAGTGTGGGGACGTTCGGTTTTTTCGGCGCGCGATGTTTGGGTTTGTTTTTTATTCGCGTTTTCGTCGTTTGCGATATTTAACGGTTTTTAGCGCGTTTAGAGTCGCGTTATATTTTTTAACGCGCGGAGGTCGTTAGAGTTAATGGCGAACGTTTATTGGAAGCGGTTTTCGAAGGTGGTCGGGTAGGTAGGGGGCGGGGCGTATTTGGTTAGGTAGGGCGAGTTGGGCGTAGGCGTAAAGGGTAGGTATTTGCGCGGTCGTTTTTCGGTTTTGGGCGTATTTGGGTTCGTTTTTGGTGTCGGGGAAGAGGCGGGGTTTGCGCGGGTTTCGTTTTTAATAGAATTTGGCGGGGCGGGGCG (SEQ ID NO: 12)
[0180] The target sequence of the SPDYA gene (5’-3’) is as follows:
[0181] AAGGGAAGTAAACGGCCCCAACGCAAGCCTGACTGCGAGACGTGCCCAAGGGAGGTAGGTCGAATGAAGAGGGTTGTGTGAGTTTTGCGCGGGCAGGCGGGATAACGGAGGAGGGAGGCCCGCGGCCGAGGCTCGGGCGGGCGGGGGGCAGGGAGGGGCGGGGTTCGCCGGCGCGCACTCCCAGGCAGGCCCCGCCCCCTCGGCCGGCTGTGCGCGCTGATTGGCCCCTGCCGGCCTCGCGCTCCCTCGCTCCGGGTTGGCGGGAGACCTTAGAGCGGGTACCGCTGCTGGCTAGCGACCGACGAGCAACCGTCTGAGGCCAGGAGCGCTGCGACGGAGCCTTGACCGCCGTTGCCCGGCCCTCTCCCGCGCAGCCCCGGGCTTCCGCAGGTACCTGTGCTCGCCCCCGGGAAGGGGCCTC (SEQ ID NO: 13)
[0182] The target sequence of the SPDYA gene after bisulfite treatment is as follows (5'-3'):
[0183] AAGGGAAGTAAACGGTTTTAACGTAAGTTTGATTGCGAGACGTGTTTAAGGGAGGTAGGTCGAATGAAGAGGGTTGTGTGAGTTTTGCGCGGGTAGGCGGGATAACGGAGGAGGGAGGTTCGCGGTCGAGGTTCGGGCGGGCGGGGGGTAGGGAGGGGCGGGGTTCGTCGGCGCGTATTTTTAGGTAGGTTTCGTTTTTTCGGTCGGTTGTGCGCGTTGATTGGTTTTTGTCGGTTTCGCGTTTTTTCGTTTCGGGTTGGCGGGAGATTTTAGAGCGGGTATCGTTGTTGGTTAGCGATCGACGAGTAATCGTTTGAGGTTAGGAGCGTTGCGACGGAGTTTTGATCGTCGTTGTTCGGTTTTTTTTCGCGTAGTTTCGGGTTTTCGTAGGTATTTGTGTTCGTTTTCGGGAAGGGGTTTT (SEQ ID NO: 14)
[0184] The complement of the target sequence of the SPDYA gene is as follows (5'-3'):
[0185] GAGGCCCCTTCCCGGGGGCGAGCACAGGTACCTGCGGAAGCCCGGGGCTGCGCGGGAGAGGGCCGGGCAACGGCGGTCAAGGCTCCGTCGCAGCGCTCCTGGCCTCAGACGGTTGCTCGTCGGTCGCTAGCCAGCAGCGGTACCCGCTCTAAGGTCTCCCGCCAACCCGGAGCGAGGGAGCGCGAGGCCGGCAGGGGCCAATCAGCGCGCACAGCCGGCCGAGGGGGCGGGGCCTGCCTGGGAGTGCGCGCCGGCGAACCCCGCCCCTCCCTGCCCCCCGCCCGCCCGAGCCTCGGCCGCGGGCCTCCCTCCTCCGTTATCCCGCCTGCCCGCGCAAAACTCACACAACCCTCTTCATTCGACCTACCTCCCTTGGGCACGTCTCGCAGTCAGGCTTGCGTTGGGGCCGTTTACTTCCCTT (SEQ ID NO: 15)
[0186] The sequence of the complementary sequence of the target sequence of the SPDYA gene after bisulfite treatment (5’-3’) is as follows:
[0187] GAGGCCCCTTCCCGGGGGCGAGCACAGGTACCTGCGGAAGCCCGGGGCTGCGCGGGAGAGGGCCGGGCAACGGCGGTCAAGGCTCCGTCGCAGCGCTCCTGGCCTCAGACGGTTGCTCGTCGGTCGCTAGCCAGCAGCGGTACCCGCTCTAAGGTCTCCCGCCAACCCGGAGCGAGGGAGCGCGAGGCCGGCAGGGGCCAATCAGCGCGCACAGCCGGCCGAGGGGGCGGGGCCTGCCTGGGAGTGCGCGCCGGCGAACCCCGCCCCTCCCTGCCCCCCGCCCGCCCGAGCCTCGGCCGCGGGCCTCCCTCCTCCGTTATCCCGCCTGCCCGCGCAAAACTCACACAACCCTCTTCATTCGACCTACCTCCCTTGGGCACGTCTCGCAGTCAGGCTTGCGTTGGGGCCGTTTACTTCCCTT (SEQ ID NO: 15)
[0188] The target sequence of the PAX5 gene (5'-3') is as follows:
[0189] TAATTCAAGCCTTCCGCTCCCCCGCCGAGCTGGGGTAGCTGATCACTGAGCTGAAACTAAACGTTTTAGGTGGAAAAAAAGCGTCCGAAGGCACCGTGAAATGATTAAGGAACTAAAGAGCTTCTCGCCATGTGAGATCATGTCCTGTTCTCGCCAACATCACAAGATGTCCCCAGACACGCCGCGCCCCCAGCGCGCCGCCCCACACTGCCGGCCCGGAGCGAGGAAAGGGTAGGCGCTGCGCGGCCGGGCCTGCTCAGCGCGCCAGACGTGGCGGACCCGGCCCGGCCGGAGTAGAGCGGGAAGCCGGGAGAGCAGCAGTGCTGCTGCCGCGCCGCCCCAGACTTTTATAGGGGTTGGGGGGAGGGAAGGAAGGCTTCAGCCTGCGCCGGGCGCTAGCCAGCGCACCTACGGGAAG (SEQ ID NO: 17)
[0190] The sequence of the target sequence of the PAX5 gene after bisulfite treatment (5'-3') is as follows:
[0191] TAATTTAAGTTTTTCGTTTTTTCGTCGAGTTGGGGTAGTTGATTATTGAGTTGAAATTAAACGTTTTAGGTGGAAAAAAAGCGTTCGAAGGTATCGTGAAATGATTAAGGAATTAAAGAGTTTTTCGTTATGTGAGATTATGTTTTGTTTTCGTTAATATTATAAGATGTTTTTAGATACGTCGCGTTTTTAGCGCGTCGTTTTATATTGTCGGTTCGGAGCGAGGAAAGGGTAGGCGTTGCGCGGTCGGGTTTGTTTAGCGCGTTAGACGTGGCGGATTCGGTTCGGTCGGAGTAGAGCGGGAAGTCGGGAGAGTAGTAGTGTTGTTGTCGCGTCGTTTTAGATTTTTATAGGGGTTGGGGGGAGGGAAGGAAGGTTTTAGTTTGCGTCGGGCGTTAGTTAGCGTATTTACGGGAAG (SEQ ID NO: 18)
[0192] The complement sequence (5'-3') of the target sequence of the PAX5 gene is as follows:
[0193] CTTCCCGTAGGTGCGCTGGCTAGCGCCCGGCGCAGGCTGAAGCCTTCCTTCCCTCCCCCCAACCCCTATAAAAGTCTGGGGCGGCGCGGCAGCAGCACTGCTGCTCTCCCGGCTTCCCGCTCTACTCCGGCCGGGCCGGGTCCGCCACGTCTGGCGCGCTGAGCAGGCCCGGCCGCGCAGCGCCTACCCTTTCCTCGCTCCGGGCCGGCAGTGTGGGGCGGCGCGCTGGGGGCGCGGCGTGTCTGGGGACATCTTGTGATGTTGGCGAGAACAGGACATGATCTCACATGGCGAGAAGCTCTTTAGTTCCTTAATCATTTCACGGTGCCTTCGGACGCTTTTTTTCCACCTAAAACGTTTAGTTTCAGCTCAGTGATCAGCTACCCCAGCTCGGCGGGGGAGCGGAAGGCTTGAATTA (SEQ ID NO: 19)
[0194] The sequence (5'-3') of the complement sequence of the target sequence of the PAX5 gene after bisulfite treatment is as follows:
[0195] TTTTTCGTAGGTGCGTTGGTTAGCGTTCGGCGTAGGTTGAAGTTTTTTTTTTTTTTTTTTAATTTTTATAAAAGTTTGGGGCGGCGCGGTAGTAGTATTGTTGTTTTTTCGGTTTTTCGTTTTATTTCGGTCGGGTCGGGTTCGTTACGTTTGGCGCGTTGAGTAGGTTCGGTCGCGTAGCGTTTATTTTTTTTTCGTTTCGGGTCGGTAGTGTGGGGCGGCGCGTTGGGGGCGCGGCGTGTTTGGGGATATTTTGTGATGTTGGCGAGAATAGGATATGATTTTATATGGCGAGAAGTTTTTTAGTTTTTTAATTATTTTACGGTGTTTTCGGACGTTTTTTTTTTATTTAAAACGTTTAGTTTTAGTTTAGTGATTAGTTATTTTAGTTCGGCGGGGGAGCGGAAGGTTTGAATTA (SEQ ID NO: 20)
[0196] The target sequence of the VASH2 gene (5’-3’) is as follows:
[0197] CAGCTGTGGCAGAACAGTCAGGGCCTGCCTGACCTCTTGAGTTTTATTGTCTCCTCTCAACTTGGGCTTAAAGGGACTTTATTAACCATGACTAATACCAGAGGATCCAAAGCTGCACCCACTTGTTAATTTTGAGGAATTTTTAAATGCGGGATTTAAAAAAGATTTAATTTCACGCATAGGTATGAACAGCCCCTCATCATCCCAGGTAGAGGATGAACAACTCATCATCCCGGGTAGAGGCAGGTAAGTGTGTCCAGCGTCCCTCAGGGAATGCTCTTCTGATGCCAAACCCTCTGCTTCCGCGGGGTCACTTCTCGGGTGGTTTTGTTTCTCCTCTGCTTCCACAGTTGCAAACCCTCGAAGTGCCACGACCCCTGGGGAAACTCGATCTTAAGTCCCATGGCCAAACGCTCCAGCCCGCGGGGCTCTCAGGACACCACAGCGATCGGATTTCGCGTGGCCGCCAGGCTCCCCCTACTCCTGTCCCCTCCCGCCAGAGAACCCCTGGAGCCAATCAGAGCGTCGCGGAGCCCGGGGTTGTAGAGTCCCGAGCCCGGGACCCGCCCCTCTTTGTTGCGGTGGCCAATAGACGCATTCGGAACATCGG (SEQ ID NO: 21)
[0198] The sequence of the target sequence of the VASH2 gene after bisulfite treatment (5' - 3') is as follows:
[0199] TAGTTGTGGTAGAATAGTTAGGGTTTGTTTGATTTTTTGAGTTTTATTGTTTTTTTTTAATTTGGGTTTAAAGGGATTTTATTAATTATGATTAATATTAGAGGATTTAAAGTTGTATTTATTTGTTAATTTTGAGGAATTTTTAAATGCGGGATTTAAAAAAGATTTAATTTTACGTATAGGTATGAATAGTTTTTTATTATTTTAGGTAGAGGATGAATAATTTATTATTTCGGGTAGAGGTAGGTAAGTGTGTTTAGCGTTTTTTAGGGAATGTTTTTTTGATGTTAAATTTTTTGTTTTCGCGGGGTTATTTTTCGGGTGGTTTTGTTTTTTTTTTGTTTTTATAGTTGTAAATTTTCGAAGTGTTACGATTTTTGGGGAAATTCGATTTTAAGTTTTATGGTTAAACGTTTTAGTTCGCGGGGTTTTTAGGATATTATAGCGATCGGATTTCGCGTGGTCGTTAGGTTTTTTTTATTTTTGTTTTTTTTCGTTAGAGAATTTTTGGAGTTAATTAGAGCGTCGCGGAGTTCGGGGTTGTAGAGTTTCGAGTTCGGGATTCGTTTTTTTTTGTTGCGGTGGTTAATAGACGTATTCGGAATATCGG (SEQ ID NO: 22)
[0200] The complement of the target sequence of the VASH2 gene (5’-3’) is as follows:
[0201] CCGATGTTCCGAATGCGTCTATTGGCCACCGCAACAAAGAGGGGCGGGTCCCGGGCTCGGGACTCTACAACCCCGGGCTCCGCGACGCTCTGATTGGCTCCAGGGGTTCTCTGGCGGGAGGGGACAGGAGTAGGGGGAGCCTGGCGGCCACGCGAAATCCGATCGCTGTGGTGTCCTGAGAGCCCCGCGGGCTGGAGCGTTTGGCCATGGGACTTAAGATCGAGTTTCCCCAGGGGTCGTGGCACTTCGAGGGTTTGCAACTGTGGAAGCAGAGGAGAAACAAAACCACCCGAGAAGTGACCCCGCGGAAGCAGAGGGTTTGGCATCAGAAGAGCATTCCCTGAGGGACGCTGGACACACTTACCTGCCTCTACCCGGGATGATGAGTTGTTCATCCTCTACCTGGGATGATGAGGGGCTGTTCATACCTATGCGTGAAATTAAATCTTTTTTAAATCCCGCATTTAAAAATTCCTCAAAATTAACAAGTGGGTGCAGCTTTGGATCCTCTGGTATTAGTCATGGTTAATAAAGTCCCTTTAAGCCCAAGTTGAGAGGAGACAATAAAACTCAAGAGGTCAGGCAGGCCCTGACTGTTCTGCCACAGCTG (SEQ ID NO: 23)
[0202] The sequence of the complementary sequence of the target sequence of the VASH2 gene after bisulfite treatment (5'-3') is as follows:
[0203] TCGATGTTTCGAATGCGTTTATTGGTTATCGTAATAAAGAGGGGCGGGTTTCGGGTTCGGGATTTTATAATTTCGGGTTTCGCGACGTTTTGATTGGTTTTAGGGGTTTTTTGGCGGGAGGGGATAGGAGTAGGGGGAGTTTGGCGGTTACGCGAAATTCGATCGTTGTGGTGTTTTGAGAGTTTCGCGGGTTGGAGCGTTTGGTTATGGGATTTAAGATCGAGTTTTTTTAGGGGTCGTGGTATTTCGAGGGTTTGTAATTGTGGAAGTAGAGGAGAAATAAAATTATTCGAGAAGTGATTTCGCGGAAGTAGAGGGTTTGGTATTAGAAGAGTATTTTTTGAGGGACGTTGGATATATTTATTTGTTTTTATTCGGGATGATGAGTTGTTTATTTTTTATTTGGGATGATGAGGGGTTGTTTATATTTATGCGTGAAATTAAATTTTTTTTAAATTTCGTATTTAAAAATTTTTTAAAATTAATAAGTGGGTGTAGTTTTGGATTTTTTGGTATTAGTTATGGTTAATAAAGTTTTTTTAAGTTTAAGTTGAGAGGAGATAATAAAATTTAAGAGGTTAGGTAGGTTTTGATTGTTTTGTTATAGTTG (SEQ ID NO: 24)
[0204] Target sequences and related sequences of RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene and VASH2 gene are shown in Table 1.
[0205] Table 1: Target sequences and related sequences of each gene
[0206]
[0207]
[0208] Preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides in the target sequence of the target gene, wherein the fragment comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, where the DNA of the test sample is treated with bisulfite, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 9 nucleotides, preferably at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22 or more nucleotides in the sequence of the target sequence of the target gene after bisulfite treatment, wherein the fragment of nucleotides comprises at least one CpG dinucleotide sequence.
[0209] More preferably, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides hybridizing to the target sequence of the target gene under medium stringency or high stringency conditions, wherein the fragment of nucleotides comprises at least one CpG dinucleotide sequence. In certain preferred embodiments, where the DNA of the test sample is treated with bisulfite, the nucleic acid used to detect the methylation status of the target gene comprises a fragment of at least 15 nucleotides, preferably at least 16, 17, 18, 19, 20, 21, 22 or more nucleotides hybridizing to the sequence of the target sequence of the target gene after bisulfite treatment under medium stringency or high stringency conditions, wherein the fragment of nucleotides comprises at least one CpG dinucleotide sequence.
[0210] Preferably, the composition further comprises a reagent for converting the 5- methylated cytosine bases in the target sequence of the target gene into uracil. More preferably, the reagent is bisulfite.
[0211] The nucleic acid used to detect the methylation status of the target gene can further comprise a blocking agent that preferentially binds to DNA in the unmethylated state.
[0212] Preferably, the composition comprises one or more of the primers, probes as shown in Table 2:
[0213] Table 2 Sequences of primers and probes used in the present application
[0214] SEQ ID NO Sequence name Specific nucleotide sequence (5'-3') SEQ ID NO:25 RNF135_1F TAGGGGTTGTTGGATTGGTTC SEQ ID NO:26 RNF135_1R CACAAAACCTCCAAACAATAACG SEQ ID NO:27 RNF135_1P TACGTTGTTTTGCGGTTATAGTTTTTGTC SEQ ID NO:28 CHFR_1F GGGTGGAATTTAGTAGCG SEQ ID NO:29 CHFR_1R CTCTAAAATTTAACTCCCAAATAATACG SEQ ID NO:30 CHFR_1P TTGAGTCGTCGCGAAGTGTCGG SEQ ID NO:31 SPINT2_1F TATTGGTTTTGGCGATTTTC SEQ ID NO:32 SPINT2_1R ACTCAACGACCCTCAACG SEQ ID NO:33 SPINT2_1P AGGTGTAGCGCGGTTTTGAAC SEQ ID NO:34 SPDYA_1F TTTTAAGTTTATTAGTTTTTAGCGT SEQ ID NO:35 SPDYA_1R TTCTCGCGAAAACAAACG SEQ ID NO:36 SPDYA_1P AAACGAAAACGACCCGAAACGA SEQ ID NO:37 PAX5_1F AGATACGTCGCGTTTTTAGC SEQ ID NO:38 PAX5_1R CGCCTACCCTTTCCTCG SEQ ID NO:39 PAX5_1P TCGTTTTATATTGTCGGTTCGGAGC SEQ ID NO:40 VASH2_1F GCGGGGTTTTTAGGATATTATAGC SEQ ID NO:41 VASH2_1R AAAAAACAAAAATAAAAAAAACCTAACG SEQ ID NO:42 VASH2_1P GCGATCGGATTTCGCGTGGT
[0215] "F" in Table 2 represents a forward primer; "R" represents a reverse primer; and "P" represents a probe.
[0216] Preferably, the fluorescent labeling mode of the probe sequences used in the present application is as shown in Table 3.
[0217] Table 3 Fluorescent labeling mode of the probe sequences used in the present application
[0218] "F" in Table 2 represents a forward primer; "R" represents a reverse primer; and "P" represents a probe.
[0216] Preferably, the fluorescent labeling mode of the probe sequences used in the present application is as shown in Table 3.
[0217] Table 3 Fluorescent labeling mode of the probe sequences used in the present application
[0218]
[0219]
[0220] In certain embodiments, the composition further comprises an agent that converts 5- un-methylated cytosine bases of a gene to uracil. Preferably, the agent is bisulfite. Bisulfite modification of DNA is a known tool for assessing CpG methylation status. In the DNA of eukaryotic cells, 5-methylcytosine is the most common covalent base modification. 5- methylcytosine cannot be identified by sequencing, because 5-methylcytosine has the same base pairing behavior as cytosine. Moreover, during PCR amplification, the epigenetic information carried by 5-methylcytosine is completely lost. The most commonly used method for analyzing the presence of 5-methylcytosine in DNA is based on the specific reaction of bisulfite with cytosine; after subsequent alkaline hydrolysis, the unmethylated cytosine is converted to uracil, which corresponds to thymine in pairing behavior; but 5-methylcytosine remains unmodified under these conditions. In this way the original DNA is converted so that the 5-methylcytosine, which originally could not be distinguished from cytosine in its hybridization behavior, is now detected as the only remaining cytosine by conventional known molecular biology techniques, for example by amplification and hybridization. All these techniques are based on different base pairing properties, which can now be fully exploited. Thus, typically, the present application provides the use of bisulfite technology in combination with one or more methylation assays for determining the methylation status of a CpG dinucleotide sequence within a target sequence of a gene of interest. Moreover, the methods of the present application are suitable for analyzing heterogeneous biological samples, for example low concentrations of tumor cells in blood or stool. Thus, when analyzing the methylation status of a CpG dinucleotide sequence in such a sample, the skilled person can use quantitative assays to determine the methylation level (e.g. percentage, fraction, ratio, proportion or extent) of a particular CpG dinucleotide sequence, rather than the methylation status. Accordingly, the term methylation status or methylation state should also be considered to refer to a value that reflects the methylation status of a CpG dinucleotide sequence.
[0221] In another aspect, the present application provides oligonucleotides for detecting liver cancer in vitro, which comprise: a fragment of at least 9 nucleotides in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence.
[0222] Preferably the oligonucleotide for detecting liver cancer in vitro comprises: a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the complement thereof; and / or a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the complement thereof and comprising at least one CpG dinucleotide sequence; a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the complement thereof; and / or a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the complement thereof and comprising at least one CpG dinucleotide sequence; and / or a fragment of at least 9 nucleotides in the sequence after bisulfite conversion of SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the complement thereof and comprising at least one CpG dinucleotide sequence.
[0223] The oligonucleotide for detecting liver cancer in vitro of the present application also comprises: a fragment of at least 15 nucleotides in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence under medium stringency or stringent conditions; and / or a fragment of at least 15 nucleotides in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence under medium stringency or stringent conditions; and / or a fragment of at least 15 nucleotides in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence under medium stringency or stringent conditions; and / or a fragment of at least 15 nucleotides in SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence under medium stringency or stringent conditions; and / or a fragment of at least 15 nucleotides in SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence under medium stringency or stringent conditions; and / or a fragment of at least 15 nucleotides in SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the complement sequence thereof and comprising at least one CpG dinucleotide sequence under medium stringency or stringent conditions.
[0224] Preferably, the oligonucleotide for detecting liver cancer in vitro comprises: a fragment of at least 15 nucleotides hybridizing to the sequence after bisulfite conversion of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the complement thereof and comprising at least one CpG dinucleotide sequence under medium stringency or high stringency conditions; and / or a fragment of at least 15 nucleotides hybridizing to the sequence after bisulfite conversion of SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the complement thereof and comprising at least one CpG dinucleotide sequence under medium stringency or high stringency conditions; and / or a fragment of at least 15 nucleotides hybridizing to the sequence after bisulfite conversion of SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the complement thereof and comprising at least one CpG dinucleotide sequence under medium stringency or high stringency conditions; and / or a fragment of at least 15 nucleotides hybridizing to the sequence after bisulfite conversion of SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the complement thereof and comprising at least one CpG dinucleotide sequence under medium stringency or high stringency conditions; and / or a fragment of at least 15 nucleotides hybridizing to the sequence after bisulfite conversion of SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the complement thereof and comprising at least one CpG dinucleotide sequence under medium stringency or high stringency conditions; and / or a fragment of at least 15 nucleotides hybridizing to the sequence after bisulfite conversion of SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the complement thereof and comprising at least one CpG dinucleotide sequence under medium stringency or high stringency conditions.
[0225] The oligonucleotide for detecting liver cancer in vitro of the present application can further comprise a blocker that preferentially binds to DNA in an unmethylated state.
[0226] In one specific embodiment, the oligonucleotide for detecting liver cancer in vitro comprises the sequences of SEQ ID NO: 25 and SEQ ID NO: 26. It can further comprise the sequence of SEQ ID NO: 27.
[0227] In another specific embodiment, the oligonucleotide for detecting liver cancer in vitro comprises the sequences of SEQ ID NO: 28 and SEQ ID NO: 29. It can further comprise the sequence of SEQ ID NO: 30.
[0228] In another specific embodiment, the oligonucleotide for detecting liver cancer in vitro comprises the sequences of SEQ ID NO: 31 and SEQ ID NO: 32, and further comprises the sequence of SEQ ID NO: 33.
[0229] In another specific embodiment, the oligonucleotide for detecting liver cancer in vitro comprises the sequences of SEQ ID NO: 34 and SEQ ID NO: 35, and further comprises the sequence of SEQ ID NO: 36.
[0230] In another specific embodiment, the oligonucleotide for detecting liver cancer in vitro comprises the sequences of SEQ ID NO: 37 and SEQ ID NO: 38, and further comprises the sequence of SEQ ID NO: 39.
[0231] In another specific embodiment, the oligonucleotide for detecting liver cancer in vitro comprises the sequences of SEQ ID NO: 40 and SEQ ID NO: 41, and further comprises the sequence of SEQ ID NO: 42.
[0232] In another aspect, the present application provides a kit comprising the composition. The kit further comprises at least one other component selected from the group consisting of nucleoside triphosphates, DNA polymerase and buffers required for the function of the DNA polymerase.
[0233] Typically, the kit further comprises a container for holding a patient's biological sample. Also, the kit further comprises instructions for use and interpretation of the test results.
[0234] The present application also relates to the use of the above-mentioned composition and oligonucleotide for the preparation of a kit for detecting liver cancer in vitro.
[0235] The present application also relates to the use of one or more of the RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene and VASH2 gene for the preparation of a kit for detecting liver cancer in vitro.
[0236] The RNF135 gene (Homo sapiens ring finger protein 135) is an E3 ubiquitin ligase containing a ring finger domain, which is involved in the regulation of gene transcription, translation, cell adhesion, epithelial development and cell cycle regulation. RING finger protein 135 (RNF135) is composed of an N-terminal ring finger domain and a C-terminal SPRY and PRY motif 15, belongs to the E3 ubiquitin ligase containing a ring finger protein family, and is located on chromosome 17q11.2. This gene ubiquinates RIG-I at an early stage of viral infection and promotes its signal transduction to produce interferon-beta. This process plays a very important role in a wide range of biological processes in development and disease pathogenesis. Studies have shown that the RNF135 gene is down-regulated in Schwann cells of malignant peripheral nerve sheath tumors, and down-regulation of RNF135 expression can cause inactivation of the Erk pathway in U87 and U251 glioma cells (the Erk pathway is involved in the regulation of cell cycle progression, cell growth, proliferation and migration), thereby inhibiting cell growth and migration.
[0237] The CHFR gene (Checkpoint with forkhead and ring finger domains) is a mitotic checkpoint gene that has been cloned and located on chromosome 12q24.33. In mammalian cells exposed to drugs that disrupt microtubule structure (such as nocodazole or paclitaxel), the CHFR protein mediates a delay in entering metaphase. Its characteristic under a microscope is a delay in chromosome condensation, and the cell cycle progresses is delayed until the cell damage is repaired. In addition, CHFR promotes cell survival in response to mitotic stress.
[0238] The SPINT2 gene (Homo sapiens serine peptidase inhibitor, Kunitz type, 2, SPINT2) encodes a transmembrane protein in the serine protease inhibitor gene, which inhibits the HGF / MET signaling pathway by inhibiting the activation of HGF, and belongs to a tumor suppressor gene. In addition, the SPINT2 gene can also inhibit the activity of hepatocyte growth factor by inhibiting the activation of hepatocyte growth activator. Hepatocyte growth factor can stimulate tumor cell growth, metastasis, and stimulate tumor angiogenesis, and plays an important role in the occurrence and development of tumors. Studies have shown that the SPINT2 gene is regulated by methylation and down-regulated in tissues such as hepatocellular carcinoma, renal cell carcinoma, ovarian cancer, and glioma. SPINT2 is up-regulated in breast cancer, and high expression of SPINT2 is significantly associated with poor prognosis. This study found that SPINT2 is lowly expressed in most gastric cancer cell lines and gastric cancer tissues, and low expression of SPINT2 is correlated with clinical indicators (such as tumor cell differentiation degree, metastasis, etc.) of gastric cancer patients.
[0239] The SPDYA (SPY1) gene (Homo sapiens speedy / RINGO cell cycle regulator family member A, SPDYA (SPY1)) is a cell cycle protein belonging to the Speedy / Ringo family of cell cycle regulators. The gene can promote cell proliferation and survival by activating cyclin-dependent kinase-2. In late G1 and throughout S phase, Spy1 expression enhances CDK2-dependent p27kip1 degradation by directly promoting p27 degradation. Studies have shown that Spy1 is expressed in various human tissues, and overexpression of the gene promotes G1-S phase progression, p27kip degradation, and cell proliferation by activating CDK2.
[0240] The PAX5 gene (paired box protein 5) is an evolutionarily conserved gene that encodes a B cell-specific activator protein (BSAP). Studies have shown that B cell differentiation and development is a dynamic transcriptional regulatory process. B cell differentiation and development play an important role in immune regulation and immune response. Transcription factors affect the directional differentiation and development of B cells. In particular, the transcription factor Pax5 plays a key regulatory role.
[0241] The VASH2 gene (Homo sapiens vasohibin 2, VASH2) is a member of the vasohibin family of proteins that can interact with the vascular endothelial growth factor (VEGF) family of proteins, involved in the regulation of neovascularization and EMT pathways. Studies have shown that VASH2 is associated with the proliferation, metastasis, and invasion of various human tumors. Therefore, VASH2 can activate the TGF-β signaling pathway, participate in the regulation of the EMT process, and enhance the migration and invasion ability of ovarian cancer and breast cancer cells.
[0242] In another aspect, the present application provides a method for detecting liver cancer in vitro, comprising the following steps:
[0243] 1) Isolating the target sequence or fragment of the target gene in the biological sample to be tested;
[0244] 2) Determining the methylation state of the target sequence of the target gene;
[0245] 3) Determining the state of the biological sample by detecting the methylation state of the target sequence of the target gene, thereby achieving in vitro detection of liver cancer.
[0246] According to certain preferred embodiments, the method further comprises the steps of:
[0247] 1) extracting genomic DNA from a biological sample to be tested;
[0248] 2) treating the DNA sample obtained in step 1) with a reagent to convert 5- un-methylated cytosine bases to uracil or other bases, i.e. 5-un-methylated cytosine bases of a target sequence of a gene of interest are converted to uracil or other bases, the converted bases being different from 5-un-methylated cytosine bases in terms of hybridization properties and being detectable;
[0249] 3) contacting the DNA sample treated in step 2) with a DNA polymerase and a primer of a target sequence of the gene of interest, such that the treated target sequence of the gene of interest is amplified to produce an amplification product or is not amplified; the treated target sequence of the gene of interest produces an amplification product if a DNA polymerization reaction occurs; the treated target sequence of the gene of interest is not amplified if a DNA polymerization reaction does not occur;
[0250] 4) detecting the amplification product with a probe; and
[0251] 5) determining the methylation state of at least one CpG dinucleotide of the target sequence of the gene of interest based on whether the amplification product is present or not.
[0252] Preferably, a typical primer comprises a fragment of a target sequence of the gene of interest comprising a fragment of at least 9 nucleotides respectively identical to, complementary to, or hybridizing under moderately stringent or stringent conditions to a fragment selected from any one of SEQ ID NOs: 1-4, any one of SEQ ID NOs: 5-8, any one of SEQ ID NOs: 9-12, any one of SEQ ID NOs: 13-16, any one of SEQ ID NOs: 17-20, any one of SEQ ID NOs: 21-24.
[0253] Preferably, a typical probe comprises a fragment of a target sequence of the gene of interest comprising a fragment of at least 15 nucleotides respectively identical to, complementary to, or hybridizing under moderately stringent or stringent conditions to a fragment selected from any one of SEQ ID NOs: 1-4, any one of SEQ ID NOs: 5-8, any one of SEQ ID NOs: 9-12, any one of SEQ ID NOs: 13-16, any one of SEQ ID NOs: 17-20, any one of SEQ ID NOs: 21-24.
[0254] Preferably, one or more of the primers, probes are as shown in Table 2 above.
[0255] Also, the contacting or amplifying comprises using at least one of the following methods: using a thermostable DNA polymerase as the amplification enzyme, using a polymerase lacking 5'-3' exonuclease activity, using polymerase chain reaction (PCR), generating amplified product nucleic acid molecules with a detectable label.
[0256] Preferably, the methylation status is determined by PCR, such as "fluorescence based real-time PCR technology", methylation sensitive single nucleotide primer extension reaction (Ms-SNuPE), methylation specific PCR (MSP), and methylation CpG island amplification (MCA) and the like. Among them, the "fluorescence based real-time PCR" assay is a high throughput quantitative methylation assay that uses fluorescence based real-time PCR (TaqMan) technology without further manipulation after the PCR step. Briefly, the "fluorescence based real-time PCR" method starts with a mixed sample of genomic DNA that is converted into a mixed pool of methylation dependent sequence differences in a sodium bisulfite reaction according to standard procedures. Subsequently, a fluorescence based PCR is performed in a "biased" reaction with PCR primers overlapping the known CpG dinucleotides. Sequence differences can be generated at the level of amplification as well as at the level of fluorescence detection of the amplification. The "fluorescence based real-time PCR" assay can be used as a quantitative test of the methylation status in a genomic DNA sample, where sequence discrimination occurs at the level of probe hybridization. In this quantitative approach, the PCR reaction provides methylation specific amplification in the presence of a fluorescence probe overlapping the specific CpG dinucleotides. A bias-free control for the amount of starting DNA is provided by a reaction where neither primer nor probe covers any CpG dinucleotides. The "fluorescence based real-time PCR" method can be used with any suitable probe, such as "TaqMan", "Lightcycler" and the like. TaqMan probes are dual labeled with a fluorescent reporter (RTSPYL5rter) and a quencher molecule (Quencher) and are designed to be specific to a relatively high GC content region so that they melt at a temperature about 10°C higher than the forward or reverse primer in the PCR cycle. This allows the TaqMan probe to remain fully hybridized during the PCR annealing / extension step. As the Taq polymerase enzymatically synthesizes a new strand in the PCR, it eventually encounters the annealed TaqMan probe. The 5' to 3' exonuclease activity of the Taq polymerase then displaces it by digesting the TaqMan probe, thereby releasing the fluorescent reporter molecule for quantitative detection of its now unquenched signal using a real-time fluorescence detection system. Typical reagents for "fluorescence based real-time PCR" analysis can include, but are not limited to: PCR primers for the target sequence of the gene of interest; a non-specific amplification blocker; TaqMan or Lightcycler probes; optimized PCR buffer and deoxynucleotides; and Taq polymerase and the like.
[0257] In some preferred embodiments, the methylation state of at least one CpG dinucleotide in the target sequence of the target gene is determined by a critical Ct value of a real-time PCR reaction. By using the method for analyzing DNA in a biological sample by a real-time PCR reaction, the detection of the methylation state of the target sequence of the target gene can be easily achieved, and the critical Ct value of the PCR reaction can be used to quickly and conveniently determine whether the sample is positive, thus providing a non-invasive and rapid in vitro detection method for liver cancer.
[0258] The biological sample is selected from the group consisting of a cell line, a histological section, a tissue biopsy / paraffin-embedded tissue, a body fluid, feces, colon effluent, urine, plasma, serum, whole blood, isolated blood cells, cells isolated from blood, or a combination thereof. Preferably, the biological sample is plasma.
[0259] The present inventors have found that the methylation state of the target sequence of the RNF135 gene, the CHFR gene, the SPINT2 gene, the SPDYA gene, the PAX5 gene and the VASH2 gene in liver cancer tissue is significantly different from that of normal liver tissue: in liver cancer tissue, the target sequence of the RNF135 gene, the CHFR gene, the SPINT2 gene, the SPDYA gene, the PAX5 gene and the VASH2 gene is methylated, while in normal liver tissue, the target sequence of the RNF135 gene, the CHFR gene, the SPINT2 gene, the SPDYA gene, the PAX5 gene and the VASH2 gene is not methylated. Therefore, the present application provides a method for in vitro detection of liver cancer by detecting the methylation state of the target sequence of one or more of the RNF135 gene, the CHFR gene, the SPINT2 gene, the SPDYA gene, the PAX5 gene and the VASH2 gene in a sample, which can non-invasively and rapidly detect liver cancer.
[0260] EMBODIMENT
[0261] The materials used in the experiments and the experimental methods are generally and / or specifically described in the present application. In the following examples, % means wt%, i.e. weight percentage, unless otherwise specified. The reagents or instruments used are not specified by the manufacturer, and are conventional reagent products that can be obtained commercially.
[0262] Example 1 Primer and Probe Test
[0263] First, low methylation level sites were screened from the second-generation sequencing information of 340 healthy human WBC samples and 100 healthy human plasma cfDNA samples. Second, the screened low methylation level sites were analyzed for plasma and liver cancer tissue, and sites that were different between 377 liver cancer plasma and 200 normal human plasma and simultaneously different between 377 liver cancer tissues and 53 cancer-adjacent tissues were screened as candidate markers. Then, the candidate markers were subjected to plasma tracing. Finally, the sensitivity and specificity of liver cancer plasma and normal human plasma were verified to determine six specific markers, namely RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene, and VASH2 gene.
[0264] Primers and probes were designed according to the target sequences of the above six genes, and the sequences of the designed primers and probes are shown in Table 2 above.
[0265] The DNA of the normal human white blood cell line is usually in a low / non-methylation state and can be used as a negative control. The amount of DNA used in the present embodiment is 15.75 ng / reaction. The fully methylated DNA is in a high / fully methylated state and can be used as a positive control. The amount of DNA used in the present embodiment is 200 pg / reaction. The DNA sample is first subjected to bisulfite conversion, and the converted BisDNA is used as a template for real-time PCR amplification using the above primers and probes. The β-actin (ACTB) gene is used as an internal reference, and a β-actin gene amplicon is created by using primers complementary to the β-actin gene sequence, and a specific probe is used to detect the β-actin gene amplicon. Each sample is subjected to at least one real-time PCR, and in some specific embodiments, two or three real-time PCR detections. The PCR system for primer / probe testing is shown in Table 4 below.
[0266] Table 4 PCR system for primer / probe testing
[0267] Volume (μL) Final concentration Taq DNA Polymerase (Biochain) 1.2 / 4.2x buffer (Biochain) 11.9 1× Forward primer F (10 μM) 1.0 200 nM Reverse primer R (10 μM) 1.0 200 nM Probe P (10 μM) 1.0 200 nM ACTB_F (10 μM) 0.5 100 nM ACTB_R (10 μM) 0.5 100 nM ACTB_P (10 μM) 0.375 75 nM BisDNA 4.0 / H2O 28.525 / Total 50.0 /
[0268] Note: "F" indicates a forward primer; "R" indicates a reverse primer; and "P" indicates a probe.
[0269] The PCR amplification program used is: 94°C, 20 min; (93°C, 30 s; 57°C, 35 s-read fluorescence signal) 45 cycles; 40°C, 5 s.
[0270] The results are shown in Table 5. When the BisDNA of the fully methylated DNA is used as a template, RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene, and VASH2 gene can all be effectively amplified; and when the BisDNA of the WBC is used as a template, the target genes other than the internal reference gene ACTB are not amplified.
[0271] Table 5 Test results of each gene primer probe
[0272]
[0273]
[0274] wherein "No Ct" means that no Ct value was detected.
[0275] Example 2
[0276] Sixteen liver cancer tissue samples (10 ng / reaction) and sixteen normal human plasma samples (3.5 mL) were selected, and genomic DNA was extracted. After bisulfite conversion, the methylation of RNF135, CHFR, SPINT2, SPDYA, PAX5 and VASH2 genes was detected according to the PCR reaction system and reaction procedure in Example 1. The threshold value of each marker was set at 41, and the Ct value of real-time PCR of the target sequence of the objective gene in the sixteen liver cancer tissue samples and sixteen normal human plasma samples was finally measured.
[0277] Table 6 Sensitivity / specificity of each gene in liver cancer tissue and normal human plasma
[0278] HCC tissue Normal human plasma Total number of samples 16 16 Number of RNF135 positive detection 14 0 Number of CHFR positive detection 15 1 Number of SPINT2 positive detection Number of SPDYA positive detection Number of PAX5 positive detection Number of VASH2 positive detection 12 1 Number of SPDYA positive calls 14 0 Number of PAX5 positive calls 9 1 Number of VASH2 positive calls 14 0 Number of six-gene joint detection positive calls 16 3 RNF135 detection sensitivity / specificity 87.50% 100% CHFR detection sensitivity / specificity 93.75% 93.75% SPINT2 detection sensitivity / specificity 75% 93.75% SPDYA detection sensitivity / specificity 87.50% 100% PAX5 detection sensitivity / specificity 56.25% 93.75% VASH2 detection sensitivity / specificity 87.50% 100% Six-gene joint detection sensitivity / specificity 100% 81.25%
[0279] The results in Table 6 show that the sensitivity of liver cancer tissue detected by RNF135, CHFR, SPINT2, SPDYA, PAX5 and VASH2 genes alone was 87.5%, 93.75%, 75%, 87.5%, 56.25% and 87.5%, respectively, and the sensitivity of the combined detection of the six genes reached 100%.
[0280] The results in Table 6 show that the methylation of the target sequence of the objective gene has good specificity. The specificity of the methylation of liver cancer detected by RNF135, CHFR, SPINT2, SPDYA, PAX5 and VASH2 genes alone is all above 90%, and the specificity of the combined detection of the six genes is 81.25%.
[0281] Among the above six markers related to liver cancer, the tissue sensitivity of four markers is above 80% from the detection results of the tissue, and the sensitivity can reach 100% when the six markers are combined for interpretation. From the detection results of normal human plasma, the specificity of the plasma detected by the six markers alone is all above 90%, and the specificity of the combined detection of the six markers can reach 81.25%. Under the condition of small sample size verification, the specificity of plasma reaching 80% is a relatively reasonable and high index level.
[0282] Example 3
[0283] Ten plasma samples (3.5 mL) of liver cancer and 16 plasma samples (3.5 mL) of normal people were selected, and genomic DNA was extracted. After the genomic DNA was converted into BisDNA by bisulfite, the methylation of RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene and VASH2 gene was detected according to the PCR reaction system in Example 2. The threshold of each gene was set at 41, and the Ct value of real-time PCR of the target sequence of the objective gene in the 10 plasma samples of liver cancer and 16 plasma samples of normal people was finally measured. The PCR results are shown in Table 7.
[0284] Table 7 Detection results of each gene in cancer plasma and normal plasma
[0285]
[0286] Table 9 shows that the sensitivity of RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene and VASH2 gene for detecting liver cancer plasma alone is 80%, 70%, 60%, 70%, 40% and 40%, respectively. The specificity of the 6 genes for detecting normal plasma alone is 100%, 93.75%, 100%, 93.75%, 93.75% and 100%, respectively.
[0287] From the above detection results of the sensitivity of liver cancer plasma and the specificity of normal plasma, it can be seen that the sensitivity of 3 markers is more than 70% when the specificity is maintained at more than 90%, but only the sensitivity of RNF135 gene reaches 80%. The sensitivity of the combined detection of the 6 genes can reach 90%, so the combined detection of the 6 genes can improve the sensitivity to a certain extent.
[0288] Therefore, the above experimental results show that the 6 objective genes selected in the present application are potential markers for detecting liver cancer methylation. Through the detection of the methylation DNA of the target sequence of the objective gene, the in vitro non-invasive detection of liver cancer can be realized, and the detection rate of liver cancer can be improved.
[0289] In summary, the present application uses the above-mentioned composition, nucleic acid sequence, kit and use thereof, and the above-mentioned detection method, and realizes the in vitro detection of liver cancer by using the methylation biomarker of the target sequence of the objective gene through the detection of the methylation nucleic acid sequence of the target sequence and fragments of the objective gene, thereby effectively improving the sensitivity and specificity of the in vitro detection of liver cancer.
[0290] The above descriptions are only the preferred embodiments of the present application, and are not intended to limit the present application in other forms. Any skilled person in the art can make changes or modifications to the equivalent embodiments with the disclosed technical contents. However, any simple modification, equivalent change and modification made to the above embodiments without departing from the technical content of the present application, and according to the technical essence of the present application, still belongs to the protection scope of the present application.
Claims
1. A composition for detecting liver cancer in vitro, the composition comprising: a nucleic acid for detecting a methylation state of a target gene, wherein the methylation state of the target gene is characterized by methylation of a target sequence of the target gene, and wherein the target gene is one or more than two of RNF135 gene, CHFR gene, SPINT2 gene, SPDYA gene, PAX5 gene and VASH2 gene. the target sequence of the RNF135 gene is as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO: 4 or the target sequence of the RNF135 gene comprises a sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 3 or SEQ ID NO:
4. the target sequence of the CHFR gene is as shown in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO: 8 or the target sequence of the CHFR gene comprises a sequence as shown in SEQ ID NO: 5 or SEQ ID NO: 6 or SEQ ID NO: 7 or SEQ ID NO:
8. the target sequence of the SPINT2 is as shown in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO: 12 or the target sequence of the SPINT2 comprises a sequence as shown in SEQ ID NO: 9 or SEQ ID NO: 10 or SEQ ID NO: 11 or SEQ ID NO:
12. the target sequence of the SPDYA gene is as shown in SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO: 16 or the target sequence of the SPDYA gene comprises a sequence as shown in SEQ ID NO: 13 or SEQ ID NO: 14 or SEQ ID NO: 15 or SEQ ID NO:
16. the target sequence of the PAX5 gene is as shown in SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO: 20 or the target sequence of the PAX5 gene comprises a sequence as shown in SEQ ID NO: 17 or SEQ ID NO: 18 or SEQ ID NO: 19 or SEQ ID NO:
20. the target sequence of the VASH2 gene is as shown in SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO: 24 or the target sequence of the VASH2 gene comprises a sequence as shown in SEQ ID NO: 21 or SEQ ID NO: 22 or SEQ ID NO: 23 or SEQ ID NO:
24. the nucleic acid for detecting the methylation state of the target gene comprises: 2. The composition of claim 1, wherein, 3. The composition of claim 1, wherein, 4. The composition of claim 1, wherein, 5. The composition of claim 1, wherein, 6. The composition of claim 1, wherein, 7. The composition of claim 1, wherein, 8. The composition according to any one of claims 1 to 7, wherein, a primer which is a fragment of at least 9 nucleotides in a target sequence of the target gene, the fragment comprising at least one CpG dinucleotide sequence.
9. The composition according to any one of claims 1 to 8, wherein, the nucleic acid for detecting the methylation state of the target gene comprising: a probe which is a fragment of at least 15 nucleotides hybridizing to a target sequence of the target gene under medium stringency or high stringency conditions, the fragment comprising at least one CpG dinucleotide sequence.
10. The composition according to any one of claims 1 to 9, further comprising: an agent which converts an unmethylated cytosine base at position 5 of a target sequence of the target gene into uracil.