SNP molecular marker and KASP primer closely linked to sweet potato purple leaf trait
By designing KASP primer sets and SNP molecular markers, the early genotyping problem of purple leaf traits in sweet potato breeding was solved, enabling accurate and high-throughput screening of sweet potato leaf color and supporting the breeding and variety identification of leafy sweet potatoes with high anthocyanin content.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SAAS BIOTECH & NUCLEAR TECH RES INST
- Filing Date
- 2026-01-05
- Publication Date
- 2026-06-19
AI Technical Summary
Existing technologies lack efficient and stable molecular markers for the purple leaf trait in sweet potato breeding, especially for accurate typing during the seedling stage, which makes it difficult to achieve early selection and high-throughput screening in breeding.
A KASP primer set was designed, including the nucleotide sequences of SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 3, for genotyping of sweet potato leaf color traits. Sweet potato samples were amplified and genotyped using the KASP kit, and the genotype was determined by the C/T polymorphism of the SNP molecular marker located at position 23643389bp on sweet potato chromosome 12.
This study enables early, high-throughput, and low-cost molecular marker-assisted selection of the purple leaf trait in sweet potatoes, accurately distinguishing between purple and green leaves, and supporting the breeding and purity identification of leafy sweet potato varieties with high anthocyanin content.
Smart Images

Figure CN121496097B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology, specifically relating to an SNP molecular marker and KASP primers closely linked to the purple leaf trait of sweet potato, and their usage. Background Technology
[0002] Sweet potato is an important dual-purpose crop for both food and vegetables globally. However, as an asexually reproduced allohexaploid crop, it possesses a large genome, high heterozygosity, and a complex genetic background, resulting in slow progress in molecular biology research and breeding techniques, lagging far behind major diploid crops such as rice and maize. This complexity makes the development of efficient and reliable molecular marker tools suitable for sweet potato particularly important and challenging. Early first-generation (e.g., RAPD) and second-generation (e.g., SSR) molecular markers widely used in sweet potato have limitations such as low throughput, poor polymorphism, or low automation, making them insufficient to meet the demands of modern high-precision and high-efficiency breeding. With the development of sequencing technology, third-generation molecular markers based on single nucleotide polymorphisms (SNPs) have become mainstream. SNP markers are widely distributed in the genome, have high density, good genetic stability, and are more directly associated with phenotypic traits, providing a new breakthrough for genetic research on complex genomes such as sweet potato. Despite the significant advantages of SNP markers, the choice of genotyping techniques directly affects the breadth of their application. Among various SNP genotyping techniques, competitive allele-specific PCR, due to its use of a universal fluorescent reporter system, has a significant cost advantage compared to methods like TaqMan that require customized site-specific probes. Furthermore, its high accuracy and high throughput make it ideal for genotyping in large-scale breeding populations. Unfortunately, such effective, trait-specific markers are particularly scarce in sweet potatoes.
[0003] Currently, reported molecular markers for the purple trait in sweet potato are all focused on anthocyanin content in tubers. However, no usable co-segregating markers have been found for the purple leaf trait, which plays an important indicative role in breeding practice, making early selection impossible. This trait is not only rich in high-value antioxidant components but is also a dominant morphological marker that can be identified at the seedling stage, indicating great breeding potential. However, its practical application faces two challenges: phenotypically, it is heavily influenced by the developmental transition from "purple young leaves to green mature leaves" and environmental factors, resulting in a narrow traditional visual selection window and a high misjudgment rate; genetically, due to the complexity of the sweet potato hexaploid genome, the purple trait may be controlled by multiple loci, and its dominant-recessive relationship is easily modified in the context of hybridization, causing a serious disconnect between the phenotype and the true genetic composition. Therefore, developing specific KASP markers that can stably and accurately genotype the trait at the seedling stage (including the cotyledon stage) has become an urgent need to overcome the bottleneck in breeding purple leaf traits and fill the technological gap in this field.
[0004] According to extensive literature and patent database searches, there are relatively few functional molecular markers developed for important traits of sweet potato, and there are no reports on single nucleotide polymorphism molecular markers specifically based on competitive allele-specific PCR typing technology for auxiliary selection of purple leaf traits in sweet potato. Summary of the Invention
[0005] The technical problem to be solved by this invention is to provide an SNP molecular marker associated with the purple leaf trait of sweet potato and its KASP primers.
[0006] The technical solution of the present invention is: a KASP primer set, wherein the primer set consists of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 3.
[0007] A kit containing the KASP primer set described above.
[0008] The application of the aforementioned KASP primer set or kit in the auxiliary breeding or identification of sweet potato leaf color traits.
[0009] Furthermore, the genomic DNA of the sweet potato sample is amplified and genotyped using the KASP primer set or kit. Based on the genotyping results, if the sample is CT heterozygous, the leaves of the sweet potato sample are purple; if the sample is TT homozygous, the leaves of the sweet potato sample are green.
[0010] Application of SNP molecular markers in assisted breeding or identification of sweet potato leaf color traits. The SNP molecular marker is located at position 23643389 bp on sweet potato chromosome 12, and the reference gene is in version [version number missing]. Ipomoea trifida (NSP306)Genome Assembly (v3) has a C / T polymorphism at this position. When the genotype is CT heterozygous, the sweet potato leaves are purple, and when the genotype is TT homozygous, the sweet potato leaves are green.
[0011] Compared with the prior art, the present invention has the following beneficial effects:
[0012] This invention first uses extreme pooled genome sequencing technology to analyze a genetic segregating population constructed from pure purple leaf material, identifying a SNP locus co-segregating with the purple leaf trait in sweet potato. Then, molecular marker primers specifically designed for this locus on the KASP platform were developed. Experimental verification showed that this marker can achieve stable and accurate genotyping in F1 segregating populations, with the genotyping results highly consistent with the purple leaf phenotype. This KASP marker can be used for early, high-throughput, and low-cost marker-assisted selection of the purple leaf trait in sweet potato, and can be applied to the breeding and purity identification of leafy sweet potato varieties with high anthocyanin content. Attached Figure Description
[0013] Figure 1 The results of KASP primer pair typing of the tested population materials. Detailed Implementation
[0014] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were all purchased from commercial channels.
[0015] Example 1: Screening of target SNP sites and design of KASP primers
[0016] (1) Construction of genetic populations and extreme mixed pools: This invention uses a single sweet potato material with stable genetic inheritance as the maternal parent. This material is a whole-plant purple type, and all above-ground tissues such as stems, petioles, and leaves exhibit a stable and uniform deep purple color throughout the entire growth period. Due to the self-incompatibility of sweet potato and the large barriers to interspecific hybridization, this study could not designate a single paternal parent. Therefore, using this purple maternal parent, it was subjected to uncontrolled pollination with a field population of mixed pollen from green leaves to construct an F1 genetically segregating population. In this population, phenotypic identical extreme purple leaf plants and extreme green leaf plants were selected, DNA was extracted and mixed in equal amounts to construct purple leaf mixed pools (purple leaf pools) and green leaf mixed pools (green leaf pools).
[0017] (2) Pooled sequencing and association analysis: High-throughput sequencing was performed on the two extreme pooled sequencing and the purple parent. The obtained sequencing data were compared with the reference genome of *Ipomoea quamoclit* with three shallow lobes. Ipomoea trifida The sequencing data was compared using the (NSP306) Genome Assembly (v3), https: / / sweetpotato.uga.edu / download_v3 / , to perform quality control and screen for high-quality SNP loci. Based on this, SNP loci that were heterozygous in the purple-leafed pond and homozygous in the green-leafed pond were further screened. By analyzing the distribution of these loci across the genome, genomic regions with significantly enriched candidate loci were located, and combined with gene annotation information, the core candidate SNP loci associated with the purple leaf trait were finally determined.
[0018] From the above candidate sites, the optimal SNP site was selected: this SNP site is located at... Morning glory trifidaThe (NSP306) Genome Assembly (v3) genome shows a SNP at position 23,643,389 of Chr12, where the genotype and leaf color trait completely co-segregate: the purple maternal parent and all purple-leaved individuals are C / T heterozygous, while all green-leaved individuals are T / T homozygous. In the purple-leaved pool, the ratio of reference base (C) to variant base (T) in the sequencing reads of this locus is approximately 1:5; in the purple maternal parent, this ratio is approximately 1:4.
[0019] (3) KASP primer design: Based on its flanking sequence, primer design software, primers (F1, F2) specifically targeting the two alleles of the SNP and a universal downstream primer (R) were designed.
[0020] F1: TCATCTGAATCAGGGCACGAC (SEQ ID No.1)
[0021] F2: TCATCTGAATCAGGGCACGAT (SEQ ID No. 2)
[0022] R: TCATCCTTTGGTGGTTGCTG (SEQ ID No.3)
[0023] Example 2 Synthesis of KASP molecular marker primers
[0024] The specific KASP primers designed in Example 1 were modified by adding the KASP reagent-recommended probe sequence to the 5' end of the forward primer. The specific processing method is as follows: GAAGGTGACCAAGTTCATGCT was added to the 5' end of the F1 sequence, and GAAGGTCGGAGTCAACGGATT was added to the 5' end of the F2 sequence. The primers developed in this invention were synthesized at Sangon Biotech (Shanghai) Co., Ltd.
[0025] KASP-F1: GAAGGTGACCAAGTTCATGCTTCATCTGAATCAGGGCACGAC (SEQ ID No. 4)
[0026] KASP-F2: GAAGGTCGGAGTCAACGGATTTCATCTGAATCAGGGCACGAT (SEQ ID No. 5)
[0027] KASP-R: TCATCCTTTGGTGGTTGCTG
[0028] Example 3: KASP molecular marker verification
[0029] (1) Material preparation: Collect 120 tender leaves, the composition of which is as follows:
[0030] 1) F1 segregating population: The whole plant is purple and the trait is stable, which is used in this invention as the purple maternal parent. It is obtained by open pollination (mixed pollen, and it is impossible to specify a single male parent); the leaf color of the offspring plants is purple-green segregated and there is no bloodline duplication, which is used to verify the co-segregation of markers.
[0031] 2) Green control material: Sweet potato plants with consistently green leaf color observed over many years were used as homozygous background controls.
[0032] (2) DNA extraction: Take 2g of fresh young leaves, grind them into a fine powder with liquid nitrogen, and then preheat to 65℃ to extract DNA from the test material using the CTAB method. Dissolve the DNA in 1×TE solution. Add RNase to a final concentration of 100μg / μl. Perform 1% agarose gel electrophoresis at a constant voltage of 100 V for 30 minutes to detect DNA concentration and quality.
[0033] (3) PCR amplification and genotyping analysis, the specific methods are as follows:
[0034] The reaction system is as follows:
[0035]
[0036] PCR amplification conditions are as follows:
[0037]
[0038] The PCR reaction and result detection and analysis of this invention were performed on a water bath PCR instrument and a high-speed fluorescence scanner produced by Chengdu Hanchen Guangyi Biotechnology Co., Ltd.
[0039] (4) Genotyping of amplification products: High-speed fluorescence scanner and data analysis software (Chengdu Hanchen Guangyi Technology Co., Ltd.) were used to scan and analyze the primer PCR amplification products of 120 materials. The genotyping results are shown below (primer scanning genotyping results are shown below). Figure 1 (As shown in the image). The results show that KASP genotyping clearly divided all tested materials into two genotype clusters. The genotype cluster located between the FAM and HEX channels is C / T heterozygous, corresponding to the purple leaf phenotype; the genotype cluster located in the HEX channel is T / T homozygous, corresponding to the green leaf phenotype. The genotyping results were completely consistent with the actual phenotypes observed in the field, proving that this marker can accurately distinguish the genotypes of the purple leaf trait in sweet potatoes.
Claims
1. Application of KASP primer set in assisted breeding or identification of sweet potato leaf color trait, wherein the KASP primer set consists of the nucleotide sequences shown in SEQ ID No. 4, SEQ ID No. 5 and SEQ ID No. 3; the genomic DNA of sweet potato samples is amplified and genotyped using the KASP primer set or kit, and the genotype results are used to determine: if it is CT heterozygous, the leaves of the sweet potato sample are purple; if it is TT homozygous, the leaves of the sweet potato sample are green.