Molecular marker related to back fat thickness and birth weight of pig and application of molecular marker
By using a molecular marker at 45bp of exon 4 of the PTGDS gene, the problem of difficulty in improving backfat thickness and birth weight in traditional breeding methods has been solved, enabling early and accurate identification and efficient breeding, thereby improving the reproductive performance and economic benefits of pig herds.
Patent Information
- Application Number
- CN202511809034.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-12-03
- Publication Date
- 2026-02-06
AI Technical Summary
Traditional breeding methods are difficult to improve the two economic traits of pigs, backfat thickness and birth weight, quickly and accurately. In particular, the genetic improvement of backfat thickness is slow and the testing cost is high, making it difficult to accurately measure using traditional methods.
The A or G polymorphism molecular marker at 45bp of exon 4 of the PTGDS gene was used to amplify this region by designing primer pairs. The genotype of pigs was detected by combining gene sequencing, molecular probes and mass spectrometry. Birth weight and backfat thickness were predicted using SNP sites.
It enables early, efficient, and accurate identification of pig birth weight and backfat thickness, improving the reproductive performance and fat deposition traits of pig herds, and enhancing breeding efficiency and economic benefits.
Smart Images

Figure CN121472422A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of animal breeding technology, and in particular to a molecular marker related to backfat thickness and birth weight in pigs and its application. Background Technology
[0002] The swine industry is one of the pillar industries of the agricultural economy, and its production efficiency and meat quality are directly related to national welfare and market demand. In swine breeding, piglet birth weight and backfat thickness are two crucial economic traits. Piglet birth weight is a fundamental trait determining the reproductive efficiency of a pig herd, closely related to piglet survival rate, growth rate, and the overall profitability of the pig farm. Backfat thickness is a key carcass trait measuring a pig's fat deposition capacity, and it has a significant negative correlation with lean meat percentage, directly affecting meat production efficiency and economic benefits. Reducing backfat thickness and increasing carcass lean meat percentage are core objectives in swine breeding both domestically and internationally.
[0003] Traditional breeding primarily relies on phenotypic selection and optimal linear unbiased prediction, estimating breeding values through performance testing and pedigree analysis of breeding pigs. While these methods have made significant progress in improving highly heritable traits such as growth rate and backfat thickness, their genetic improvement is relatively slow for limited traits, low heritability traits, or traits that are difficult to measure accurately, and breeding efficiency needs improvement. Backfat thickness is a medium-to-high heritability trait; although traditional methods are effective, accurate measurement usually relies on expensive specialized equipment (such as ultrasound) or slaughter data, which is costly and time-consuming. Reproductive traits such as piglet birth weight typically have low heritability and are greatly influenced by the environment, making rapid genetic progress difficult to achieve using traditional breeding methods alone. With the development of molecular biology and genomics, molecular marker-assisted selection technology has provided a new breakthrough for pig breeding. This technology, by detecting DNA molecular markers linked to important economic traits, can accurately assess the genetic potential of individuals early in life, even before birth, thereby shortening generation intervals and accelerating genetic progress. In particular, the application of genome-wide association studies (GWAS) technology enables researchers to screen single nucleotide polymorphism (SNP) markers that are significantly associated with target traits across the entire genome.
[0004] Prostaglandin D2 synthase (PTGDS) is a key enzyme in metabolic and reproductive physiology. It catalyzes the conversion of prostaglandin H2 to prostaglandin D2 (PGD2), which plays an important role in lipid metabolism, immune regulation, and reproductive hormone regulation. Studies have shown that PTGDS proteins can not only bind to various lipophilic small molecules (such as retinoic acid and thyroid hormones) and participate in lipid transport and metabolism, but may also affect smooth muscle function, platelet aggregation, and central nervous system activity through its synthetic product PGD2. However, research on the application of the PTGDS gene in pig breeding is still limited. In particular, whether the specific SNP sites of this gene are significantly associated with both piglet birth weight and backfat thickness—two key economic traits—has not been publicly reported, and there is a lack of mature protocols for its application in marker-assisted breeding. Summary of the Invention
[0005] To address the problems existing in the prior art, this invention provides a molecular marker related to backfat thickness and birth weight in pigs and its application.
[0006] In a first aspect, the present invention provides a molecular marker based on the genome version number Sscrofa11.1 GCF_000003025.6, wherein the molecular marker is located at the 45th bp of the 4th exon of the PTGDS gene and has a polymorphism of A or G.
[0007] Secondly, the present invention provides a molecular marker comprising a nucleic acid with a nucleotide sequence as shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the 156th position exhibits a polymorphism of A or G.
[0008] The nucleotide sequence shown in SEQ ID NO.1: ACGGGGGCAGCAACCTCGAGGTGTCGGTGGTGGAGACTGACTACAAGAACTACGCCCTGCTCCACACCGAGAGCGGCCCGAGCCCAGGCCCGGCCTTCCGCATGGCCACGCTCTACA.
[0009] The nucleotide sequence shown in SEQ ID NO.2: ACGGGGGCAGCAACCTCGAGGTGTCGGTGGTGGAGACTGACTACGAGAACTACGCCCTGCTCCACACCGAGAGCGGCCCGAGCCCAGGCCCGGCCTTCCGCATGGCCACGCTCTACA.
[0010] Thirdly, the present invention provides a primer pair for amplifying the aforementioned molecular marker.
[0011] The primer pair design method described in this invention can be a conventional method of this invention. Technicians can design primer pairs (including primer pairs or KASP primer combinations) of different lengths based on existing primer design rules and primer design software (such as Primer) to amplify the aforementioned molecular markers.
[0012] Fourthly, the present invention provides a primer pair comprising nucleotide sequences as shown in SEQ ID NO.3 and SEQ ID NO.4.
[0013] The nucleotide sequence shown in SEQ ID NO.3: ACAGAACAGCGAGGGAGGAGC.
[0014] The nucleotide sequence shown in SEQ ID NO.4: GCGAGGCGCACGTACTGTAGA.
[0015] The primer pair amplified the nucleotide sequence shown in SEQ ID NO.5: ACAGAACAGCGAGGGAGGAGCGGGGTGCGGGCAGGAAGCAGGGGTGGGGAGGGGACAGGGAGGGCGCGGGCAGGGACGGGAGGGCGAGGGAGCTGAGAGAGGGGAAGGCAGACGGGGGCAGC AAGGAGGAGGTGAGGGTGGTGGAGACTGACTACAAGAACTACGGGCTGCAGCACAGGGAGAGCGGGGCGAGGGCAGGGGCGGGGAAGGGCATGGGGACCGCAGTACAGTACGTGCGGGAGGC.
[0016] The nucleotide sequence shown in SEQ ID NO.6: ACAGAACAGCGAGGGAGGAGCGGGGTGCGGGCAGGAAGCAGGGGTGGGGAGGGGACAGGGAGGGCGCGGGCAGGGACGGGAGGGCGAGGGAGCTGAGAGAGGGGAAGGCAGACGGGGGCAGC AAGGAGGAGGTGAGGGTGGTGGAGACTGACTACGAGAACTACGGGCTGCAGCACAGGGAGAGCGGGGCGAGGGCAGGGGCGGGGAAGGGCATGGGGACCGCAGTACAGTACGTGCGGGAGGC.
[0017] Fifthly, the present invention provides a reagent kit, characterized in that it includes the aforementioned molecular markers or the aforementioned primer pairs.
[0018] In a sixth aspect, the present invention provides the use of the aforementioned molecular markers, or the aforementioned primer pairs, or the aforementioned kits in any of the following: (1) To predict or detect the birth weight or backfat thickness of pigs, or to prepare a reagent for predicting or detecting the birth weight or backfat thickness of pigs; (2) Identify or breed pig breeds with high birth weight or low backfat thickness, or prepare reagents for identifying or breeding pig breeds with high birth weight or low backfat thickness; (3) Molecular marker-assisted breeding of pigs; (4) Improvement of pig breeds related to birth weight or backfat thickness; (5) Improvement of pig germplasm resources.
[0019] In a seventh aspect, the present invention provides a method for determining the birth weight or backfat thickness of a pig, comprising: The polymorphism of molecular markers as described above is detected in the pig samples to be tested, and the birth weight or backfat thickness of the pigs is determined based on the genotype detection results.
[0020] Furthermore, the detection method includes one or more of the following: gene sequencing, molecular probes, liquid phase capture, or mass spectrometry.
[0021] Furthermore, determining the birth weight or backfat thickness of the pig under test based on the genotype detection results includes: Pigs with the AA genotype have a lower birth weight or a higher backfat thickness compared to pigs with the AG or GG genotypes.
[0022] Eighthly, the present invention provides a method for breeding pig breeds with high birth weight or low backfat thickness, comprising: In the process of pig breeding, pigs with the genotype AG or GG, as indicated by the aforementioned molecular markers, are retained for subsequent breeding processes.
[0023] The present invention has the following beneficial effects: This invention provides a PTGDS gene SNP molecular marker associated with pig birth weight and backfat thickness traits, and its application. By identifying the genotype of pigs associated with this molecular marker, birth weight and backfat thickness can be determined efficiently and accurately. The molecular marker provided by this invention can be further applied to the breeding of high-quality pig breeds, enabling the selection of pig breeds with high birth weight or low backfat thickness, improving the reproductive performance and fat deposition traits of pig herds, and enhancing the economic benefits of breeding pigs, thus possessing significant application value. Attached Figure Description
[0024] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0025] Figure 1 The results are PCR amplification results of the fourth exon of the Large White pig PTGDS gene provided in Example 1 of this invention. M is DL1002Maker, and lanes 1-5 are PCR amplification products of the Large White pig genome.
[0026] Figure 2 This is a sequence diagram of the sequencing results of a representative individual of the genotype at the 45th base of the fourth exon of the Large White pig PTGDS gene provided in Example 1 of the present invention.
[0027] Figure 3 This is a peak diagram of the sequencing results of a representative individual of the genotype at the 45th base of the fourth exon of the Large White pig PTGDS gene provided in Example 1 of the present invention. Detailed Implementation
[0028] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.
[0029] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.
[0030] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.
[0031] In the following examples, the PTGDS gene-related information is based on the genome version number Sscrofa11.1 GCF_000003025.6.
[0032] Example 1 I. Extraction of porcine genomic DNA The experimental pig breed used in this invention was the Large White pig. Sample data, birth weight, and backfat thickness phenotypic data were obtained from Shuangbaotai (Group) Co., Ltd. Genomic DNA was extracted from pig ear tissue using a commercially available kit, following the kit's instructions. The concentration and quality of the extracted DNA were tested and then stored at -20°C for later use.
[0033] (1) Ear margin tissue was collected from 182 large white pigs. The hair on the ear margin tissue was removed with sterilized surgical scissors. The clean tissue was then cut into pieces, ground, and placed in a 1.5 mL centrifuge tube.
[0034] (2) Add 200 μL of buffer GA to the centrifuge tube, vortex and mix thoroughly.
[0035] (3) Add 20 μL proteinase K, vortex to mix, incubate in a water bath at 56 °C until the tissue dissolves, and centrifuge at 12000 rpm for 1 min.
[0036] (4) Add 200 μL of buffer GB, mix thoroughly by inverting, place at 70°C for 30 min until the solution becomes clear, and centrifuge at 12000 rpm for 1 min.
[0037] (5) Add 200 μL of anhydrous ethanol, shake well for 15 seconds, and after flocculent precipitate appears, centrifuge at 12000 rpm / min for 1 min.
[0038] (6) Add the mixture obtained in the previous step to the adsorption column CB3, then centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 back into the collection tube.
[0039] (7) Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube.
[0040] (8) Add 600 μL of washing solution PW to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and put the adsorption column CB3 into the collection tube.
[0041] (9) Repeat step (8).
[0042] (10) Place the adsorption column CB3 back into the collection tube, centrifuge at 12,000 rpm for 2 min, and discard the waste liquid. Place the adsorption column CB3 at room temperature for a few minutes to dry the remaining rinsing liquid.
[0043] (11) Transfer the adsorption column CB3 into a clean centrifuge tube, add 70 μL of elution buffer TE to the middle of the adsorption membrane, let it stand at room temperature for 5 min, centrifuge at 12,000 rpm for 2 min, and collect the solution into the centrifuge tube.
[0044] (12) Use the Nanodrop instrument to determine the concentration and detect the DNA quality.
[0045] (13) The prepared DNA was aliquoted and stored at 4℃ and -20℃ respectively.
[0046] II. Obtaining the SNP sites of the porcine PTGDS gene This invention provides porcine genomic DNA samples and commissioned Beijing Novogene Technology Co., Ltd. to perform deep genome sequencing and subsequent bioinformatics analysis on 50 individuals with varying backfat thickness. After ensuring the DNA quality met sequencing requirements, the samples underwent library construction, high-throughput sequencing, data quality control, and alignment analysis. SAMTOOLS software was used to detect SNPs in the high-quality alignment results, and filtering was performed based on criteria such as deletion rate, sequencing depth, and minimum allele frequency to obtain a high-confidence SNP set. Subsequently, ANNOVAR software was used to perform functional annotation of the SNP sites, including annotations of gene regions, functional regions, and variant types. Based on the annotation results, gene regions significantly associated with pig birth weight and backfat thickness traits were identified. A single nucleotide mutation A>G at nucleotide 45 of exon 4 of the PTGDS gene was determined, and this site showed a significant correlation with differences in birth weight and backfat thickness.
[0047] Through the above sequencing and mutation detection process, this invention successfully identified the PTGDS gene SNP locus associated with pig birth weight and backfat thickness, providing an important genetic basis for subsequent molecular marker-assisted breeding research.
[0048] III. Detection of SNP sites in the porcine PTGDS gene 1. PCR amplification Using the genomic DNA extracted from 182 Large White pigs as a template, the fragment containing the 45th base of the fourth exon of the PTGDS gene was amplified. The PCR amplification system is detailed in Table 1, and the reaction conditions are detailed in Table 2.
[0049] Forward primer PTGDS-F: ACAGAACAGCGAGGGAGGAGC (SEQ ID NO. 3), Reverse primer PTGDS-R: GCGAGGCGCACGTACTGTAGA (SEQ ID NO. 4).
[0050] Table 1 PCR amplification reaction system
[0051] Table 2 Reaction conditions for PCR amplification
[0052] Take 5 μl of PCR product and detect it by 1.5% agarose gel electrophoresis. The results are as follows: Figure 1 As shown, the amplification product yielded a single target band of 243 bp, and contained the SNP molecular marker at the 45th base site of the fourth exon of the porcine PTGDS gene.
[0053] The sequence of the amplified product is shown in SEQ ID NO.5: ACAGAACAGCGAGGGAGGAGCGGGGTGCGGGCAGGAAGCAGGGGTGGGGAGGGGACAGGGAGGGCGCGGGCAGGGACGGGAGGGCGAGGGAGCTGAGAGAGGGGAAGGCAGACGGGGGCAGC AAGGAGGAGGTGAGGGTGGTGGAGACTGACTACAAGAACTACGGGCTGCAGCACAGGGAGAGCGGGGCGAGGGCAGGGGCGGGGAAGGGCATGGGGACCGCAGTACAGTACGTGCGGGAGGC.
[0054] Or as shown in SEQ ID NO.6: ACAGAACAGCGAGGGAGGAGCGGGGTGCGGGCAGGAAGCAGGGGTGGGGAGGGGACAGGGAGGGCGCGGGCAGGGACGGGAGGGCGAGGGAGCTGAGAGAGGGGAAGGCAGACGGGGGCAGC AAGGAGGAGGTGAGGGTGGTGGAGACTGACTACGAGAACTACGGGCTGCAGCACAGGGAGAGCGGGGCGAGGGCAGGGGCGGGGAAGGGCATGGGGACCGCAGTACAGTACGTGCGGGAGGC.
[0055] 2. Nanopore sequencing and genotyping The PCR products of each sample were subjected to nanopore sequencing, and genotyping was performed directly from the sequencing data. The results are as follows: Figure 2 As shown in Table 3. The sequencing peak diagrams of different genotypes obtained are as follows. Figure 2 As shown.
[0056] Table 3. Statistical results of genotype and allele frequencies at the rs 889738 locus of the PTGDS gene on chromosome 1 in Large White pigs.
[0057] 3. Association analysis and application of the invention of molecular markers with pig birth weight and backfat thickness traits The experimental pig herd used for association analysis consisted of 182 Large White pigs. Polymorphism was detected using the direct sequencing method of PCR products established in the previous experimental example. Analysis of variance was performed using the GLM program in SAS statistical software to analyze the correlation between the three different genotypes of the porcine PTGDS gene and the traits of birth weight and backfat thickness. The additive and dominant effects of the genes were calculated using the REG program, and difference tests were performed. The model used was: in , where is the birth weight / backfat thickness phenotypic value, and μ is the population mean. This is a genotype effect. This is an inter-field effect. For gender effect, For family effect, This represents a random residual effect. Results are expressed as least squares mean ± standard error, and P < 0.05 is considered statistically significant.
[0058] The results showed that individuals with the GG / AG genotype had a significantly higher birth weight than those with the AA genotype, and the birth weight of individuals with the GG genotype was greater than that of individuals with the AG genotype. Individuals with the GG / AG genotype had a significantly lower back fat thickness than those with the AA genotype, and the back fat thickness of individuals with the GG genotype was lower than that of individuals with the AG genotype.
[0059] Table 4. Association analysis of the 45th base site of the fourth exon of the Large White pig PTGDS gene with birth weight and backfat thickness.
[0060] Note: Subordinate markers indicate significant differences in the same quality among different genotypes. Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.
Claims
1. A molecular marker characterized in that, Based on the genome version number Sscrofa11.1 GCF_000003025.6, the molecular marker is located at the 45th bp of the 4th exon of the PTGDS gene, and the polymorphism is A or G.
2. A molecular marker, characterized in that, The molecular marker comprises a nucleic acid with the nucleotide sequence shown in SEQ ID NO. 1 or SEQ ID NO. 2, and the polymorphism is at the 156th position, and the polymorphism is A or G.
3. A pair of primers, characterized in that, The primer pair is used for amplifying the molecular marker of claim 1 or 2.
4. A pair of primers, characterized in that, The primer pair comprises the nucleotide sequences shown in SEQ ID NO. 3 and SEQ ID NO.
4.
5. A kit characterized in that, The kit comprises the molecular marker of claim 1 or 2, or the primer pair of claim 3 or 4.
6. Use of the molecular marker of claim 1 or 2, or the primer pair of claim 3 or 4, or the kit of claim 5 in any of the following: (1) predicting or detecting the birth weight or backfat thickness of a pig, or preparing a reagent for predicting or detecting the birth weight or backfat thickness of a pig; (2) identifying or breeding a pig breed with high birth weight or low backfat thickness, or preparing a reagent for identifying or breeding a pig breed with high birth weight or low backfat thickness; (3) molecular marker assisted breeding of pigs; (4) pig breed improvement related to birth weight or backfat thickness; (5) improvement of pig germplasm resources.
7. A method of identifying birth weight or backfat of a pig, characterized in that, The method comprises: detecting the polymorphism of the molecular marker of claim 1 or 2 in a pig sample to be tested, and determining the birth weight or backfat thickness of the pig to be tested according to the genotype detection result.
8. The method of claim 7, wherein, The detection method comprises one or more of gene sequencing, molecular probes, liquid phase capture or mass spectrometry.
9. The method according to claim 7 or 8, characterized in that, The determination of the birth weight or backfat thickness of the pig to be tested according to the genotype detection result comprises: a pig with genotype AA has lower birth weight or higher backfat thickness than a pig with genotype AG or GG.
10. A method for breeding a pig breed with high birth weight or low backfat thickness, characterized by, The method comprises: during the breeding of a pig breed, retaining a pig with genotype AG or GG of the molecular marker of claim 1 or 2 for subsequent breeding process.