Indole-3-acetic acid biosensor as well as construction method and application thereof

By constructing an indole-3-acetic acid biosensor based on the Escherichia coli transcriptional regulatory protein MarR, the problems of sensitivity and background leakage in existing sensors were solved, achieving efficient high-throughput screening, breaking through the bottleneck of microbial production of indole-3-acetic acid, and improving production efficiency and screening accuracy.

CN121495965APending Publication Date: 2026-02-10CHINA AGRI UNIV +1
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511717713.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-11-21
Publication Date
2026-02-10

AI Technical Summary

Technical Problem

Existing indole-3-acetic acid biosensors have shortcomings in terms of sensitivity, dynamic range, and background leakage, and cannot efficiently match the endogenous environment of E. coli, making it difficult to meet the industrialization requirements in terms of the efficiency and economy of the microbial production of indole-3-acetic acid.

Method used

An indole-3-acetic acid biosensor was constructed, which utilizes the Escherichia coli transcriptional regulatory protein MarR and its endogenous promoter, combined with a fluorescent protein gene, to achieve a highly sensitive and low-noise response. High-throughput screening was performed by flow cytometry to directly convert the accumulation of intracellular products into a fluorescent signal, enabling rapid isolation of high-yielding strains.

Benefits of technology

A highly sensitive response to indole-3-acetic acid and its derivatives was achieved, background noise was reduced, and a high-throughput screening platform suitable for the synthesis pathway of indole-3-acetic acid was created, breaking through the industrialization bottleneck of microbial manufacturing and improving production efficiency and screening accuracy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121495965A_ABST
    Figure CN121495965A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of gene engineering, and particularly relates to an indole-3-acetic acid biosensor as well as a construction method and application thereof. The invention relates to an indole-3-acetic acid sensing plasmid. The plasmid carries a gene for coding a repressor protein, a promoter fragment specifically controlled by a transcription factor, a yellow fluorescent protein gene and a biosensor plasmid vector skeleton. The core of the invention lies in that the sensor has the advantages of high sensitivity, wide dynamic range and low background leakage, and can specifically respond to indole-3-acetic acid and various indole derivatives. The main application of the sensor is that the sensor is integrated into escherichia coli engineering bacteria for producing indole-3-acetic acid, so that high-yield strains can be quickly and efficiently screened from massive mutant libraries, and a key tool is provided for solving the industrialization bottleneck of indole-3-acetic acid microbiological method production.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to an indole-3-acetic acid biosensor, its construction method, and its application. Background Technology

[0002] Indole-3-acetic acid (IAA), an important plant growth hormone and microbial metabolite, has wide applications in agriculture and biomedicine. Traditional chemical synthesis methods suffer from problems such as high toxicity of raw materials, harsh reaction conditions, and environmental pollution. Microbial fermentation of IAA using recombinant *E. coli* is considered the most promising future trend to replace traditional chemical synthesis methods due to its advantages of controllable conditions, short cycle time, high yield, and environmental friendliness.

[0003] Currently, the production of indole-3-acetic acid by *E. coli* is mainly achieved by introducing or optimizing its biosynthetic pathway, the most important of which is the indole-3-pyruvate pathway. The key steps of this pathway are catalyzed by tryptophan transaminase and indole-3-pyruvate decarboxylase. Although significant progress has been made through metabolic engineering strategies (such as enhancing precursor supply and knocking out competing pathways), the industrial biomanufacturing of indole-3-acetic acid still faces several severe challenges, making it difficult to meet the needs of large-scale applications in terms of production efficiency and economics. The main problems are: (1) Insufficient activity of key enzymes. The expression level, stability and catalytic efficiency of key proteases in *E. coli* hosts are often unsatisfactory, becoming the "rate-limiting step" of the entire synthetic pathway, which seriously restricts the final yield; (2) Complex pathway balance and regulation. The expression intensity of multiple enzymes in the synthetic pathway needs to be finely coordinated. Too weak or too strong any link may lead to metabolic imbalance, resulting in the accumulation of intermediate products or waste of resources, thereby affecting the overall yield.

[0004] To address these issues, directed protein evolution technology has been widely applied to the modification of key rate-limiting enzymes (such as indole-3-pyruvate decarboxylase) to obtain high-performance mutants with higher catalytic efficiency and stronger stability. However, traditional enzyme mutant screening methods suffer from a significant bottleneck: low screening throughput. Existing screening methods typically rely on techniques such as high-performance liquid chromatography (HPLC) to detect the yield of indole-3-acetic acid, which is cumbersome, time-consuming, labor-intensive, and costly, usually only screening a few hundred clones per day, which is insufficient for screening high-throughput enzymes of up to 1000 clones. 6 Up to 10 9Matching mutant libraries with large volumes of mutants is crucial. Developing a high-throughput screening platform capable of matching such massive mutant libraries is urgently needed. The core design of this platform is to construct a genetic loop that directly links indole-3-acetic acid concentration with easily detectable reporter phenotypes (such as fluorescence intensity and resistance), and combine this with techniques such as flow cytometry (FACS) to achieve rapid sorting of millions of single cells, thereby efficiently and cost-effectively identifying high-yield strains from massive mutant libraries.

[0005] However, existing indole-3-acetic acid sensing systems are mostly designed for plant or detection applications. Directly using them for screening high-yield strains faces numerous shortcomings, including insufficient sensitivity, narrow dynamic range, and high background noise, failing to meet the demands for precise screening. Furthermore, these systems are typically not optimized for the endogenous environment of *E. coli*, resulting in low applicability and reliability in practical applications.

[0006] Therefore, developing a novel indole-3-acetic acid biosensor with high sensitivity, wide dynamic range, low background leakage, and optimized for the endogenous environment of Escherichia coli, and transforming it into an efficient high-throughput screening model, is a key prerequisite and inevitable trend for overcoming the bottleneck of microbial production of indole-3-acetic acid and realizing its industrial application. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention provides a novel indole-3-acetic acid (IAA) biosensor and its construction and application methods. It solves the deficiencies of existing IAA biosensors in terms of sensitivity, dynamic range, and background leakage, as well as their inability to efficiently match the endogenous environment of *E. coli*. This invention aims to provide a novel solution with a compact structure, strong applicability, and high-throughput screening capability, thereby overcoming the bottleneck of microbial production of IAA.

[0008] This invention provides an indole-3-acetic acid sensing plasmid, characterized in that the plasmid carries a gene encoding a repressor protein, a gray feature promoter which is an endogenous promoter of the Escherichia coli transcriptional regulatory protein MarR expressing the transcriptional regulatory protein gene, a blue feature promoter which is an amplified fragment of a promoter fragment specifically controlled by a transcription factor obtained using the Escherichia coli genome as a template expressing a fluorescent protein gene, a yellow fluorescent protein gene amplified fragment, and a biosensor plasmid vector backbone amplified fragment.

[0009] Furthermore, the repressor protein is MarR protein, the nucleotide sequence of the gene encoding the repressor protein is shown in SEQ ID NO.1, the promoter fragment amplification controlled by the transcription factor specifically is shown in SEQ ID NO.2, and the yellow fluorescent protein gene amplification is shown in SEQ ID NO.3.

[0010] Furthermore, the construction of the biosensor plasmid vector backbone is as follows: using the vector plasmid puc57 as a template, PCR amplification is performed with primer pairs SEQ ID NO.4 and SEQ ID NO.5 to obtain the plasmid vector backbone amplified product.

[0011] Furthermore, the gene encoding the repressor protein was amplified by PCR using the Escherichia coli DE3 genome as a template and primer pairs SEQ ID NO.6 and SEQ ID NO.7.

[0012] This invention provides an indole-3-acetic acid biosensor, which is a recombinant strain containing an indole-3-acetic acid sensing plasmid.

[0013] This invention provides an application of an indole-3-acetic acid biosensor in screening high-yielding strains of indole-3-acetic acid.

[0014] Furthermore, the recombinant strain uses an indole-3-acetic acid producing strain as its host.

[0015] Compared with the prior art, the present invention has the following beneficial effects:

[0016] The core innovation of this invention lies in the first-time discovery and application of the E. coli transcriptional regulatory protein MarR and its endogenous promoter to construct a highly integrated and modular indole-3-acetic acid (IDA) biosensor plasmid. This design fundamentally solves the problems of poor compatibility and high background leakage in E. coli by heterologous sensing systems, achieving high sensitivity and low noise response to IDA and its various derivatives. Simultaneously, this high-performance sensor can be applied to the directed evolution process of engineered strains, creating a "product-sensing" high-throughput screening platform suitable for the IDA synthesis pathway. This platform can directly convert the amount of intracellular product accumulation into a fluorescence signal, thereby enabling the rapid and precise separation of high-yielding strains from a massive mutant library using flow cytometry based on whether the biosensor emits a certain fluorescence. This breakthrough overcomes a key bottleneck restricting the industrialization of IDA microbial manufacturing. Attached Figure Description

[0017] Figure 1 This is a schematic diagram of the indole-3-acetic acid biosensor plasmid in Example 1.

[0018] Figure 2 This is a graph showing the relative fluorescence values ​​of the indole-3-acetic acid biosensor response in Example 3.

[0019] Figure 3 This is a graph showing the relative fluorescence values ​​(specificity) of different indole derivative responses in Example 3. Detailed Implementation

[0020] Example 1

[0021] Construction of indole-3-acetic acid biosensor plasmid

[0022] Indole-3-acetic acid biosensor plasmids were constructed using the In-Fusion technology (Novizan, China) with seamless ligation: Using primers SEQ ID NO.4 and SEQ ID NO.5 as primers, plasmid puc57 was used as a template to amplify the biosensor plasmid vector backbone amplification; using primers SEQ ID NO.6 and SEQ ID NO.7 as primers, the repressor protein gene amplification (SEQ ID NO.1) was obtained using the *E. coli* DE3 genome as a template; using primers SEQ ID NO.8 and SEQ ID NO.9 as primers, the transcription factor-specific promoter fragment amplification (SEQ ID NO.2) was obtained using the DE3 *E. coli* genome as a template; and using primers SEQ ID NO.10 and SEQ ID NO.11 as primers, the yellow fluorescent protein gene amplification (SEQ ID NO.3) was obtained using the yellow fluorescent protein gene as a template. The above biosensor plasmid vector backbone amplification, repressor protein gene amplification, promoter fragment, and yellow fluorescent protein gene amplification were sequentially ligated to obtain the following... Figure 1 The indole-3-acetic acid biosensor plasmid shown is illustrated. The primers for amplifying the repressor protein, the specific promoter, and the fluorescent protein all contain matching homologous arms.

[0023] in, Figure 1 In the diagram, the gray promoter is the endogenous promoter of the E. coli transcriptional regulatory protein MarR, expressing the gene of this transcriptional regulatory protein. The blue promoter is an amplified version of a promoter fragment specifically controlled by transcription factors obtained using the E. coli genome as a template, expressing the fluorescent protein gene.

[0024] The PCR reaction system is shown in Table 1:

[0025] Table 1

[0026]

[0027] The PCR reaction procedure is: 95℃ for 3 minutes;

[0028] 34 cycles × (95℃ 15s, 60℃ 15s, 72℃ 1min / kb);

[0029] 72℃ for 5 minutes; 4℃ for ∞.

[0030] Among them, SEQ ID NO:1 marR gene

[0031] AACTAATTACTTGCCAGGGCAACTAATGTGAAAAGTACCAGCGATCTGTTCAATGAAATTATTCCATTGGGTCGCTTAATCCATATGGTTAATCAGAAGAAAGATCGTCTGCTTAACGAGTATCTGTCTCCGCTGGATATTACTGCGGCACAGTTTAAGGTGCTCTGCTCTATCCGCTGCGCGGCGTGTATTACTCCGGTTGAACTGAAAAAAGTGTTGTCGGTCGACCTGGGAGCACTGACCCGTATGCTGGATCGCCTGGTCTGTAAAGGCTGGGTGGAAAGGTTGCCGAACCCGAATGACAAGCGCGGCGTACTGGTAAAACTTACCACCGGCGGCGCGGCAATATGTGAACAATGCCATCAATTAGTTGGCCAGGACCTGCACCAAGAATTAACAAAAAACCTGACGGCGGACGAAGTGGCAACACTTGAGTATTTGCTTAAGAAAGTCCTGCCGTAA;

[0032] SEQ ID NO:2 ycN promoter

[0033] CCCTGCGATTAATTTAACGAATAGTGCGTTTTACTGCGACATGTCATTCACACAATGAATACATAAGGTAAAAAAAGCACATTATGCAAAATTCATTATCTAATTGAAAAAACTAGAATTAACGATAAATAACCGTATTTTTAATTCTTTTTTGTTATTAAAACTCACACTTTTAACACTTAGTATCAACTGAAACAGTTAGCGTGGTATTAATTAGTTCAATAATTAGTGTATACTTGATTTTGTGATATGGGTCACGAAACAAAGACCCAGCTAAAAGATTATGTCGAGGTAAAAATC;

[0034] SEQ ID NO:3 Yellow fluorescent protein

[0035] ;

[0036] SEQ ID NO:4

[0037] GGGCCTTTCTGCGTTTATAGAACTAATTACTTGCCAGGGCAACTAATG;

[0038] SEQ ID NO:5

[0039] AGAGAATATAAAAAAGCCAGATTATTAATCC;

[0040] SEQ ID NO:6

[0041] GGGCCTTTCTGCGTTTATAGAACTAATTACTTGCCAGGGCAACTAATG;

[0042] SEQ ID NO:7

[0043] AATCGCAGGGTTACGGCAGGACTTTCTTAAGCAAATACT;

[0044] SEQ ID NO:8

[0045] CCTGCCGTAACCCTGCGATTAATTTAACGAATAGTGC;

[0046] SEQ ID NO:9

[0047] CTTTACGCATGATTTTTACCTCGACATAATCTTTTAGCTGGG;

[0048] SEQ ID NO:10

[0049] GGTAAAAATCATGCGTAAAGGCGAAGAGCT;

[0050] SEQ ID NO:11

[0051] TCTGGCTTTTTATATTCTCTTCATCATTTGTACAGTTCATCCATACCATGC.

[0052] Example 2

[0053] Preparation of chemically competent Escherichia coli

[0054] Escherichia coli DE3 was streaked onto antibiotic-free LB medium and activated overnight at 37°C. The next day, it was inoculated at 1% onto 50 mL of liquid LB medium and cultured at 37°C and 220 rpm. When OD... 600 When the pH reaches 0.6, stop the culture and immediately place the culture on ice to cool (until the next experiment). Then transfer the bacterial culture to a pre-chilled 50 mL centrifuge tube, centrifuge at 3500 rpm for 10 min, discard the supernatant, and collect the bacterial cells into an EP tube. Wash the bacterial cells twice with 25 mL of pre-chilled sterile 0.1 M CaCl2, centrifuge at 3500 rpm for 10 min, discard the supernatant again, and collect the bacterial cells. Finally, resuspend the bacterial cells in 2 mL of pre-chilled 0.1 M CaCl2 (containing 10% glycerol), and aliquot 100 μL into pre-chilled 1.5 mL centrifuge tubes to obtain chemocompetent Escherichia coli DE3 cells.

[0055] The process of transferring the indole-3-acetic acid biosensor plasmid into competent E. coli is as follows:

[0056] Prepare the following system on ice: First, add 4 µL of the indole-3-acetic acid biosensor plasmid constructed in Example 1 to a PCR tube, then add 50 µL of the prepared E. coli DE3 chemically competent cells (the plasmid should not exceed 10% of the competent cell volume; the competent cells should be thawed on ice and added immediately after thawing). Gently pipette to mix. Incubate the plasmid and E. coli competent cell mixture at 4 ℃ for 30 min, and adjust the water bath to 42 ℃ for heat shock. Heat shock at 42 ℃ for 60-90 s (strictly control the time), and immediately after heat shock, incubate on ice for 2-3 min. Then, inoculate all the transformation products into SOC medium dispensed into 1.5 mL centrifuge tubes and incubate at 37 ℃. Centrifuge the cultured bacterial solution at 10000 r / min for 1 min, discard the supernatant (retain 50-100 µL), resuspend the bacterial cells, and then spread them onto the corresponding antibiotic solid medium. Incubate upside down in a bacterial incubator at 37 ℃ for 12-16 h.

[0057] Example 3

[0058] Indole-3-acetic acid biosensor fluorescence detection

[0059] Transformed *E. coli* were inoculated into antibiotic-free LB medium and activated overnight at 37°C. The next day, 1% of the culture was inoculated into 50 mL of liquid LB medium containing ampicillin (100 μg / mL), with the appropriate concentration (1-3 μm detection range for the biosensor) of indole-3-acetic acid added simultaneously. The culture was incubated at 30-37°C and 220 rpm. After 30 h of incubation, 200 μL of the bacterial culture was added to each well of a 96-well microplate. The fluorescence intensity was detected using a multi-mode microplate reader (sYFP fluorescence detection: excitation wavelength 503 nm, emission wavelength 540 nm). The optical density (OD) of the bacterial culture was measured using a UV spectrophotometer. 600 The fluorescence intensity was compared with the OD 600 The ratio (RFU) is used as a correction fluorescence intensity (e.g. Figure 2 , 3 (As shown). This biosensor can identify IAA and emit fluorescence.

[0060] Figure 2 Since temperature affects the expression of fluorescent proteins, this study investigated whether lowering the temperature could improve the response performance of the IAA biotransmitter. Recombinant *E. coli* was cultured at 37 °C. When the bacterial cell OD... 600 When the value was 0.6, 3 mM IAA was added for protein induction. The effect of temperature on the expression of the fluorescent protein gene sYFP was studied by adjusting different induction temperatures (30 ℃ and 37 ℃). The experimental results are as follows. Figure 2The expression of the fluorescent protein gene sYFP did not differ significantly between induction temperatures of 30 ℃ and 37 ℃, therefore 37 ℃ was chosen as the induction temperature.

[0061] Figure 3 The ligand specificity of the indole-3-acetic acid biosensor based on the promoter specific control of transcription factors was further verified. 3 mM of compounds with structures similar to indole-3-acetic acid, including sodium indole-3-acetate, potassium indole-3-acetate, indole-3-propionic acid, and indole-3-butyric acid, were added to the culture medium, and their fluorescence density was measured after culturing. The results are shown in the figure. The reporter strain responded to sodium indole-3-acetate, potassium indole-3-acetate, indole-3-propionic acid, and indole-3-butyric acid. This indicates that the indole-3-acetic acid biosensor based on the promoter specific control of transcription factors can respond not only to indole-3-acetic acid but also to several other indole derivatives. This is of great significance for screening high-yielding strains of other indole derivatives.

[0062] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. An indole-3-acetic acid sensing plasmid, characterized in that, The plasmid carries a gene encoding a repressor protein, an endogenous promoter of the E. coli transcriptional regulatory protein MarR, an amplified promoter fragment specifically controlled by transcription factors obtained using the E. coli genome as a template, an amplified yellow fluorescent protein gene, and an amplified biosensor plasmid vector backbone. Wherein, the repressor protein is MarR protein, the nucleotide sequence of the gene encoding the repressor protein is shown in SEQ ID NO.1, the promoter fragment amplification controlled by the transcription factor specifically is shown in SEQ ID NO.2, and the yellow fluorescent protein gene amplification is shown in SEQ ID NO.

3.

2. The indole-3-acetic acid sensing plasmid according to claim 1, characterized in that, The biosensor plasmid vector backbone amplification was constructed as follows: using recombinant Escherichia coli puc57 as a template, PCR amplification was performed using primer pairs SEQ ID NO.4 and SEQ ID NO.

5.

3. The indole-3-acetic acid sensing plasmid according to claim 1, characterized in that, The gene encoding the repressor protein was amplified by PCR using Escherichia coli DE3 genome as a template and primer pairs SEQ ID NO.6 and SEQ ID NO.

7.

4. An indole-3-acetic acid biosensor, characterized in that, The recombinant strain contains the indole-3-acetic acid sensing plasmid as described in any one of claims 1-3.

5. The application of the indole-3-acetic acid biosensor according to claim 4 in screening high-yielding strains of indole-3-acetic acid.

6. The indole-3-acetic acid biosensor as described in claim 4, characterized in that, The recombinant strain was derived from Escherichia coli.