CSE inhibitors for treatment of tumors in combination with MAPK inhibitors

By combining CSE inhibitors with MAPK inhibitors for BRAF V600-mutant cancers, the problem of existing technologies being unable to prevent or delay resistance to MAPK inhibitors in BRAF V600-mutant cancers has been solved, resulting in better treatment outcomes and extended survival.

CN121532191APending Publication Date: 2026-02-13NATIONAL CANCER INSTITUTE
View PDF 6 Cites 0 Cited by

Patent Information

Application Number
CN202480045688.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-02-22
Filing Date
2024-07-03
Publication Date
2026-02-13

AI Technical Summary

Technical Problem

Current technologies cannot effectively prevent or delay the acquired resistance of BRAF V600 mutant cancers to MAPK inhibitors, especially in melanoma. Existing combination therapies such as EP3563870A1, WO2015004636A1, WO2015161230A1, WO2021171260A2, and WO2022259157A1 have failed to effectively prevent the development of resistance.

Method used

Combining cystathionine-γ-lyase (CSE) inhibitors with MAPK inhibitors, especially BRAF V600 mutation inhibitors, can be used to treat BRAF V600 mutation-positive cancers and prevent or delay the development of resistance to MAPK inhibitors.

Benefits of technology

It delayed or prevented the acquired resistance of BRAF V600 mutant cancers to MAPK inhibitors, improved treatment response, prolonged progression-free survival and overall survival, and reduced adverse reactions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121532191A_ABST
    Figure CN121532191A_ABST
Patent Text Reader

Abstract

The present invention relates to a cystathionine-gamma-lyase (CSE) inhibitor for use in combination with MAPK inhibitor (s), in particular a BRAF V600 mutation inhibitor, in the treatment of cancer, preferably a tumor, in a patient, preferably for preventing or delaying the development of the patient's resistance to a MAPK inhibitor, in particular a BRAF V600 mutation inhibitor, for the treatment of said cancer. The invention also relates to combination therapies, as well as to pharmaceutical compositions, combinations and kits for use in such therapies, as well as to diagnostics as desired.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a cystathionine-γ-lyase (CSE) inhibitor, in combination with one or more MAPK inhibitors, particularly BRAF V600 mutation inhibitors, for the treatment of cancer, preferably tumors, particularly melanoma, in patients, preferably for the prevention or delay of the development of resistance to treatment of said cancer using said MAPK inhibitor. If diagnostic needs are required, the invention also relates to combination therapies, and pharmaceutical compositions, combinations, and kits for such therapies. Background Technology

[0002] Cutaneous melanoma is the deadliest form of skin cancer. While early diagnosis can improve survival, the overall prognosis is poor due to rapid disease progression and frequent distant metastases. The most common oncogenic mutations driving tumor formation occur in the BRAF, NRAS, and NF1 genes. Approximately 50% of cutaneous melanoma patients carry the V600E activating mutation in the serine / threonine protein kinase B-raf (Braf) oncogene, which leads to overactivation of the MAPK / ERK pathway, resulting in uncontrolled proliferation of cancer cells (Davies et al., 2002). Vemurafenib (V therapy) was the first FDA-approved targeted therapy for Braf V600E-mutant melanoma, exhibiting a high response rate; however, unfortunately, tumors rapidly develop resistance (Sosman et al., 2012). Dabrafenib combined with inhibition of V600E mutant Braf, and trametinib combined with inhibition of downstream bispecific mitogen-activated protein kinase 1 / 2 (MEK1 / 2, also known as MAP2K1 / 2) (DT-therapy) can prolong progression-free survival and overall survival, but resistance to this combination therapy is almost inevitable (Manzano et al., 2016; Prahalad et al., 2012; Robert et al., 2015; Sosman et al., 2012; Sun et al., 2014).

[0003] It is increasingly recognized that treatment resistance in various cancers is associated with extensive reprogramming of metabolic pathways in cancer cells (Luis et al., 2020; Yoo and Han, 2022). The rapid proliferative capacity of melanoma cells benefits from enhanced aerobic glycolysis (Hall et al., 2013), which is promoted by activation of the Braf / MEK / ERK pathway induced by the BRAFV600E mutation (Haq et al., 2013). Conversely, BrafV600E inhibition induces significant metabolic changes in melanoma cells. This includes a shift from aerobic glycolysis to enhanced mitochondrial respiration, leading to the production of reactive oxygen species (ROS) and resulting in altered redox environments (Corazao-Rozas et al., 2016). The aim of this study is to elucidate the potential mechanistic aspects that may link this increased ROS production to the formation of resistance to dabrafenib / trametinib (DT) and vemurafenib (V) therapies.

[0004] The inventors have discovered that the transsulfurization pathway dedicated to the production of cysteine ​​from methionine plays a crucial role in this process. In addition to its classic function of producing cysteine, the transsulfurases cystathionine-β-synthase (CBS) and cystathionine-γ-lyase (CSE) are also key players in the biosynthesis of small signal molecules such as hydrogen sulfide and cysteine ​​persulfates (Ida et al., 2014; Kumar and Banerjee, 2021). The important functions of these reactive sulfur species (RSS) in human physiology and pathology have recently been revealed, making them a focus of redox biomedical research (Cirino et al., 2023; Cortese-Krott et al., 2017; Wallace and Wang, 2015; Wang et al., 2021). In addition, their carcinogenic functions are increasingly recognized (Coletta et al., 2012; Czikora et al., 2022; Erdelyi et al., 2021; Pavlova et al., 2022; Szabo, 2016).

[0005] In most targeted therapies that block driver oncogenes (such as BRAF V600E), cancer cells can develop acquired resistance through continuous administration (Sosman et al., 2012). Acquired resistance to treatment remains an unresolved problem in cancers such as melanoma, and solutions to overcome or prevent this resistance are crucial for further advancements in the treatment of melanoma and other tumors.

[0006] EP3563870A1 discloses a PD-1 axis binding antagonist for treating or delaying the progression of melanoma resistant to BRAF antagonists, wherein the PD-1 axis binding antagonist is administered in combination with a MEK inhibitor. However, this combination therapy does not prevent the development of resistance to BRAF inhibitors.

[0007] WO2015004636A1 discloses a method for treating melanoma, comprising administering a cyclin-dependent kinase (CDK) inhibitor and a BRAF inhibitor and / or a MEK inhibitor to a subject requiring treatment. The melanoma being treated may be BRAF-resistant mutant melanoma. However, this method does not prevent the development of resistance to BRAF / MEK inhibitors.

[0008] WO2015161230A1 discloses a method for treating an individual's cancer, comprising administering a MAPK inhibitor and one or more AXL inhibitors, Met inhibitors, and PI3K inhibitors. In one aspect, the present invention relates to a method for reducing resistance to MAPK inhibitors, the method comprising administering a MAPK inhibitor and an AXL inhibitor. The cancer may be carcinoma, sarcoma, leukemia, breast cancer, melanoma, lung cancer, etc.

[0009] WO2021171260A2 discloses a triplet therapy combination comprising dabrafenib, an ERK inhibitor, and a RAF inhibitor or PD-1 inhibitor for the treatment of cancers such as breast cancer, melanoma, or non-small cell lung cancer. This triplet combination is particularly effective in treating colorectal cancer (including advanced or metastatic colorectal cancer) with BRAF gain-of-function mutations or BRAF V600E / D / K mutations. The ERK inhibitor can target multiple resistance mechanisms of BRAF and MEK inhibitors, potentially circumventing resistance.

[0010] WO2022259157A1 discloses a triplet combination therapy comprising dabrafenib, trametinib, and an SHP2 inhibitor for the treatment of cancers such as breast cancer, melanoma, or non-small cell lung cancer. The SHP2 inhibitor is (3S,4S)-8-(6-amino-5-((2-amino-3-chloropyridin-4-yl)thio)pyrazin-2-yl)-3-methyl-2-oxa-8-azaspiro[4.5]decane-4-amine. This triplet combination is particularly effective in treating colorectal cancers (including advanced or metastatic colorectal cancers) with BRAF gain-of-function mutations or BRAF V600E mutations. This triplet combination has the potential to uniquely target the intrinsic and acquired resistance mechanisms of BRAF V600-driven cancer cells.

[0011] Currently, the combination of vemurafenib with cobimetinib, dabrafenib with trametinib, or encorafenib with binimetinib is the most widely used combination targeted therapy for patients with V600-mutant melanoma (based on Giunta et al., 2020).

[0012] Studies by Jiang et al. (Jiang et al., 2023) have shown that AOAAs can enhance the antitumor (colorectal cancer) effects of regorafenib. However, the authors used AOAAs to inhibit PSAT1 and noted the need for a more specific PSAT1 inhibitor because AOAAs lack sufficient specificity. This paper confirms that AOAAs act through PSAT1 and affect cellular metabolism in multiple ways. Equally important, as shown by Jiang et al., AOAAs are not selective CSE inhibitors. Therefore, in the context of Jiang et al., AOAAs cannot be considered CSE inhibitors, and those skilled in the art should not draw different guidance from the research of Jiang et al. Furthermore, the inventors have found that even at concentrations 10-20 times higher than those used by Jiang et al., untreated BRAF V600 mutant melanomas are insensitive to AOAAs.

[0013] Sun et al. (Sun et al., 2016) proposed that PAG with CSEi activity enhances the anticancer effect of sorafenib in hepatocellular carcinoma (HCC), but also indicated that the underlying mechanism is mediated through the metallothionein-1G (MT-1G) protein. The results showed that sorafenib induces MT-1G, which is crucial for acquired resistance to sorafenib in HCC cells by inhibiting sorafenib-induced cell death (ferroptosis); furthermore, the study also showed that PAG inhibits metallothionein synthesis, and PAG treatment leads to a decrease in MT-1G levels.

[0014] The typical and atypical functions of CSE suppressed by PAG have not been investigated at all.

[0015] Furthermore, sorafenib is not specifically targeted at Braf V600E. It inhibits not only the mutant protein that promotes proliferation in melanoma cells but also wild-type Braf proteins that perform important physiological functions, exhibiting a mechanism of action distinct from specific BRAF V600 inhibitors. In addition, sorafenib targets several other signaling proteins, including VEGFR, PDGFR, c-Kit, and RET, which play crucial roles in the regulation of cell proliferation and angiogenesis. Moreover, sorafenib has been shown to inhibit the cysteine-glutamate antitransporter, which is responsible for cysteine ​​uptake, essential for cellular cysteine ​​supply. Therefore, in the study published by Sun et al., they used sorafenib, which may inhibit cysteine ​​uptake, in combination with a CSE inhibitor (responsible for limiting or inhibiting CSE uptake outside the cell to produce cysteine). Thus, Sun et al. did not mention the potential for resistance to targeted therapy because the two drugs have distinctly different mechanisms of action.

[0016] Therefore, it cannot be inferred that CSE inhibition also has a beneficial effect on resistance to Braf V600 / MAPK inhibitors.

[0017] Studies by Liu et al. (Liu et al., 2021) have shown that I194496 inhibits the growth of triple-negative breast cancer (TNBC).

[0018] Wang et al. (Wang et al. 2019) discovered that compound I157172 inhibits breast cancer metastasis.

[0019] Li et al. (Li et al., 2021) reviewed the progress in controlling breast cancer using H2S-producing enzyme inhibitors and showed that CSE inhibitors I194496, I157172, PAG, BCA, and AVG have anticancer activity.

[0020] While Liu et al. (Liu et al., 2021), Wang et al. (Wang et al., 2019), and Li et al. (Li et al., 2021) reported the anticancer effects of CSE inhibition in certain tumors, none of these publications described the antitumor effects of CSE inhibitors in BRAF V600 mutant tumors or melanoma. The inventors have discovered that in untreated BRAF V600 mutant melanoma, inhibition of CSE has no anti-tumor effect, and the same is true when combined with BRAFV600E / MAPK inhibitors. However, unexpectedly, the study found that inhibiting CSE delayed the development of acquired resistance to BRAF V600E and MAPK inhibitors.

[0021] While existing technologies have made progress in finding treatments for resistant cancers or preventing the development of resistance to cancer drugs, we still need solutions that can prevent or at least delay the development of resistance in cancer therapies.

[0022] This invention provides a novel solution for treating cancer, particularly by preventing and / or delaying the development of resistance to known cancer therapies. This solution is based on the discovery of the molecular mechanisms underlying resistance to MAPK inhibitors, particularly BRAF inhibitors and / or MEK inhibitors. Brief Description of the Invention The existing technology does not disclose the use of CSE inhibitors in combination with MAPK inhibitors for BRAF V600 mutation-positive cancers to prevent or delay the occurrence / development of acquired resistance to treatment of BRAF V600 mutation-positive cancers.

[0023] The inventors unexpectedly discovered that inhibiting CSE is beneficial in preventing resistance caused by MAPK inhibitor treatment in BRAF V600 mutation-positive cancers, while CSE inhibitors alone or in combination with BRAF V600E / MAPK inhibitors have no anti-tumor effect on untreated BRAF V600 mutation-positive melanoma.

[0024] 1. The present invention relates to a cystathionine-γ-lyase (CSE) inhibitor, which, in combination with one or more MAPK inhibitors, particularly a BRAF V600 mutant MAPK inhibitor, is used to treat BRAF V600 mutation-positive cancers, preferably BRAF V600 mutation-positive tumors, in patients, and preferably to prevent or delay the occurrence or development of resistance in said patients to treatment of said cancer using said MAPK inhibitor.

[0025] Preferably, the MAPK inhibitor includes a BRAF V600 inhibitor, particularly a specific inhibitor of the BRAF V600 mutation. More preferably, the mutation is selected from the group consisting of: V600D, V600K, V600R, or V600E; more preferably V600K or V600E; and even more preferably V600E.

[0026] Preferably, the MAPK inhibitor includes BRAF inhibitors, especially inhibitors of BRAF V600 mutations, and / or MEK inhibitors.

[0027] The present invention also relates to a cystathionine-γ-lyase (CSE) inhibitor for the prevention or delay of the development or progression of resistance to cancer treatment using one or more MAPK inhibitors, preferably in patients treated with said one or more MAPK inhibitors.

[0028] The present invention also relates to a cystathionine-γ-lyase (CSE) inhibitor for use in treating patients who are treated with one or more MAPK inhibitors and who are resistant to or at risk of developing resistance to the one or more MAPK inhibitors.

[0029] The present invention also relates to a combination of a cystathionine-γ-lyase (CSE) inhibitor and one or more MAPK inhibitors, used in the treatment of cancer in patients to prevent or delay the development or progression of resistance to the one or more MAPK inhibitors.

[0030] The term "one or more MAPK inhibitors" can be replaced with "MAPK inhibitor". Resistance to the one or more MAPK inhibitors is preferably understood as resistance to at least one of the one or more MAPK inhibitors, and includes resistance to each of the one or more MAPK inhibitors. Preferably, the cancer is a tumor.

[0031] Preferably, the patient is a mammalian patient, and more preferably a human patient.

[0032] In a specific implementation, the BRAF inhibitor is different from sorafenib.

[0033] In a specific implementation, the CSE inhibitor is different from aminooxyacetic acid (AOAA).

[0034] 2. In a preferred embodiment, the CSE inhibitor for the application according to paragraph 1, wherein the cancer (preferably tumor) is selected from the group consisting of: melanoma, skin cancer, epithelial cancer, colorectal cancer, colon cancer, rectal cancer, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumors, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilmes tumor), histiocytosis, Langerhans cell histiocytosis, and Erdheim-Chester disease.

[0035] Preferred cancer types include melanoma, colorectal cancer, colon cancer, rectal cancer, and lung cancer.

[0036] The preferred candidate is melanoma.

[0037] 3. In a preferred embodiment, the MAPK inhibitor is a BRAF V600 mutation inhibitor and / or a MEK inhibitor.

[0038] Preferably, the one or more MAPK inhibitors include BRAF inhibitors, especially inhibitors of BRAF V600 mutations.

[0039] Preferably, The MAPK inhibitors include inhibitors of BRAF V600 mutations, and / or The MAPK inhibitors include BRAF V600 mutation inhibitors and / or MEK inhibitors.

[0040] Therefore, the present invention preferably relates to A cystathionine-γ-lyase (CSE) inhibitor, used to prevent or delay the development / progression of resistance to cancer treatment using a BRAF V600 inhibitor, preferably in patients treated with a BRAF inhibitor; and / or A cystathionine-γ-lyase (CSE) inhibitor for the treatment of patients treated with BRAF V600 inhibitors who are resistant to or at risk of developing resistance to one or more of the BRAF V600 and MEK inhibitors; and / or A combination of cystathionine-γ-lyase (CSE) inhibitors and BRAF inhibitors is used to treat cancer patients to prevent or delay the development or progression of resistance to the BRAF inhibitors.

[0041] Preferably, the cancer is a tumor, more preferably a BRAF mutation-positive tumor, and more preferably a BRAF V600 mutation-positive tumor.

[0042] Resistance to BRAF inhibitors is preferably understood as resistance to at least one of the one or more BRAF inhibitors, and includes resistance to each of the one or more BRAF inhibitors.

[0043] Preferably, the patient is a mammalian patient, more preferably a human patient, and more preferably a patient with a BRAF V600 mutation-positive tumor.

[0044] 4. In a preferred embodiment, the MAPK inhibitor, preferably the BRAF inhibitor, is an inhibitor of the BRAF V600 mutation, and the tumor is a BRAF V600 mutation-positive cancer. Preferably, the mutation is V600D, V600K, V600R, or V600E; more preferably, V600K or V600E; even more preferably, V600E.

[0045] Preferably, the patient is a mammalian patient, and more preferably a human patient.

[0046] Preferably, the patient is resistant to one or more BRAF V600 inhibitors, preferably BRAF V600 mutation inhibitors, or is at risk of developing resistance.

[0047] 5. In a preferred embodiment, the CSE inhibitor is used to prevent or delay the occurrence and / or development of resistance to the patient's cancer (preferably a tumor), wherein the tumor is a BRAF V600 mutation-positive cancer. The resistance is preferably acquired resistance. Preferably, the cancer or tumor is selected from the group defined in paragraph 2, and particularly preferably, the cancer is melanoma. Preferably, the CSE inhibitor used for the application is as described in paragraphs 1 to 4 or given herein. Preferably, the CSE inhibitor is selective for CSE or selective for CBS.

[0048] Preferably, the tumor is a BRAF V600 mutation-positive cancer, more preferably having BRAF V600D, V600K, V600R, or V600E mutations. Preferably, the tumor or cancer is melanoma.

[0049] 6. In a preferred embodiment, the BRAF V600 mutation inhibitor is selected from vemurafenib (PLX4032), dabrafenib (GSK2118436), dabrafenib mesylate, encorafenib (LGX818), agerafenib (RXDX-105, CEP-32496), and regorafenib (BAY). 73-4506), GDC-0879, RO5212054 (PLX3603), PLX-4720, PLX8394, SB590885, L-779450, RAF265, RAF709, naporafenib (LXH254), LY3009120 (DP-4978), belvarafenib (HM95573), CH5126766 (RO5126766), TAK-632, lifirafenib (BGB-283), AZ628, AZ304, ARQ-736, XL281 (BMS-908662) or CCT196969.

[0050] The inhibitors are understood to include any pharmaceutically acceptable salt, hydrate, or tautomer (if any).

[0051] Preferably, the BRAF inhibitor is a BRAF V600 inhibitor, preferably selected from vemurafenib (PLX4032), dabrafenib (GSK2118436), dabrafenib mesylate, encofenib (LGX818), agorafenib (RXDX-105, CEP-32496), PLX-4720, PLX8394, RAF265, RAF709, LY3009120 (DP-4978), riferafenib (BGB-283), AZ628, or AZ304.

[0052] Preferably, the BRAF inhibitor is selected from vemurafenib, dabrafenib, or encofenib.

[0053] Preferably, the BRAF inhibitor is selected from vemurafenib, dabrafenib, or encofenib; more preferably, vemurafenib or dabrafenib.

[0054] Preferably, the present invention relates to a CSE inhibitor for the application according to any one of paragraphs 3-5, wherein the BRAF inhibitor is selected from vemurafenib, dabrafenib, or encofenib.

[0055] 7. In a preferred embodiment, the MEK inhibitor is selected from trametinib (GSK1120212), cobimetinib (XL518, GDC-0973), binimetinib (MEK162), selumetinib (AZD6244), mirdametinib (PD-0325901), CI-1040 (PD184352), TAK-733, pimasertib (AS703026), refatinib (… Refametinib), AZD8330, E6201, GDC-0623, RO-4987655 (CH4987655), CH5126766 (RO5126766), HL085, SHR7390, TQ-B3234, CS-3006, FCN-159, WX-554, PD318088, PD98059, BI-847325, U0126, myricetin, CInQ-03, G-573, PD184161, PD98059, RO5068760 or SL327.

[0056] Preferably, the MEK inhibitor is selected from trametinib (GSK1120212), cobimetinib (XL518, GDC-0973), bimetinib (MEK162) or selemetinib (AZD6244), more preferably from trametinib, cobimetinib or bimetinib, and even more preferably, the MEK inhibitor is trametinib.

[0057] Preferably, the present invention relates to a CSE inhibitor for the application according to any one of paragraphs 3-5, wherein the MEK inhibitor is selected from trametinib, cobimetinib, bimetinib or selemetinib, more preferably selected from trametinib, cobimetinib or bimetinib, and even more preferably the MEK inhibitor is trametinib.

[0058] 8. In one embodiment, particularly according to any one of paragraphs 3-7, the MAPK inhibitor comprises a BRAF inhibitor, particularly a BRAF V600 mutation inhibitor and a MEK inhibitor, or a combination thereof.

[0059] Preferably, the CSE inhibitor is used to prevent or delay the development of acquired resistance to MAPK inhibitors in BRAF V600-mutant cancers, wherein preferably, the MAPK inhibitor comprises BRAF V600 inhibitors (especially vemurafenib, dabrafenib, and encofenib) and MEK inhibitors (especially cobimetinib, trametinib, and bimetinib).

[0060] Preferably, the combination of BRAF inhibitor and MEK inhibitor is selected from the group consisting of: dabrafenib + trametinib, vemurafenib + cobimetinib, or encofenib + bimetinib; more preferably, dabrafenib + trametinib.

[0061] Preferably, a BRAF inhibitor is selected from any group listed in paragraph 6 above, and / or a MEK inhibitor is selected from any group listed in paragraph 7 above.

[0062] More preferably, the BRAF inhibitor is selected from the group consisting of vemurafenib, dabrafenib, or encofenib, and the MEK inhibitor is selected from trametinib, cobitinib, bimetinib, or selmetinib.

[0063] Preferably, the combination of BRAF inhibitor and MEK inhibitor is dabrafenib + trametinib, vemurafenib + cobimetinib, or encofenib + binitemetinib; more preferably, dabrafenib + trametinib.

[0064] 9. In a preferred embodiment, particularly in the embodiment according to any one of paragraphs 3-8, the CSE inhibitor is selected from propargylglycine (PAG), β-cyanoalanine (BCA), L-aminoethoxyvinylglycine (AVG), hydroxylamine, I194496, I157172, S-3-carboxypropyl-L-cysteine ​​(… S -3-carboxpropyl-L-cysteine ​​(CPC), NSC4056 (aurintricarboxylic acid), L-aminoethoxyvinylglycine, 2-arylhydrazine dithiocarbamate or cystathionine-γ-lyase-IN-1 (CAS No. 2165706-30-7).

[0065] Preferably, the CSE inhibitor is used to prevent or delay the development of acquired resistance to BRAF V600 and MEK inhibitors in BRAF V600-mutant cancers, wherein the inhibitor is selective for CSE.

[0066] Preferably, the CSE inhibitor is selected from the group consisting of β-cyanoalanine (BCA), L-aminoethoxyvinylglycine (AVG) and propargylglycine (PAG), more preferably, D,L-propargylglycine (2-aminopent-4-alkynic acid or H-DL-Pra-OH) or N-propargylglycine (2-propargyl-1-ylamino)acetic acid.

[0067] Combination inhibition of BRAF and MEK leads to better treatment response by avoiding anomalous activation of the MAPK pathway, resulting in improved overall survival and progression-free survival, and even reduced adverse reactions.

[0068] 10. In a particular embodiment, the patient is a mammal, preferably a human.

[0069] 10a. In a preferred embodiment, the present invention relates to a CSE inhibitor for the application according to any one of paragraphs 1-9, wherein the treatment prevents or delays the development of resistance in patients with BRAF V600 mutations to BRAF inhibitor therapy, MEK inhibitor therapy, or a combination therapy of BRAF inhibitor and MEK inhibitor, wherein preferably, the development of resistance is delayed for at least 1 month, 2 months, 3 months, 4 months, 5 months, 6 months or longer.

[0070] In a preferred embodiment, treatment comprising a CSE inhibitor and a MAPK inhibitor delays the development of acquired resistance. Preferably, treatment comprising a CSE inhibitor and a MAPK inhibitor prevents the development of acquired resistance. Preferably, treatment comprising a CSE inhibitor and a MAPK inhibitor improves the efficacy of MAPK-targeted therapy.

[0071] 10b. In a preferred embodiment, the present invention relates to a CSE inhibitor for the application according to any one of paragraphs 1-10, wherein the CSE inhibitor is administered in combination with the MAPK inhibitor to a patient with a tumor. The patient had not received any prior treatment, or The patient had not previously received MAPK inhibitors (BRAF inhibitors and / or MEK inhibitors), or The patient had previously received treatment with MAPK inhibitors (BRAF inhibitors and / or MEK inhibitors) but remained sensitive to them.

[0072] Preferably, the tumor is a tumor containing the V600 mutation in serine-threonine protein kinase B-RAF (BRAF).

[0073] More preferably, the mutation is V600; more preferably V600D, V600K, V600R or V600E; more preferably V600K or V600E; more preferably V600E.

[0074] In a preferred embodiment, the patient's tumor is selected from the group consisting of: melanoma, colorectal cancer, colon cancer, rectal cancer, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumors, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilmes tumor), histiocytosis, Langerhans cell histiocytosis, and Edheim-Chester disease.

[0075] Preferably, the tumor is a melanoma, and more preferably a BRAF V600 mutant melanoma (e.g., unresectable or metastatic melanoma).

[0076] 11. In a preferred embodiment, the present invention relates to a CSE inhibitor for said application according to any one of paragraphs 1-10 (including 10a and 10b), wherein The CSE inhibitor is administered before the administration of the MAPK inhibitor (especially the BRAF V600 mutation inhibitor), or The CSE inhibitor is administered in parallel with a MAPK inhibitor (especially a BRAF V600 mutation inhibitor), or The CSE inhibitor is administered after the administration of the MAPK inhibitor (especially the BRAF V600 mutation inhibitor).

[0077] Preferably, the MAPK inhibitor, preferably a BRAF V600 mutation inhibitor and / or a MEK inhibitor, more preferably a combination thereof, can be administered alone, sequentially, simultaneously or in parallel with a CSE inhibitor.

[0078] 12. In a preferred embodiment, the present invention relates to a CSE inhibitor for the application according to any one of paragraphs 1-11, wherein the CSE inhibitor and the MAPK inhibitor are administered in a sequential, intermittent, or continuous manner. Preferably, the treatment comprises preventing or delaying the development of resistance to the MAPK inhibitor, wherein the CSE inhibitor and the MAPK inhibitor are administered in a sequential, intermittent, or continuous manner.

[0079] Preferably, the therapy is an intermittent therapy, such as an 8-week cycle therapy, wherein the CSE inhibitor and MAPK inhibitor are administered for 5 weeks and then discontinued for 3 weeks.

[0080] Preferably, the therapy is a continuous therapy, wherein the CSE inhibitor and the MAPK inhibitor can be administered simultaneously / in parallel for a period of time; or the CSE inhibitor and the MAPK inhibitor can be administered alternately.

[0081] Preferably, the therapy is a continuous therapy, wherein the patient is given a MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor) daily and the CSE inhibitor is given to the patient at least once a week, preferably at least twice a week.

[0082] 13. The present invention also relates to a combination, particularly a pharmaceutical kit comprising a cystathionine-γ-lyase (CSE) inhibitor and a MAPK inhibitor, which, in combination with one or more MAPK inhibitors, is used to treat BRAF V600 mutation-positive cancers in patients, preferably BRAF V600 mutation-positive tumors, and preferably to prevent or delay the development of resistance in said patients to treatment of said cancer using said MAPK inhibitors.

[0083] Preferably, the combination or kit comprises a CSE inhibitor, a BRAF inhibitor (especially a BRAF V600 mutation inhibitor) and / or a MEK inhibitor, preferably comprising a CSE inhibitor, a BRAF inhibitor and a MEK inhibitor, each of which is as defined herein (e.g., as described above).

[0084] Preferably, the combination or kit is used for the treatment methods defined in paragraphs 2, 3, 4 or 5 and / or 10, 11 or 12.

[0085] In a preferred embodiment, the combination or kit comprises a cystathionine-γ-lyase (CSE) inhibitor in combination with: a BRAF inhibitor as defined in paragraph 6, and / or a MEK inhibitor as defined in paragraph 7, and / or a combination as defined in paragraph 8.

[0086] In a preferred embodiment of any of the above combinations, the CSE inhibitor is as defined in paragraph 9.

[0087] 14. The present invention also relates to a pharmaceutical composition comprising a cystathionine-γ-lyase (CSE) inhibitor and a MAPK inhibitor, as well as a pharmaceutically acceptable excipient, for use in BRAF V600 mutation-positive cancers, particularly BRAF V600 mutation-positive cancers.

[0088] The pharmaceutical composition is preferably used to treat cancer, preferably tumors, in patients. Preferably, the pharmaceutical composition is used to prevent or delay the development or progression of resistance in the patient to treatment of the cancer using a MAPK inhibitor.

[0089] Preferably, the pharmaceutical composition comprises a CSE inhibitor, a BRAF inhibitor (especially a BRAF V600 mutation inhibitor), and / or a MEK inhibitor. More preferably, it comprises a CSE inhibitor, a BRAF inhibitor, and a MEK inhibitor, each of which is as defined herein (e.g., as described above).

[0090] Preferably, the pharmaceutical composition is used in the treatment methods defined in paragraphs 2, 3, 4 or 5 and / or 10, 11 or 12.

[0091] In a preferred embodiment, the combination or kit comprises a cystathionine-γ-lyase (CSE) inhibitor in combination with: a BRAF inhibitor as defined in paragraph 6, and / or a MEK inhibitor as defined in paragraph 7, and / or a combination as defined in paragraph 8.

[0092] In a preferred embodiment of any of the above combinations, the CSE inhibitor is as defined in paragraph 9.

[0093] 15. In a further embodiment, the present invention relates to a method of treating cancer in a subject, preferably a tumor in a BRAF V600 mutation-positive subject (preferably a patient), the method comprising administering to the subject a cystathionine-γ-lyase (CSE) inhibitor in combination with a MAPK inhibitor. Preferably, the MAPK inhibitor is a BRAF inhibitor, particularly a BRAF V600 mutation inhibitor, or a MEK inhibitor, or a combination of a BRAF inhibitor and a MEK inhibitor, as defined herein. Preferably, the method is for preventing or delaying the occurrence or development of resistance in the patient to treatment of the cancer using a MAPK inhibitor. Preferably, the subject is a patient diagnosed with BRAF V600 mutation-positive cancer (preferably a tumor).

[0094] In another alternative embodiment, the present invention relates to a method for preventing or delaying the development or progression of resistance in a subject (preferably a patient) to treatment of a tumor in said patient using a MAPK inhibitor, said method comprising administering to the subject a cystathionine-γ-lyase (CSE) inhibitor in combination with a MAPK inhibitor. Preferably, the MAPK inhibitor is a BRAF inhibitor or a MEK inhibitor, or a combination of a BRAF inhibitor and a MEK inhibitor, as defined herein. Preferably, the subject is a patient diagnosed with BRAV V600 mutation-positive cancer (preferably a tumor).

[0095] In the method of the present invention, the cancer (preferably tumor) contains a V600 mutation in serine-threonine protein kinase B-RAF (BRAF V600 mutation).

[0096] More preferably, the mutation is V600D, V600K, V600R or V600E; even more preferably V600K or V600E; V600E is the most preferred.

[0097] In a preferred embodiment, the patient's tumor is selected from the group consisting of: BRAF V600 mutant melanoma, colorectal cancer, colon cancer, rectal cancer, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumors, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilmes' tumor), histiocytosis, Langerhans cell histiocytosis, and Edheimer-Chester disease.

[0098] Preferably, the tumor is a melanoma, and more preferably a BRAF V600 mutant melanoma (e.g., unresectable or metastatic melanoma).

[0099] Preferably, the combination or kit as defined in paragraph 13 or the pharmaceutical composition as defined in paragraph 14 is administered to the subject in accordance with the treatment methods defined in paragraphs 2, 3, 4 or 5 and / or 10, 11 or 12. Preferably, the subject is a mammal, preferably a human patient, preferably as defined in paragraph 10.

[0100] In a preferred embodiment, the method includes detecting the presence of BRAF mutations in a tumor sample derived from the subject prior to the administration step.

[0101] Therefore, preferably, a diagnostic step is performed before initiating combination therapy to detect the presence or absence of BRAF mutations in the tumor sample. Preferably, BRAF mutations (preferably V600 mutations) are determined using methods including: (a) PCR or sequencing of nucleic acids (e.g., DNA) extracted from a patient's melanoma sample; and / or (b) determining the expression of BRAF mutant proteins in the sample using Sanger sequencing.

[0102] Preferably, it is a BRAF mutation (preferably the V600 mutation) as defined in paragraph 10.

[0103] In a preferred embodiment, the patient is sensitive to MAPK inhibitor therapy, preferably a BRAF inhibitor and / or a MEK inhibitor or a combination thereof.

[0104] 16. In a preferred embodiment of the treatment method The CSE inhibitor is administered before the MAPK inhibitor (especially the V600 mutation inhibitor), or The CSE inhibitor was administered in parallel with the MAPK inhibitor (especially the V600 mutation inhibitor), or The CSE inhibitor is administered after the administration of the MAPK inhibitor (especially the V600 mutation inhibitor).

[0105] Preferably, the MAPK inhibitor (preferably a BRAF inhibitor, especially a BRAF V600 mutation inhibitor), and / or the MEK inhibitor (preferably a combination thereof) are administered alone, sequentially, simultaneously, or in parallel with the CSE inhibitor. Preferably, the BRAF inhibitor (especially a BRAF V600 mutation inhibitor) and the MEK inhibitor are administered simultaneously, preferably from the start of treatment, especially as soon as possible after diagnosis.

[0106] Preferably, treatment with CSE inhibitors is initiated within one month, preferably within one week, or more preferably within 6, 5, 4, 3, 2, or 1 day after the patient is diagnosed with BRAF 600 mutation-positive cancer.

[0107] Preferably, the CSE inhibitor in combination with the MAPK inhibitor is administered to a patient with a tumor who has not previously received treatment, or a patient with a tumor who has not previously received a MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor), or a patient with a tumor who has previously received treatment with a MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor) but remains sensitive to the MAPK inhibitor (BRAF inhibitor and / or MEK inhibitor).

[0108] In a preferred embodiment, the CSE inhibitor for the application according to paragraph 1, wherein the cancer (preferably tumor) is selected from the group consisting of: melanoma, skin cancer, epithelial cancer, colorectal cancer, colon cancer, rectal cancer, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumors, neuroblastoma, glioma, astrocytoma, leukemia, hairy cell leukemia, hepatobiliary cancer, nephroblastoma (Wilmes tumor), histiocytosis, Langerhans cell histiocytosis, and Edheim-Chester disease. Preferred cancer types include melanoma, colorectal cancer, colon cancer, rectal cancer, and lung cancer. Melanoma is preferred.

[0109] 17. In a preferred embodiment, the present invention relates to a CSE inhibitor for the application according to any one of paragraphs 1 to 10, wherein the CSE inhibitor and the MAPK inhibitor are administered in a sequential, intermittent or continuous manner.

[0110] Preferably, the therapy is an intermittent therapy, such as an 8-week cycle therapy, wherein the CSE inhibitor and the MAPK inhibitor are preferably administered daily for 5 weeks, followed by a 3-week period without administration.

[0111] Preferably, the therapy is a continuous therapy, wherein the CSE inhibitor and the MAPK inhibitor can be administered simultaneously / in parallel for a period of time; or the CSE inhibitor and the MAPK inhibitor can be administered alternately.

[0112] In a preferred embodiment, the treatment prevents or delays the development of resistance to BRAF inhibitor therapy, MEK inhibitor therapy, or a combination therapy of BRAF inhibitor and MEK inhibitor, wherein preferably, the development of resistance is delayed by at least 1 month, 2 months, 3 months, etc.

[0113] In a preferred embodiment, treatment comprising the CSE inhibitor and the MAPK inhibitor delays the development of acquired resistance compared to MAPK treatment alone. Preferably, treatment comprising the CSE inhibitor and the MAPK inhibitor prevents the development of acquired resistance. Preferably, treatment comprising the CSE inhibitor and the MAPK inhibitor improves the efficacy of MAPK-targeted therapy.

[0114] definition As used herein, "subject" refers to an individual of an animal species, preferably a vertebrate, more preferably a mammal species, extremely preferably a primate, a hominid, or a human. Examples of mammals include, but are not limited to, any member of the class Mammalia: humans, non-human primates (such as chimpanzees and other ape species), farm animals (such as cattle, horses, sheep, goats, pigs), livestock (such as rabbits, dogs, and cats), and laboratory animals (including rodents such as rats, mice, and guinea pigs). In one embodiment, the mammal is a human.

[0115] "Patient" refers to a subject who is currently or will soon be receiving medical or veterinary observation, supervision, diagnosis or treatment.

[0116] A neoplasm is an abnormal, excessive, or uncontrolled growth of tissue within the subject's body. (The process of forming or producing a neoplasm is called tumor formation.) Neoplasm growth is out of sync with the growth of surrounding normal tissue, and it may continue to grow abnormally even after the initial cause has been removed. The number of each type of neoplasm is listed in the table.

[0117] "Tumor" refers to a growth formed by an abnormally growing clump of cells. In the embodiment, the tumor is formed by a malignant growth and is therefore a malignant tumor. Preferably, the tumor should be a solid tumor.

[0118] In this document, the term "cancer" refers to a malignant growth caused by the uncontrolled division of cells in a part of the body; preferably, the cancer has a tendency to spread to other parts of the body, that is, to form cancer (metastasis) in different tissues. Preferably, the cancer is a tumor.

[0119] The term "melanoma" refers to cancer that develops from pigment-producing cells called melanocytes. In certain implementations, melanoma is a type of skin cancer.

[0120] As used herein, the term "inhibitor" refers to a substance, particularly a molecular substance or molecule, that can reduce or decrease (e.g., block) the activity of a protein in a subject's body. This protein is the target of the inhibitor. In a preferred embodiment, the inhibitor is a signaling pathway inhibitor, a substance capable of reducing or decreasing (e.g., blocking) the transmission of signals from one molecule to another within a cell. In a particular embodiment, the signal transduction inhibitor is involved in the development of cancer. The terms "inhibition," "inhibition," or "inhibitory effect" refer to the effect of the inhibitor on the target protein, preferably an effect.

[0121] The term "BRAF V600" or "V600" refers to a mutation in the BRAF gene in which valine (V) is replaced by another amino acid at position 600. For example, "BRAF V600E" or "V600E" is a mutation in which valine (V) at position 600 is replaced by glutamate (E). V600E is a driver mutation for certain diseases, such as melanoma, hairy cell leukemia, colorectal cancer, and non-small cell lung cancer.

[0122] "BRAF inhibitor" refers to a chemical substance, drug, or compound that can inhibit serine / threonine protein kinase B-Raf and / or its mutants. BRAF inhibitors are preferably capable of inhibiting V600 mutant B-Raf.

[0123] "MEK inhibitors" are chemical substances, drugs, or compounds that can inhibit mitogen-activated protein kinase kinases MEK1 and / or MEK2. MEK inhibitors can be used to affect the MAPK / ERK pathway.

[0124] "CSE inhibitors" are compounds, chemicals, or drugs that can inhibit the cystathionine-γ-lyase (CSE) protein. "CSE inhibitors" encompass complete or partial inhibition of the enzymatic activity of CSE in the process of hydrogen sulfide synthesis.

[0125] In this article, "selective CSE inhibitors" refers to CSE inhibitors that exhibit selectivity for CSEs exceeding that for at least one other enzyme involved in cancer development. For example, CSE inhibitors have CSE inhibitory selectivity for enzymes selected from PSAT1, VEGFR, PDGFR, c-Kit, and RET.

[0126] In a very specific embodiment, the “selective CSE inhibitor” is selective for CBS.

[0127] The term "composition" in this invention refers to a composition comprising at least one compound of this invention as an active ingredient and at least one other substance. Preferably, the compound of this invention is present in an effective amount. The composition may also contain other bioactive substances, for example, for use in combination therapies. Furthermore, the composition may include biologically acceptable carriers, formulations, excipients, etc., known in the art. A pharmaceutical composition refers to any composition intended for the treatment of a subject, particularly including pharmaceuticals, drugs, custom-made drugs, and pharmacy preparations.

[0128] "Treatment" for a subject refers to any process, action, and especially arapies in which a subject or patient receives assistance, particularly medical or veterinary assistance, with the aim of directly or indirectly improving the condition of the subject or patient. Improving the condition of a subject may include restoring or maintaining the normal function of organs or tissues, including partial improvement, particularly improvement or relief of a disease state caused by cancer (especially melanoma). Treatment generally refers to the administration of an effective amount of a compound or composition described herein, especially combinations of compounds disclosed herein. Unless otherwise specified, treatment includes medical or veterinary treatment and prevention (or prophylactic treatment), i.e., prevention of the occurrence or formation of disease, such as resistance to treatment or therapy.

[0129] The term "therapy" refers to the treatment of a disease, disorder, or ailment.

[0130] "Combination therapy" refers to a therapy that combines two or more treatment methods. For example, for the same disease or disorder, a patient may need to take two or more medications or treatments.

[0131] According to the invention, a "combination" refers to a combination containing at least two active ingredients (preferably inhibitors in this invention) for administration to a subject or patient. The active ingredients in the combination may be administered simultaneously or sequentially, or in any effective treatment regimen to provide an effective dose of either or both of the therapeutic ingredients.

[0132] The term “combined co-administration” or similar terms used in this article are intended to cover the administration of selected therapeutic agents to a single patient and are intended to include treatment regimens in which the agents are administered via the same or different routes of administration or at the same or different times.

[0133] As used herein, "effective amount" or "therapeutic effective amount" means an adequate quantity of a formulation or compound that is capable of alleviating one or more symptoms of the disease or condition being treated to a certain degree. The result may be a reduction and / or relief of the signs, symptoms, or cause of the disease, or any other desired alteration of the biological system, particularly in cancer or tumors. For example, an "effective amount" for therapeutic use means an amount of a composition comprising the compounds disclosed herein that is capable of significantly reducing disease symptoms, preferably causing regression of cancer or tumors, particularly melanoma. In any specific case, techniques such as dose escalation studies can be used to determine the appropriate "effective" dose. The term "effective amount" refers to the amount of compound required in a composition to exert the effect of the active ingredient. "Therapeutic effective amount" refers to one or more symptoms or characteristic parameters sufficient to relieve or prevent (or prevent worsening) a condition (such as an imbalance or disease). The singular forms “a,” “one,” and “the,” or at least “a” or “one,” contain plural references unless the context clearly indicates otherwise.

[0134] The terms “comprising,” “including,” or “included” here should be interpreted in a non-exhaustive sense, allowing for the addition or reference of other features, method steps, or components to the listed features, method steps, or components. “Comprising” may be replaced with “including” if the practice of a particular language variant requires it; and if other members or components are not essential to putting the invention into practice, it may be limited to “consisting substantially of…”.

[0135] abbreviation A375-XA375 cell line-derived xenograft ABCG2 is a member of the ATP-binding casette (ABC) transporter G family. Akt protein kinase B APOE (apolipoprotein E) Asparagine (Asn) Aspartate (Asp) ATP6V0D2 V-type proton ATPase subunit d2 Braf (Serine / threonine-protein kinase B-raf) CARS2 mitochondrial cysteine-tRNA ligase CBS cystathionine-β-synthase CDO (cysteine ​​dioxygenase) CYP cytochrome P450 Cyscysteine Cys-SSH cysteine ​​persulfide CysTyC (cystine) CSAD (cysteine ​​sulfinic acid decarboxylase) CSE cystathionine-γ-lyase CTH cystathionine DLST (dihydrolipoyllysine-residuesuccinyltransferase) is a component of the 2-ketoglutarate dehydrogenase complex. DT dabrafenib-trametinib DTR (Dabrafenib-Trametinib Resistant) ECAR extracellular acidification rate ERK (Mitogen-activated protein kinase kinase) ETHE1 persulfide dioxygenase G6PD glucose-6-phosphate dehydrogenase GAPDH (glyceraldehyde-3-phosphate dehydrogenase) GCLC glutamate-cysteine ​​ligase catalytic subunit gGluCysγ-glutamylcysteine Glutamine (Gln) GLS glutaminase Glutamate (Glu) GLUL (glutamine synthetase) GOT aspartate aminotransferase GPX (glutathione peroxidase) GS glutathione synthetase GSH (glutathione) GSSG oxidized glutathione GSSH (glutathione persulfide) H2S Hydrogen sulfide H2S2 Hydrogen disulfide HCys (homocysteine) Hlanth (homolanthionine) HMW (High Molecular Weight) HSPB1 (Heat Shock Protein B1) IDH isocitrate dehydrogenase Lanthionine LMW (low molecular weight) MAPK (mitogen-activated protein kinase) MEK (mitogen-activated protein kinase) Metmethionine MPST (mercaptopyruvate sulfur transferase) Nrf2 nuclear factor E2-related factor 2 Oxygen consumption rate (OCR) OGDH2-ketoglutarate dehydrogenase complex OXPHOS oxidative phosphorylation PAGD, L-propargylglycine (D,L-propargylglycine) PDH (pyruvate dehydrogenase) Patient-derived xenograft in PDX PFKFB6-phosphofructo-2-kinase / fructose-2,6-biphosphatase Pyruvate (Pyr) Ras GTPase ROS (Reactive Oxygen Species) SDHA succinate dehydrogenase flavoprotein subunit A Serine SO sulfite oxidase SOD (superoxide dismutase) SQOR sulfides: quinone oxidoreductase TRP14 is a thioredoxin domain-containing protein 14. Trx (thioredoxin) TrxR1 thioredoxin reductase 1 TST (thiosulfate sulfur transferase) xCT cystine / glutamate transporter Attached Figure Description Figure 1. A375 cells resistant to dabrafenib-trametinib overexpressed genes related to resistance and redox balance. In addition to activating the PI3K / Akt pathway, dabrafenib-trametinib resistant cells also overexpressed ABC transporter and cytochrome P450 protein.

[0136] (A) To investigate the molecular and metabolic background of melanoma resistant to MAPK inhibitors (MAPKi), the inventors generated a DT-resistant line (A375-DTR) of BRAF V600E mutant A375 human melanoma cells by long-term culture with increased doses of dabrafenib (a BRAF inhibitor) and trametinib (a MEK1 / 2 inhibitor). Figure A is a simplified diagram illustrating how the dual inhibition of V600E mutant Braf by dabrafenib and MEK1 / 2 by trametinib leads to the blockade of the MAPK-ERK pathway.

[0137] (B) Proliferation assays were used to track the continued viability of resistant cells in the presence of the drug. A375 control and DTR cells were cultured with and without DT. Culture dishes were fixed daily, and relative cell numbers were measured using the sulforhodamine B (SRB) assay. Absorbance values ​​after dilution and path correction are shown.

[0138] (C) MAPK-Erk pathway activity was detected by Western blot analysis, measuring the levels of phosphorylated MEK1 / 2 and phosphorylated ERK1 / 2 in A375 control cells and DT-resistant (DTR) cells cultured for 0, 24, 48, or 72 hours in the presence or absence of DT. β-actin was used as a loading control.

[0139] (D) Phosphorylated Akt levels were measured in A375 control cells and DT-resistant (DTR) cells cultured for 0, 24, 48, or 72 hours in the presence or absence of DT by Western blot analysis. Inhibition of the MAPK-ERK pathway resulted in elevated Akt phosphorylation levels (Fig. 3A), consistent with previous reports demonstrating that enhanced PI3K-Akt pathway activity leads to DT resistance (Liu et al., 2020; Sun et al., 2014). β-actin was used as a loading control.

[0140] (EF) Using Qiagen's real-time quantitative PCR (RT-qPCR) microarray, the inventors discovered the overexpression of several genes associated with the development of cancer resistance. Gene expression in untreated control cells and DT-treated DTR A375 cells was compared using Qiagen's RT-qPCR microarray assay, namely "human drug metabolism (E) and cancer drug resistance (F)". (G) High expression of genes responsible for neutralizing exogenous substances was measured by RT-qPCR using custom-designed oligonucleotides. Values ​​were normalized to GAPDH, β-actin, and b2M. Fold-over-fold increases compared to untreated controls were calculated.

[0141] (HJ) Western blot analysis was used to measure the levels of proteins involved in redox balance in A375 control cells and DT-resistant (DTR) cells in the presence or absence of DT. GAPDH was used as a loading control.

[0142] Each Western blot experiment was repeated at least three times, and representative images are shown.

[0143] p<0.05, p<0.01, p<0.001, and the results were determined by ordinary one-way ANOVA or Brown-Forsythe test (n=2 technical replicates from 3 biological replicates (E)).

[0144] Figure 2. Altered energy metabolism in DT-treated and DT-resistant (DTR) cells.

[0145] (A) Mitochondrial function was analyzed by measuring the oxygen consumption rate (OCR) of cells using a Mito Stress Test kit and a Seahorse Cell Analyzer. After the test, cells were fixed and total protein levels were determined using the sulfonylrhodamine B (SRB) assay. The measured OCR values ​​were normalized to absorbance after dilution and optical path correction.

[0146] (B) Glycolytic activity of cells was analyzed by measuring extracellular acidification rate (ECAR) using a hippocampal cell analyzer and a glycolysis stress test kit. After the test, cells were fixed and total protein levels were measured using the sulfonylrhodamine B (SRB) assay. The measured ECAR values ​​were normalized to absorbance after dilution and optical path correction.

[0147] (C) Protein levels of citric acid cycle enzymes responsible for NADH production were measured by Western blot analysis in A375 control cells and DT-resistant (DTR) cells cultured in the presence or absence of DT. DT-treated control cells were treated with DT for 6 days. GAPDH was used as a loading control.

[0148] (DE) After culturing for 48 hours in the presence or absence of DT, the amino acid levels in cell lysates (D) and cell culture medium (E) were determined using the EZ:faast amino acid analysis kit and then by LC-MS / MS. The amino acid levels in the lysates were normalized to the total protein content, and the culture medium measurements were compared with those in fresh culture medium.

[0149] (F) The simplified diagram illustrates the metabolic pathways involved in the conversion of glutamate (Glu).

[0150] (G) Gene expression was analyzed by RT-qPCR. Detection values ​​were normalized to GAPDH, β-actin, and b2M. Fold increases compared to the untreated control were calculated.

[0151] (H) Protein levels in A375 control cells and DT-resistant cells cultured with or without DT were analyzed by Western blotting. DT-treated control cells were treated with DT for 6 days. Protein levels of GOT1 and GOT2 were measured by Western blotting. GAPDH was used as a loading control.

[0152] Each protein blot experiment was repeated at least three times, and representative images are shown in the figure.

[0153] p<0.05, p<0.01, p<0.001, Ordinary one-way ANOVA or Brown-Forsythe test (A, B, D, E, G) were used. Representative figures are from n=15 technical replicates of 2 independent experiments (A, B) and n=2 technical replicates of 3 biological replicates (D, E, G).

[0154] Figure 3. Due to DT treatment, dabrafenib-trametinib resistant A375 cells overexpress genes involved in redox balance, and cysteine ​​metabolism is reprogrammed in DT resistant melanoma cells.

[0155] (A) Cells were cultured with different concentrations of cysteine ​​in or without 100 nM sodium selenite and in or without DT. Cell viability was measured using the SRB assay after 72 hours. Absorbance values ​​after dilution and optical path correction are shown.

[0156] (B) Cells were cultured for 24, 48 or 72 hours without sodium selenite (Se), lysed and the level of selenoproteins was determined by Western blot analysis.

[0157] (C) Using the EZ:faast amino acid assay kit, the levels of cystine (CySSyC) and glutamate (Glu) were measured from the culture medium above the cells after 72 hours of culture. Changes in CySSyC and Glu levels were compared to fresh culture medium. The fold increase compared to the untreated control was calculated. Negative values ​​compared to fresh culture medium indicate decreased uptake, and positive values ​​indicate increased efflux.

[0158] (D) Glutathione levels were measured from cell lysates using HPE-IAM alkylating agent and then by LC-MS / MS. Measurements were normalized to total protein content and the fold increase compared to the untreated control was calculated.

[0159] (E) GSTpi levels were measured by Western blot analysis in A375 control cells and DT-resistant (DTR) cells cultured in the presence or absence of DT. GAPDH was used as a loading control.

[0160] (F) The simplified diagram shows the source and sink of intracellular cysteine ​​(Cys).

[0161] (G) Levels of LMW cysteine, cystine, and cysteine ​​persulfate in cell lysates were measured using HPE-IAM alkylating agent and LC-MS / MS. Measurements were normalized to total protein content and the fold increase compared to the untreated Ctrl control was calculated.

[0162] (H) Gene expression was analyzed by RT-qPCR. Data were normalized to GAPDH, β-actin, and b2M. Fold increases compared to the untreated control were calculated.

[0163] (I) The levels of proteins involved in Cys metabolism were measured by Western blot analysis in A375 control cells and DT-resistant (DTR) (I / 1) and SK-MEL28 (I / 2) cells cultured in the presence or absence of DT.

[0164] (J) The contents of LMW thiols and persulfates were measured by alkylation with HPE-IAM followed by LC-MS / MS. The detected values ​​were normalized to the total protein level and the fold increase compared to the untreated control was calculated.

[0165] Each Western blot experiment was repeated at least three times, and representative images are shown in the figure. GAPDH was used as a loading control.

[0166] p<0.05, p<0.01, p<0.001, using Ordinary one-way ANOVA or Brown-Forsythe test and Welch test (A, C, D), n = 2 replicates from 4 biological replicates (A), n = 2 replicates from 2 biological replicates (C), n = 3 replicates from 3 biological replicates (D). p<0.05, p<0.01, p<0.001, ordinary one-way ANOVA or Brown-Forsythe test (G, H, J) were used, n=3 technical replicates from 3 biological replicates (G, J), n=2 technical replicates from 3 biological replicates (H).

[0167] Figure 4. Analysis of CSE and CBS-related enzyme functions and enzymes in the sulfide catabolism pathway in A375 cells.

[0168] (A) Total steady-state levels of cysteine ​​metabolic intermediates were measured by alkylation with HPE-IAM followed by LC-MS / MS assay. Detected values ​​were normalized to total protein content. A fold increase was shown compared to the untreated A375 control.

[0169] (B) The chemical reactions of CBS and CSE proteins were tracked using stable methionine isotopes. Heavy atoms are marked with an asterisk.

[0170] (CD) The cells were treated with heavy Met ( 34 S) Cells were treated for 0, 18, 24, and 48 hours, lysed, and then normal and reanalytes were measured using the EZ:faast amino acid kit, followed by LC-MS / MS analysis. The measured values ​​were normalized to total protein content. Methionine-derived reanalytes were analyzed using... Labels. The ratio of reticulum to total analyte (C) and steady-state level (D) are shown.

[0171] (E) The simplified diagram illustrates the typical reactions of CSE and CBS and the sulfide / persulfide formation reactions.

[0172] (F) The chemical reactions of CBS and CSE proteins were tracked using stable cystine isotopes. Heavy atoms are marked with an asterisk.

[0173] (GH) using heavy CySSyC ( 13 C, 15 Cells were treated for 0, 18, 24, or 48 hours, lysed, and measured using the EZ:faast amino acid kit, followed by LC-MS / MS analysis. The measured values ​​were normalized to total protein content. CySSyC-derived reanalytes were used... The figure shows the ratio of heavy analyte to total analyte (G) and the steady-state level of heavy analyte (H). (I) The persulfation of Cys residues in the protein was determined by HPE-IAM alkylation followed by LC-MS / MS. A fold increase was observed compared to the untreated control group.

[0174] p<0.05, p<0.01, p<0.001, by Ordinary one-way ANOVA or Brown-Forsythe test, it was found that n=3 technical replicates from 3 biological replicates (A) and n=3 replicates from 2 biological replicates (I).

[0175] Figure 5. Metabolism of Cys and H2S was remodeled in vemurafenib-treated and resistant melanoma cells.

[0176] (A) The simplified diagram illustrates how the Braf V600E inhibitor vemurafenib blocks the MAPK / ERK pathway.

[0177] (B) To investigate whether the inventors' observations regarding Cys and H2S metabolic remodeling represent a general adaptive response of melanoma cells to BrafV600E inhibition, the inventors generated a vemurafenib-resistant A375 cell line by long-term culturing of cells at increased vemurafenib doses. A375 control cells treated with vemurafenib (V) and vemurafenib-resistant (VR) cells were grown in the presence or absence of V. Cells were fixed after 72 hours, and relative cell numbers were measured using the SRB assay.

[0178] (C) Control cells treated with V were cultured with V for 6 days. By measuring the phosphorylation of MEK1 / 2 and ERK1 / 2, the inventors found that V treatment effectively blocked the phosphorylation of MEK1 / 2, and that the phosphorylation of MEK1 / 2 was completely restored in VR cells. The protein levels of enzymes involved in redox balance, Cys and H2S metabolism were determined by Western blot analysis in untreated, V-treated and V-resistant cells. GAPDH was used as a loading control.

[0179] (D) Intracellular LMW thiols were measured by alkylation with HPE-IAM followed by LC-MS / MS. Measurements were normalized to total protein content. The fold increase or ratio compared to the untreated control group is shown.

[0180] Each protein blotting experiment was repeated at least three times, and representative images are shown in the figure.

[0181] p<0.05, p<0.01, p<0.001, obtained by Ordinary one-way ANOVA or Brown-Forsythe test, which indicates that the sample comes from n=3 technical replicates of 3 biological replicates (B, D).

[0182] Figure 6. Metabolomic analysis (low molecular weight thiols and persulfides) of DT-treated cell line-derived and patient-derived xenograft tumors.

[0183] (A) Xenograft tumors derived from the A375 cell line (A375-X) were grown in NOD SCID mice and treated orally with DT for 4 days. The mice were sacrificed 24 hours after the last treatment and the tumor weight was measured.

[0184] (B) Quick-frozen homogenized A375 xenograft tumor samples were alkylated and lysed using ice-cold HPE-IAM / methanol. LMW thiols were measured by LC-MS / MS. The fold increase compared to the untreated control was calculated. (C) Patient-derived xenograft (PDX) tumors were grown in NOD SCID mice and treated orally with DT four times over 6 days. The mice were sacrificed 24 hours after the last treatment and the tumor weight was measured.

[0185] (D) Quick-frozen homogenized patient-derived xenograft (PDX) tumor samples were alkylated and lysed using ice-cold HPE-IAM / methanol. LMW thiols were measured by LC-MS / MS. The fold increase compared to the untreated control was calculated. p<0.05, p<0.01, p<0.001, Ordinary one-way ANOVA or Brown-Forsythe test was used, n=6 biological replicates.

[0186] Figure 7. Higher levels of persulfides are beneficial to A375 cells treated with DT. Combination of Braf and / or MEK inhibitors with CSE inhibitors produces a more effective therapeutic response. (AB) Protein levels of sulfide catabolism pathway enzymes were measured by Western blot analysis in control (cultured for 6 days in or without DT) and DTR cells (A) in or without DT, and Ctrl (cultured for 6 days in or without V) and VR cells (B) in or without V. GAPDH was used as a loading control.

[0187] (C) An alkylation scheme based on monobromodiamine was adopted, followed by fluorescence detection to measure the thiosulfate (S2O3) level per unit of total protein.

[0188] (D) ETHE1 protein levels in shCtrl (labeled C) and shETHE1 monoclonal (1–9) were measured by Western blotting. Cells derived from clone 9 were used for further experiments.

[0189] (E) Ethe-silenced (shETHE1) and lentiviral control (shCtrl) A375 cells were cultured for 6 days in the presence or absence of DT, and then lysed. Protein levels involved in Cys and H2S metabolism were analyzed by Western blotting. GAPDH was used as a loading control.

[0190] (F) Proliferation of untreated (7F / 1) and DT-treated (7F / 2) shCtrl and shETHE1 cells was measured by the SRB test. Absorbance values ​​after dilution and optical path correction are shown.

[0191] (G) Intracellular levels of LMW thiols and H2S metabolic intermediates were measured from cell lysates using HPE-IAM alkylating agent and then by LC-MS / MS. Measurements were normalized to total protein content and fold increases compared to untreated controls were calculated.

[0192] (H) Extracellular GSSH levels were measured from the culture medium above the cells using HPE-IAM alkylating agent by LC-MS / MS and compared with fresh culture medium.

[0193] (I) The persulfation of proteins in cell lysates was measured by LC-MS / MS using HPE-IAM alkylating agent.

[0194] Figure 8. CSE expression is upregulated in the tumors of melanoma patients who received DT therapy.

[0195] (A) CSE levels in malignant cutaneous melanomas removed from the same patient before (left) and after (right) DT treatment were measured by immunohistochemistry.

[0196] (B) CSE levels in lymphoma metastases from the same patient before (left) and after (right) DT treatment were measured by immunohistochemistry.

[0197] (C) CSE levels in tumors removed from different patients before (no borders) and after (with borders) DT treatment.

[0198] Figure 9. Untreated melanoma cells are insensitive to PAG and AOAA treatment. (A) Untreated A375 cells were treated with 0.5 mM PAG for 9 days. The culture dishes were fixed daily and proliferation was measured by the SRB assay.

[0199] (B) Untreated A375 cells were treated with 250 or 500 µM AOAA for 48 hours. Relative cell count was measured by SRB assay.

[0200] Figure 10. PAG inhibition of CSE delays the development of acquired resistance to MAPK inhibitors in vitro.

[0201] (AB) A375 cells were cultured for 2 months with or without vemurafenib (A) or dabrafenib-trametinib (B). Fresh medium was added every three days. The proliferation of V-treated and V+PAG-treated cells was compared with untreated A375 cells (A). In a 4-day proliferation assay, the proliferation of DT-treated cells to DT+PAG-treated cells was compared with DT-resistant and untreated A375 cells (B). Culture dishes were fixed daily for SRB assays. Absorbance values ​​after dilution and path correction are shown.

[0202] (C) A375 cells were cultured for 16 weeks with encofenib (a BRAF V600E inhibitor) and bimetinib (a MEK1 / 2 inhibitor) (EB) in the presence or absence of 0.5 mM PAG. The proliferation of EB-treated cells was compared to that of EB + PAG-treated cells in a 7-day proliferation assay. Culture dishes were fixed daily for SRB assays. Absorbance values ​​after dilution and path correction are shown.

[0203] (D) A375 cells were cultured for 10 weeks with cobimetinib (a MEK1 / 2 inhibitor) and vemurafenib (a Braf V600E inhibitor) (CV) in the presence or absence of 0.5 mM PAG. Representative microscopic images are shown.

[0204] (EH) The levels of phosphate MEK1 / 2, phosphate ERK1 / 2, and phosphate Akt in A375 cells cultured with V (E) or DT (F) for 2 months, or with EB for 10 weeks (G) or 16 weeks (H) were measured in the presence or absence of PAG and compared with untreated control (EH) and previously generated DT-resistant cell lines labeled with R (F).

[0205] Each Western blot experiment was repeated at least three times, and representative images are shown. GAPDH was used as a loading control.

[0206] Figure 11. In vivo inhibition of CSE delays the development of acquired resistance to dabrafenib-trametinib (DT) therapy.

[0207] (A) A xenograft model with A375 melanoma cell line has been established. Tumor-bearing mice were randomly assigned to groups and treated with DT five times a week. Mice in the DT + PAG group received PAG treatment three times a week in addition to DT treatment. Tumors were measured two or three times a week using manual calipers.

[0208] (B) Calculate progression-free survival for each group. Treatment is considered ineffective when the tumor exceeds its pre-treatment volume.

[0209] (C) When 11 out of 12 mice in the DT group showed resistance, the mice were sacrificed and the tumor weight was measured.

[0210] Figure 12. Preparation of CSE knockout cell lines using CRISPR-Cas9 technology (A) CSE levels were measured in CRISPR control and CSE knockout A375 cell lines with and without 48 hours of DT treatment. CSE levels were almost undetectable in the CSE knockout cell population, indicating successful knockout. After 48 hours of DT treatment, CSE levels were significantly elevated in control cells, while only low background levels were detected in CSE knockout cells.

[0211] (B) CSE levels were measured in CRISPR control and CSE knockout A375 cell lines 1.5 months after DT treatment. No significant differences were found.

[0212] GAPDH was used as a loading control.

[0213] Specific embodiments of the present invention The inventors have demonstrated the positive effect of CSE inhibitors in combating cancer or tumor resistance to MAPK inhibitor therapy, particularly in the treatment of cancer with Braf V600 mutations. Melanoma is the preferred cancer. Some results in the prior art [Sun et al.: Metallothionein-1G facilitates sorafenib resistance through inhibition of ferroptosis, Hepatology, 64(2), 488-500(2016)] suggest that PAG (a CSE inhibitor) may enhance the role of kinase inhibitors (such as sorafenib) in certain cancers (such as hepatocellular carcinoma, HCC). However, the inventors have tested PAG and the nonspecific CSE inhibitor AOAA in BRAF V600 mutant melanoma, but these compounds have no antiproliferative effect.

[0214] Unexpectedly, the inventors discovered that combining the CSE inhibitor D,L-propynylglycine (PAG) with DT, V, CV, or EB effectively delayed the development of acquired resistance, thereby providing a more effective combination therapy for patients carrying BrafV600 mutations (especially BrafV600E mutations), such as melanoma patients.

[0215] The inventors meticulously analyzed the altered energy patterns and redox environments in control melanoma cells treated with dabrafenib / trametinib (DT treatment) or vemurafenib (V treatment) and in resistant (VR or DTR) melanoma cells. They revealed the crucial roles and novel mechanistic details of reprogrammed cysteine ​​and hydrogen sulfide metabolism in cellular adaptation to these drugs (both in vitro and in vivo) in DT-treated and DTR cells, respectively. The current findings were also confirmed in vivo through transsulfuromic analysis of treated, untreated, and patient-derived xenograft mouse models. Unexpectedly, among the many immediate adaptive changes following treatment, elevated CSE expression played a key role in cancer cell survival and resistance development after DT or V treatment. Increased CSE expression led to increased GSH and protein Cys persulfate, which promoted cancer cell survival and tumor growth by providing additional protection against oxidative stress induced by Braf mutations (particularly BrafV600E inhibition). The increased RSS production was also used to realign mitochondrial energy production in melanoma cells to compensate for the increased energy demands of the cells in the presence of these drugs, enabling them to survive and proliferate. The inventors' metabolomics analysis revealed how the altered transsulfurization is associated with other metabolic processes, such as the TCA cycle or glutamine breakdown, further supporting many important details of cell protection.

[0216] Furthermore, the inventors discovered that DT treatment, which inhibits the MAPK / ERK pathway in melanoma cells, increases oxidative stress, which is offset by the overexpression of multiple antioxidant genes mediated by Nrf2. In DT-resistant cells, a more balanced redox environment and the restoration of glycolysis are predicted by regulating the expression patterns of enzymes involved in cellular antioxidant responses and glucose metabolism.

[0217] Further experiments revealed that metabolic pathways involved in cellular energy metabolism were reprogrammed in melanoma cells resistant to BrafV600Ei and MEK1 / 2i. In addition to OXPHOS upregulation and increased expression of CAC enzymes that produce NADH (fueling the electron transport chain), the inventors also found enhanced glutamine degradation in DT-treated and DT-resistant cells, indicating an increased demand for Glu.

[0218] DT treatment and DT-resistant cells also require increased levels of CySSyC to stimulate GSH synthesis, which is used to counteract oxidative stress and neutralize anticancer drugs.

[0219] Returning to the inhibition of the MAPK / Erk pathway by DT, while inhibition in control cells resulted in an immediate increase in CSE levels and a decrease in CBS levels, unexpectedly, the opposite pattern was observed in DT-resistant cells: CBS expression was restored, and CSE levels decreased to below untreated control levels, becoming almost undetectable. H2S2 was elevated in DT-resistant cells, and both DT-treated and DTR cells showed higher concentrations of H2S and GSSH, suggesting that the changes in CSE and CBS expression induced by DT treatment are related to their function in producing reactive sulfur species (RSS). These RSS are deeply involved in cellular protection against oxidative stress. It can be speculated that the observed adaptive changes in CSE and CBS expression levels after DT treatment contribute to the protection and survival of melanoma cells against DT-targeted therapy, thereby leading to resistance.

[0220] These observations explain why previously low levels of CSE in control cells were rapidly induced after DT treatment, potentially representing an important adaptive response in cells to drug exposure. The inventors concluded that this adaptive response plays a crucial role in establishing the foundation for resistant cell survival. CSE is indeed a highly inducible protein, with several transcription factors, including Nrf2 (which coordinates the antioxidant response in melanoma cells after DT treatment, see above), and other stress-response factors having binding sites on the CSE promoter, thereby regulating CSE expression levels. Therefore, inducing CSE expression is a rapid adaptive response in cancers (particularly melanoma cells) to counteract cell damage caused by immediate drug-induced oxidative stress and to provide additional energy for fuel production by increasing RSS generation. As drug resistance develops, CSE levels decrease and CBS levels increase, providing a balanced but increased RSS flux, restoring glycolysis, and promoting cancer cell proliferation and tumor progression.

[0221] Thiosulfate is the final product of the sulfide metabolic pathway and is a recognized marker of increased sulfide flux in this field. The inventors have discovered that thiosulfate levels increase due to DT treatment (…). Figure 7C This result further demonstrates that, in addition to the increased production of sulfides / persulfides, the catabolism of sulfides and persulfides also increases due to DT treatment. Therefore, DT treatment increases sulfide flux. Cys levels are typically tightly regulated by oxidative catabolism. A further unexpected finding revealed that, despite high Cys demand in DT-treated cells, DT treatment significantly induced oxidative catabolism of Cys. Increased expression of the cysteine ​​dioxygenase 1 (CDO1) gene (a Cys metabolic enzyme) in DTR cells was confirmed at the protein level. Therefore, oxidative Cys catabolism may be the primary reason for the low Cys homeostasis levels in both DT-treated and DT-resistant cells.

[0222] In another experiment (data not shown), the ratio of protein thiol oxidase variants was found to increase due to DT treatment, providing direct evidence that DT treatment leads to increased oxidative stress.

[0223] The metabolite patterns identified in this study indicate that typical CBS activity was extremely low in DT-treated control cells, but partially recovered to control levels in DT-resistant cells, consistent with measured CBS protein levels. However, typical CSE activity was not prominent in any of these systems, including DT-treated control cells with CSE overexpression. Fluxomics analysis also concludes that the increased RSS production in DT-treated and DTR cells cannot be explained by CSE or CBS-mediated Cys metabolism leading to H2S production.

[0224] The inventors also demonstrated that DT-treated control cells had increased oxidative load, and that both DT-treated control cells and DT-resistant cells had elevated CySSyC:Cys ratios; and found that oxidative catabolism of Cys was activated in both DT-treated and DT-resistant cells. Given that these cells absorbed more CySSyC and had elevated intracellular GSH, GSSH, and H2S levels, all of which indicate an increased demand for Cys, this latter observation is particularly surprising, contradicting the oxidative catabolism.

[0225] Figure 3F The main pathways, including the synthesis of GSH and RSS (H2S and cysteine ​​persulfate) and their oxidative metabolism to taurine, were summarized. Based on our data, these pathways are the reasons for the increased Cys flux in melanoma cells exposed to DT treatment. As mentioned above, DT treatment leads to increased thiosulfate levels, further demonstrating this effect (see [link to relevant documentation]). Figure 7C ).

[0226] As another example, the inventors verified the above by conducting experiments using vemurafenib (the first FDA-approved Braf V600E inhibitor). They found that metabolic reprogramming, similar to that used in DT resistance development, plays a role in V resistance development. Consistent with metabolomics analysis, in in vitro cell culture proliferation assays, the time required for vemurafenib resistance development was shorter than that required for dabrafenib-trametinib resistance development. This is logical, as dual inhibition of Braf and MEK leads to a more complete blockade of the MAPK / ERK pathway.

[0227] DT treatment also induced metabolic changes, which have been confirmed in vivo using xenograft models; this result is also consistent with the inventors' in vitro results.

[0228] In another set of experiments (ETHE1 silencing assay, which improved the effect of DT treatment on A375 cells), the levels of enzymes involved in the sulfide catabolism chain in DT-resistant cells were restored to the levels observed in untreated control cells. Figure 7D Up to 7F).

[0229] All of these, mostly unexpected discoveries, prompted the inventors to test the effects of CSE inhibitors on resistance in the current context. In this test, A375 cells cultured in a medium containing vitamin V acquired complete resistance after two months, while cells receiving a combination of vitamin V and PAG (a CSE inhibitor) showed significantly reduced proliferation. Figure 10AIn the case of DT treatment, resistance development takes approximately 4 months in vitro. However, 2 months of combined DT and PAG treatment significantly inhibited tumor cell growth compared to DT treatment alone. Figure 10B Similar results were obtained with other BrafV600i / MEK1 / 2i, CV, and EB models. Figures 10C-10D ).

[0230] As another example, combining the CSE inhibitor PAG with Braf V600E and MEK1 / 2 inhibitors demonstrated benefit for the SK-Mel28 cell line, another melanoma cell line carrying the Braf V600E mutation. For this cell line, the time required to acquire resistance was longer than for the A375 cell line; however, preliminary results indicated that SK-Mel28 cells receiving PAG, in addition to Braf V600E and MEK1 / 2 inhibitors, proliferated more slowly.

[0231] The restoration of phosphorylated MEK1 / 2 levels is (at least) partially necessary for the acquisition of resistance. Therefore, the inventors compared the levels of phosphorylated MEK1 / 2 in cells cultured for two months with or without PAG, and found that the levels of phosphorylated MEK1 / 2 were lower in PAG-treated cells. Furthermore, in cell lines receiving PAG as a combination therapy (V, DT, and EB), phosphorylated Akt was significantly reduced, which is crucial for the development of acquired resistance to BrafV600i / MEK1 / 2i, as demonstrated by the inventors and others. The inventors also demonstrated that CSE levels were elevated after DT treatment in various Braf V600 mutant cell lines and melanoma patient samples. Furthermore, they showed that dual administration of DT and PAG delayed the development of acquired resistance in mouse models. Figures 11A-11C This strengthens the significance of the present invention.

[0232] To confirm that PAG overcomes resistance by inhibiting CSE, another experiment was conducted using CSE-knockout melanoma cells. CSE knockout resulted in a heterogeneous cell population in which knockout was successful, but a low proportion of cells remained CSE-positive. It was observed that CSE protein levels were almost undetectable at the start of the experiment. Figure 12A However, after about a month and a half of DT treatment, the CSE levels in the control group and the gene knockout cell line were almost identical. Figure 12B Therefore, it can be concluded that cells with incomplete gene knockout overgrow cells due to DT selection pressure. This experiment further demonstrates that this process is CSE-specific; therefore, CSE-specific inhibitors should be used in this invention. Therefore, CSE is an important stress response element in MAPK inhibitor therapy and can serve as a secondary drug target to improve the efficacy of BRAF inhibitors and / or MEK inhibitors (e.g., V and DT targeted therapy).

[0233] BrafV600E mutant melanoma is one of the deadliest types of skin cancer and remains a serious healthcare problem because previously introduced, initially highly effective targeted therapies quickly fail due to resistance. The combination of dabrafenib and trametinib (DT) inhibits Braf and downstream MEK1 / 2 kinases, leading to extensive metabolic reprogramming, including increased glutamine catabolism and a shift from aerobic glycolysis to oxidative phosphorylation, where oxidative phosphorylation, along with increased CYP activity, co-induces oxidative stress. This is offset by elevated PPP activity and a Nrf2-mediated stress response, resulting in overexpression of multiple oxidoreductases, increased GSH, and the production of sulfides and persulfides due to increased cysteine ​​uptake and a significant reprogramming of cysteine ​​metabolism. Upon Braf inhibition, CBS is downregulated, while CSE and enzymes in the sulfide catabolism pathway are strongly upregulated; conversely, resistant cells revert to CBS and downregulate CSE levels. This is consistent with the immediate stress response following drug exposure and the restoration of anabolism in resistant cells. The enzymatic activities of these two transsulfurin proteins were analyzed using stable isotope tracing technology. Based on the inventors' throughput data, drug-induced rapid CSE overexpression does not support an increased cellular demand for Cys; instead, it utilizes cysteine ​​(via glutamate-supported xCT activity transport) to increase persulfide and indirectly increase sulfide levels. The inventors' data indicate that in melanoma cells, BrafV600E inhibition-induced persulfide / sulfide production is crucial for meeting the cells' growing energy demands by providing antioxidant protection and a backup electron source for ETC, thus ensuring survival under drug-induced stress. Most importantly, these observations identify CSE as an important immediate stress response element in melanoma cells following drug exposure, and it can be used as a secondary drug target in drug development to improve the efficacy of Braf inhibitor therapies.

[0234] The methods for identifying BRAF V600 mutations in cancer are well known and are known to those skilled in the art.

[0235] BRAF V600 can be identified on the archive organization, for example, the BRAF V600E / K mutation status.

[0236] A common method for detecting BRAF V600 mutations is PCR. For example, the cobas® 4800 BRAF V600 mutation assay (Roche) is a real-time polymerase chain reaction (PCR) assay used to detect and identify BRAF V600 mutations in human melanoma in formalin-fixed paraffin-embedded tissue (FFPET) (Mourah S. et al., 2015).

[0237] Sanger sequencing is also a suitable method for diagnosing V600 mutations, and may even provide better results than PCR testing. These two methods can also be combined for more reliable results (Qu, Kevin et al., 2013).

[0238] If the histological diagnosis of cancer or tumor (such as melanoma) is confirmed by an expert, it is also preferred. Treatment options for V600-mutant cancers or tumors (particularly melanoma) are well-known in the field and have been reviewed in ebooks such as Yushak, M. et al., Systemic therapy options for patients with unresectable melanoma (Yushak, M. et al. 2017).

[0239] However, in addition to melanoma, BRAF V600 mutations are also common in several other types of cancer, such as thyroid cancer and non-small cell lung cancer.

[0240] Treatment regimens that use MAPK inhibitors, especially BRAF V600 mutation inhibitors, and optionally, additionally with MEK inhibitors, are well known in the art.

[0241] An unrestricted example is the use of dabrafenib and trametinib in the treatment of patients with BRAF V600 mutations, evaluated in the BELIEVE trial and reviewed by Shimoi T. et al. (Shimoi T. et al., 2024). In these trials, patients with solid tumors received dabrafenib (150 mg) twice daily and trametinib once daily (2 mg) until disease progression or intolerable toxicity was observed. This study confirmed the good efficacy of dabrafenib and trametinib in BRAF V600-mutant tumors and concluded that dabrafenib and trametinib will provide a new treatment option for rare cancers (such as high-grade glioma, biliary tract cancer, and thyroid cancer) in patients with BRAF V600 mutations. This conclusion can be extended to other combination therapies with BRAF V600 mutation inhibitors, preferably with MEK inhibitors.

[0242] As mentioned above, resistance is a recurring problem in such treatments. Florent L. et al., in their recent review (Florent L. et al. 2023), compiled the latest data on cell and microenvironment-induced resistance to targeted therapies in BRAF V600-mutant metastatic melanoma. The discovery of targeted mutations and the understanding of the mechanisms of metastatic melanoma development have improved patient treatment; however, the authors also mentioned other unresolved resistance mechanisms and hope that future understanding of these mechanisms will contribute to improving the treatment of melanoma patients. They focused their review on the mechanisms of resistance to targeted therapies in BRAF V600E-mutant metastatic melanoma. The treatments described in these publications are incorporated herein by reference.

[0243] Cystathione-γ-lyase (CSE) inhibitors may be well-suited to these existing treatment options. CSE inhibitors have been suggested for the treatment of cancers other than those with BRAF V600 mutations.

[0244] For example, Liu et al. (Liu et al., 2021) and Wang et al. (Wang et al., 2019) reported the anticancer effects of CSE inhibition on certain tumors. Li et al. (Li et al., 2021) summarized the strategy of using H2S-producing enzyme inhibitors to control breast cancer and taught that CSE inhibitors I194496, I157172, PAG, BCA, and AVG have anticancer activity.

[0245] Typically, the therapeutically effective dose of CSEi compounds can be determined through standard experiments in the art. Once an animal model is established, such as the A375 melanoma cell line xenograft model established by the inventors, the appropriate dose range for the animals can be determined. In one embodiment of the invention, the compound or pharmaceutical composition of the invention is administered at a low dose, gradually increasing the dose until the desired effect of preventing / treating the associated disease is achieved. This will determine a therapeutically effective dose. Technicians, such as clinicians, are aware of the various factors that need to be considered when determining the optimal dose for a given subject. These considerations are well known to those skilled in the art. Essentially, FDA guidance (Rockville, MD, 2005) can be used. Nair and Jacob (Nair AB and Jacob S., 2016) provide a more detailed discussion.

[0246] For the CSE inhibitors of the present invention, such human doses, such as daily doses, may be, but are not limited to, 0.01 mg / kg to 100 mg / kg body weight or 0.05 mg / kg to 50 mg / kg body weight, especially for PAG, the dose is 0.1 mg / kg to 10 mg / kg, or equivalent doses of other CSE inhibitors. Pharmaceutical compositions and uses of CSE inhibitors are well known in the art, for example, as disclosed in US9725426B2 and US10227314B2, assigned to SOVA Pharmaceuticals. Selective inhibitors of cystathionine-γ-lyase (CSE) are well known, including PAG, which is commonly used in examples. Asimakopoulou, A. (Asimakopoulou, A. 2013) et al. reviewed the selectivity of commonly used pharmacological inhibitors of cystathionine β synthase (CBS) and cystathionine γ lyase (CSE).

[0247] Li, M et al. (Li, M et al., 2021) analyzed and reviewed CSE inhibitors, particularly focusing on selectivity. They also mentioned NSC4056, also known as gold tricarboxylic acid, which has an IC50 of 0.6 µM for CSE and is considered the most potent inhibitor as of 2021 (Hu, Y. et al., 2018). Another compound, 2-arylhydrazine dithiocarbamate, was shown to have higher selectivity for CSE than CBS and higher activity than commonly used inhibitors (Bhattacharjee A. et al., 2017). Example Example 1: Method reagents Unless otherwise specified, all reagents were purchased from Sigma and were of at least 97% purity. Organic solvents used for chromatography were purchased from Merck and were in gradient phase. Water was deionized and ultrafiltered using an Androna B30 HPLC system. Stable isotopes were manufactured by Cambridge Isotope Laboratories. HPE-IAM (β-(4-hydroxyphenyl)ethyliodoacetamide) was purchased from Santa Cruz Biotechnology. Dabrafenib, trametinib, and vemurafenib were all purchased from MedChemExpress.

[0248] Cell culture A375 cell lines were purchased from Sigma (#88113005) and treated with escalating doses of dabrafenib and trametinib until dabrafenib concentrations reached 62.5 nM and trametinib concentrations reached 10 nM; or with vemurafenib until a concentration of 2 µM was reached. After approximately 3–5 months, cells proliferated in the presence of the inhibitors, were considered resistant, and continued to grow in the presence of the drugs. Cells were cultured in a 37°C, 5% CO2 incubator with or without dabrafenib and trametinib or vemurafenib, using high-glucose DMEM (Thermo #21969035) containing 100 U penicillin-streptomycin (Lonza #DE17-602E), 2 mM L-glutamine (Lonza #17-605E), 10% fetal bovine serum (Sigma #F0392), and 100 nM sodium selenite. The SK-Mel28 cell line (human melanoma cell line) was kindly provided by the Department of Experimental Pharmacology at the National Institute of Oncology, Budapest, Hungary. It was cultured in the presence or absence of 62.5 nM dabrafenib and 10 nM trametinib in a 37°C, 5% CO2 incubator using RPMI 1640 medium (RPMI 1640, Gibco 11875093) containing 100 U penicillin-streptomycin (Lonza #DE17-602E), 2 mM L-glutamine (Lonza #17-605E), 10% fetal bovine serum (Sigma #F0392), and 100 nM sodium selenite. SK-MEL-28 expresses mutant B-Raf (V600E) and wild-type N-Ras, and is able to form tumors in nude mice, and these tumors were established from patient-derived tumor samples.

[0249] To examine the role of PAG in resistance development, as described above, A375 and SK-MEL28 cells were cultured in DMEM or RPMI containing 100 nM dabrafenib and 10 nM trametinib, with or without 0.5 mM PAG.

[0250] Cystine deprivation DMEM (Thermo #21013024), which lacks cystine and methionine, is supplemented with 30 mg / L L-methionine, dialysis FBS (Sigma #F0392), 100 U penicillin-streptomycin (Lonza #DE17-602E), 2 mM L-glutamine (Lonza #17-605E), 1 mM sodium pyruvate (Sigma #S8636), and 100 nM sodium selenite. Different concentrations of L-cystine were added before the experiment.

[0251] Cell viability and proliferation Cells were seeded into 12-well or 24-well plates. After treatment, cells were washed with HBSS, fixed with cold 10% trichloroacetic acid (TCA), and incubated at 4°C for at least 1 hour, followed by washing four times with MilliQ water. Sulfodamine B dye (0.4% dissolved in 1% acetic acid) was added to each well and incubated at room temperature for 15 minutes. The culture plates were rinsed four times with 1% acetic acid solution and then air-dried. To dissolve protein-bound SRB, 10 mM unbuffered Tris solution was added. Absorbance was measured at 570 nm using a microplate reader.

[0252] Western blot Cells were washed with HBSS and collected in RIPA buffer supplemented with protease and phosphatase inhibitors. Cell debris was removed by sonication for 15 seconds followed by centrifugation at 14000g for 10 minutes at 4°C. Protein concentration was determined using the bicinchoninic acid (BCA) method with bovine serum albumin (BSA) as a standard. Protein samples were denatured in SDS loading buffer and reduced with 100 mM dithiothreitol (DTT) at 95°C for 5 minutes. 15 µg of protein sample was loaded onto each well of a polyacrylamide gel. After size separation by electrophoresis, proteins were transferred to nitrocellulose membranes using a Trans-Blot Turbo Blotting System (BioRad). Transfer efficiency was verified by Ponceau staining. At room temperature, seal with TBST (0.05% Tween20) containing 5% skim milk and 0.5% BSA for 1 hour.Primary antibodies against the following: Akt (ab8805), catalase (ab52477), CBS (ab140600), CDO1 (ab232699), CSE (ab189916), DLST (ab177934), ETHE1 (ab174302), G6PD (ab993), GAPDH (ab181602), GCLC (ab53179), GPX1 (ab108427), GPX4 (ab125066), GS (ab124811), GSTpi (ab233112), IDH1 (ab172964), Nrf2 (ab137550), OGDH (ab137773), PFKFB3 (ab181861), PFKFB4 (ab137785), SO (ab129094). SOD1 (ab52950), SOD2 (ab13533), Trx (ab185329), and TST (ab166625) were purchased from Abcam; CARS2 (HPA041776), MPST (HPA001240), and SQOR (HPA017079) were purchased from Sigma; β-actin (3700S), ERK1 / 2 (4695T), MEK1 / 2 antibody (8727), PDH (2784), phosphorylated (Ser473)-Akt (9271S), phosphorylated ERK1 / 2 (Thr202 / Tyr204) (9101L), phosphorylated MEK1 / 2 (S217 / 221) (9121), and SDHA (5839) were purchased from CellSignaling; TRP14 (MAB3504) was purchased from R&D. Systems; GOT1 (MA531527) and GOT2 (PA527572) were purchased from Invitrogen, and TrxR1 (sc-28321) was purchased from Santa Cruz Biotechnology. The primary antibody was diluted 1:1000 in TBST and incubated with the membrane overnight at 4°C. After washing with TBST (3 times, 20 minutes each time), the membrane was incubated with horseradish peroxidase-labeled secondary antibody (anti-mouse / rabbit IgG (DAKO)) diluted 1:4000 at room temperature for 2 hours. After washing, the membrane was incubated with ECL reagent (BioRad) for 2 minutes, and the signal was detected using a gel imaging system (Syngene).

[0253] RNA isolation and RT-qPCR Cells were cultured in T25 flasks, and total RNA was isolated using TRIzol reagent (Applied Biosystems) according to the manufacturer's instructions. Concentration and purity were determined using a Nanodrop spectrophotometer. 3 µg of RNA sample was treated with 2U Dnase I (Thermo Scientific) at 37°C for 30 min. The reaction was terminated with 20 mM EDTA, followed by heat inactivation at 70°C for 10 min, and the sample was immediately placed on ice. RNA samples were reverse transcribed using a high-capacity cDNA reverse transcription kit (Applied Biosystems) according to the manufacturer's instructions. The DNA-RNA hybridization product was diluted 10-fold with RNase-free water and used as a template for real-time quantitative PCR. Analysis was performed using 2x qPCRBIO SyGreen Mix reagent (PCRBiosystems) on a Roche Light Cycler 480 instrument according to the manufacturer's instructions. The relative abundance of mRNA was calculated using the ΔCT method, with GAPDH, β-2-microglobulin (β2M), and actin as internal controls. β2M primers were purchased from Qiagen (#PPH01094E). All other primer sequences are listed in Table 1. RT 2 Profiler TM PCR array human cancer drug resistance (PAHS-004ZF) and RT 2 Profiler TM The PCR array for human cancer drug resistance (PAHS-004ZF) was purchased from Qiagen. For the PCR array, RT was used according to the manufacturer's instructions. 2 The First Strand Kit (330404) transcribed 2 µg of RNA and measured it on a Roche Light Cycler 480 instrument.

[0254] Table 1 Oligonucleotide Sequences

[0255] Preparation of CSE knockout melanoma cell lines Plasmids expressing Cas9 and sgRNA (kindly provided by Dr. MazharAdli of Northwestern University) were used in all CRISPR experiments. Twenty-nucleotide sgRNAs were designed using Benchling.com software. 5'-CACC-3' and 5'-AAAC-3' overhangs were added to the 5' ends of the forward and reverse complementary oligonucleotides, respectively. The forward and reverse sgRNA oligonucleotides were mixed in NEBuffer 2 (NEB #B7002S, New England Biolabs), heated to 95°C, annealed by gradually decreasing the temperature, and finally ligated into the BsmBI-cleaved sgRNA expression plasmid, followed by transformation. Positive sequences were confirmed by Sanger sequencing. Vector controls included two non-targeted 20-nucleotide control guide sequences. PsPAX2, Pmd2G, and plasmids containing the target sequence were transfected into HEK293T cells using FuGene6 (Promega E2691) at a ratio of 4:1:5 in OptiMem medium (Gibco #31985070). The virus-containing medium was collected and replaced with fresh, high-glucose DMEM medium (see above) after 24 and 48 hours. The collected medium was filtered through a 0.22 μM filter syringe and stored at 4°C for immediate use, or... Long-term storage at 80°C. A375 melanoma cell lines expressing wild-type Cas9 were seeded at 40-60% confluence and allowed to adhere. Cells were then infected with a lentiviral mixture containing 8 µg / mL polybrene or control medium. After 14+ hours, selection was performed with puromycin (2 µg / mL) until all untransfected cells died. After selection, clones were obtained from single cells and cultured into homogeneous cell cultures. The SgRNA sequences used are as follows: Sg continuation (Cont.): 1. TCATGCTTGCTTGGGCAAAA; sequence number: 31 2. GCCAGCGGGGATATGGTGAA sequence number: 32 Sg CSE: 1. TCCAGAGCAATGGACCTCCA; sequence number: 33 2. AGGCGCCCCTTGCTTGAACG; sequence number: 34. All cloning experiments used competent DH5α Escherichia coli strains.

[0256] Mitochondrial activity measurement Oxygen consumption rate (OCR) and extracellular acidification rate (ECAR) were measured using an extracellular flux analyzer (Seahorse Biosciences, Seahorse XFp Analyzer). Cells were seeded into Seahorse culture plates (Seahorse Biosciences, Seahorse XFpFluxPak). Mitochondrial function was characterized using a mitochondrial stress test kit (103015); glycolytic function was characterized using a glycolytic stress test kit (103020). After each experiment, cell culture plates were fixed with 10% TCA, and SRB (saturated glycogenotoxicity) was measured. OCR and ECAR data were normalized using measured absorbance data.

[0257] in vivo model For cell line-based xenotransplantation, 10 6 200 µl of DMEM was subcutaneously injected into 8-10 week old NOD.CB17-Prkdc cells. scid / NCrCrl (NOD-SCID) or NOD.Cg-Prkdc scid Il2rg tm1Wjl / SzJ (NSG) mice. The patient-derived tumor xenograft (PDTX) model was kindly provided by KINETO Lab Ltd. in Budapest. As previously described, this model involved implanting a freshly resected, untreated BRAFV600E-mutant melanoma sample into NOD.Cg-Prkdc mice. scid Il2rg tm1Wjl The model was established using SzJ (NSG) mice (The Jackson Laboratory, Bar Harbor, ME, USA). For PDTX experiments, fourth-generation (G4) tumor samples (approximately 2 × 2 × 2 mm) from a subcutaneous (sc) growth model were subcutaneously implanted into NOD-SCID mice. The width and length of the tumor were measured twice weekly using digital calipers. Volume was estimated using the following formula: Volume = (Width) 2 × Length / 2. When the tumor volume reaches the estimated 200 mm. 3Mice were randomly assigned to groups and orally administered 30 mg / kg dabrafenib and 1 mg / kg trametinib, respectively, for a total of four doses. For cell line-derived xenografts, mice received treatment daily for four consecutive days. Mice carrying PDTX were treated on days 1, 4, 5, and 6. Twenty-four hours after the last treatment, mice were sacrificed, tumor weight was measured, and the tumors were rapidly frozen in liquid nitrogen. The frozen tissue was then pulverized using a tissue pulverizer.

[0258] For long-term treatment of DT or DT+PAG, 1.5 x 10 6 A375 cells were subcutaneously injected into NSG mice. When the tumor volume reached the estimated 100 mm... 3 Mice were randomly divided into two groups: the DT+PAG group received oral administration of 30 mg / kg dabrafenib and 1 mg / kg trametinib five times a week (37 times in total), and the DT+PAG group received intraperitoneal injection of 5 mg / kg PAG three times a week (23 times in total). After the DT group mice acquired resistance, all mice were sacrificed and tumor weight was measured.

[0259] license: KINETO Lab Ltd. holds an animal husbandry license (PEI / 001 / 1715 / 2015) and a license for PDTX sample collection, processing, model generation, and use (IV / 10147-1 / 2020 / EKU). Cryopreserved PDTX samples were transferred with dry ice to the laboratory animal facility of the National Institute of Oncology, whose animal husbandry license (PEI / 001 / 1738-3 / 2015) and anticancer drug xenograft experiment license (PE / EA / 1461-7 / 2020) cover all activities during the research. All ethical licenses were granted by the Hungarian National Committee – the Scientific and Research Ethics Committee. Immunohistochemical analysis of patient samples Formalin-fixed paraffin-embedded melanoma tumor samples were collected from the National Cancer Institute Biobank. This procedure was approved by the Hungarian National Ethics Committee (document number IV / 10441–1 / 2020 / EKU). After preparing 2 µm thick tissue sections, the sections were dewaxed and subjected to antigen retrieval at 95°C for 20 minutes in Roche ULTRA Cell Conditioning (CC1) (pH 6.0). Incubation was performed at 37°C for 20 minutes using an anti-CSE antibody (Abcam #ab189916) at a 250-fold dilution. Dewaxing, antigen retrieval, and staining were all performed using a Roche BenchMark ULTRA IHC / ISH system. Staining was performed according to the manufacturer's instructions using the UltraView Universal Alkaline Phosphatase Red Detection Kit (Roche #760-501), followed by counterstaining with hematoxylin. Images were acquired using an Olympus BX43 microscope equipped with a DP74 camera.

[0260] Lentiviral transduction For stable ETHE1 knockdown mediated by shRNA, the inventors used MISSION shRNA lentiviral transduction particles (SHCLNV-NM_014297, ID: TRCN0000083454) with a multiplicity of infection (MOI) of 5. The corresponding control was the MISSION pLKO.1-puro empty vector control transduction particle (#SHC001V). Single clones were cultured from the entire cell population, and ETHE1 expression was assessed using Western blot analysis. Clone 9, with the lowest ETHE1 expression level, was selected for further experiments (Figure 9).

[0261] Isotope tracing experiment For isotope tracing experiments, the culture medium used is the same as that used in cystine deprivation experiments (see above), but supplemented with either methionine or cysteine. For methionine labeling, the culture medium contains 30 mg / L L-[ 34S]-Met (Cambridge Isotopes #sc-482584A) and 200 µM unlabeled L-cysteine ​​(Sigma #C7602); for cysteine ​​labeling, the medium contained 30 mg / L unlabeled L-methionine (Sigma #M9625) and 200 µM-U[ 13 C], U[ 15 [N]-Cysteine ​​(Cambridge Isotopes #CNLM-4244-H-PK) (see Figure 3C). After inoculation and reaching 80% confluence, the culture medium was removed, the cells were washed with HBSS, and then the culture was treated with a medium containing heavy isotopes for a specified time. HPLC-MS / MS determination of amino acids Cells were seeded in 6-well plates, washed with HBSS, collected in CHAPS buffer (150 mM KCl, 50 mM HEPES pH 7.4, 0.1% CHAPS, protease inhibitor), and sonicated for 10 seconds. After centrifugation (14000g, 10 min, 4°C), the protein concentration in the supernatant was determined using the BCA method. 50 µl of a 1 mg / mL sample was derivatized using the EZ:Faast kit (Phenomenex, Torrance, CA, USA) according to the manufacturer's instructions, and analyzed using a Thermo Vanquish UHPLC system coupled with a Thermo Q Exactive Focus mass spectrometer. The m / z values ​​recommended by the EZ:Faast kit were used, supplemented with m / z values ​​for isotope labeling. The monitored transitions are shown in Table 2.

[0262] Table 2

[0263] HPLC-MS / MS determination of low molecular weight (LMW) metabolites Assays were performed based on the method published by Akaike et al. (Akaike et al., 2017), as described herein: Cells were seeded in 6-well plates, washed twice with HBSS, and then obtained in ice-cold methanol containing 5 mM β-(4-hydroxyphenyl)ethyliodoacetamide (HPE-IAM). For measurements of xenograft tumors, approximately 10–40 mg of cryo-pulverized tissue samples were homogenized in 5 mM HPE-IAM. Samples were kept on ice between each preparation step. After sonication, alkylation was performed at 37 °C for 20 min, followed by centrifugation (14000 g, 10 min, 4 °C). Prior to injection, the supernatant was acidified with 10% formic acid (FA) and diluted twice with 0.1% formic acid / H2O. The cell pellet was dissolved in 1% SDS / PBS, sonicated, and protein content was determined using the BCA method. HPLC-MS / MS measurements were performed using a Thermo Q-Exactive Focus Orbitrap mass spectrometer coupled with a Thermo Vanquish UHPLC system. Two different methods were used to measure the samples.

[0264] To determine extracellular metabolites, 50 µl of culture medium was alkylated with 5 mM HPE-IAM at 37 °C for 20 min. The sample was acidified with 10% TCA and centrifuged at 14000 g for 10 min at 4 °C.

[0265] The first method was performed on a Phenomenex Kinetex C18 (50 x 2.1 mm, 2.6 µm) column with a mobile phase of 0.1% FA / H₂O (A) and 0.1% FA / MeOH (B). An initial concentration of 5% B solution was linearly increased to 13% over 2 minutes, then to 95% over 4 minutes, held for 0.5 minutes, and then decreased to 5% B solution over 0.1 minutes, held for 3.4 minutes, before the next injection. The flow rate was 0.5 ml / min, and the temperature was 40 °C. Detection was performed by MS / MS in positive ion mode, using high-energy collisional dissociation (HCD) to detect the analytes listed in Table 2.

[0266] The second method employed a Phenomenex Hypercarb (100 x 2.1 mm, 3 µm) column with a mobile phase of 0.5% FA / H₂O (A) and 0.5% IPAIN 1:1 (B). The initial concentration of B was 0%, linearly increased to 30% within 15 minutes, then increased to 100% within 1 minute, held for 5 minutes, and then decreased to 100% A within 1 minute, held for 8 minutes. The temperature was 40 °C, and the flow rate was 0.2 ml / min. High-energy collisional dissociation (HCD) was used, and the analyte was detected by MS / MS in positive ion mode.

[0267] HPLC-MS / MS determination of taurine and linu-taurine Cells were seeded in 6-well plates, washed twice with HBSS, and harvested in ice-cold 75% methanol. For measurements of xenograft tumors, approximately 10–40 mg of cryogenically pulverized tissue samples were homogenized in ice-cold methanol. Samples were kept on ice between each preparation step. After sonication, protein precipitates were removed by centrifugation (14000 g, 10 min, 4 °C). Before injection, the supernatant was acidified with 10% formic acid (FA) and diluted twice with 0.1% FA / ACN. The cell pellet was dissolved in 1% SDS / PBS, sonicated, and protein content was measured using the BCA method. HPLC-MS / MS measurements were performed using a Thermo Scientific LTQ-XL mass spectrometer with a Thermo Vanquish UHPLC and a Phenomenex Kinetex HILIC column (100 x 2.1 mm, 2.6 µm) according to previously published methods.

[0268] HPLC-MS / MS determination of protein persulfides Measurements were performed according to the method published by Akaike et al. (Akaike et al., 2017), as described herein: Cells were seeded in 6-well plates, washed with HBSS, harvested in RIPA buffer containing 5 mM HPE-IAM, and sonicated. After centrifugation (14000 g, 10 min, room temperature), 100 µl of the supernatant was collected and desalted using a Zeba column (7K MWCO, 0.5 mL). The protein content in the effluent was measured using the BCA method, and then 100 mM HPE-IAM DMSO was added to the desalting solution. The protein content in the desalted sample was adjusted to be equal using RIPA buffer, and then digested with streptomycin (3 mg / ml) in 35 mM sodium acetate buffer (pH 5.0) at 37°C for 1 h. Undigested proteins were precipitated with 10% TCA, and then centrifuged (14000 g, 10 min, room temperature). The supernatant was injected into LC-MS / MS, and the derivatized analytes were measured using the same HPLC-MS / MS method as for the LMW species described above, employing a Kinetex C18 column. Cysteine ​​and cysteine ​​persulfates were detected using MS / MS in positive ion mode, utilizing higher-energy collisional dissociation (HCD).

[0269] The determination of thiosulfate (S) using an alkylation scheme based on monobromodiamine. 2 O 3 ) Cells were seeded in 12-well plates and washed once with PBS. After adding 100 µl of PBS solution containing 1 mM monobromodiamine (pH 8.0), cells were scraped and collected, and incubated at 37°C for 1 hour to label with thiol groups. The reaction was terminated with 10 µl of 50% TCA, and the precipitated protein was removed by centrifugation at 4000g for 5 minutes at room temperature. The precipitated protein was then redissolved in 4% SDS containing 0.1 M NaOH for BCA protein assay.

[0270] The derivatives in the supernatant were detected using a Thermo Ultimate 3000 HPLC system equipped with a fluorescence detector. 5 µl of derivatized sample was injected into a Phenomenex Kinetex XB-C18 150x3 mm 2.6 μm column for separation. The mobile phase consisted of 0.1% TFA / H₂O (A) and 0.1% TFA / MeOH (B), with gradient elution as follows: flow rate set at 0.6 ml / min, initial B phase concentration of 10%. After 3 minutes, the concentration was linearly increased to 15% B within 9 minutes. The column was then washed with 75% B for 2 minutes and equilibrated with 10% B for 3 minutes before the next injection.

[0271] Hydrogen sulfide labeled with monobromodiamine was measured from the same sample using different chromatographic methods. A Phenomenex Luna C18(2) 250x2mm 2.6µm column was used with mobile phases of 0.1% TFA / H2O (A) and 0.1% TFA / ACN (B) and gradient elution was performed as follows: the flow rate was set at 0.25 ml / min, the initial B phase ratio was 15% B, and it was increased to 35% B within 3 minutes. At 8.5 minutes, it was linearly increased to 90% B again within 2 minutes. 90% B was maintained for 1 minute, then reduced to 15% B after 1 minute, and equilibrated with 15% B for 2 minutes before the next injection.

[0272] For fluorescence detection of labeled analytes, an excitation wavelength of 390 nm and an emission wavelength of 475 nm were selected, and quantification was performed using a calibration curve established with standard solutions.

[0273] Example 2 2.1. In addition to activating the PI3K / Akt pathway, dabrafenib-trametinib resistant cells also overexpress ABC transporters. Proteins and cytochrome P450 protein.

[0274] To investigate the molecular and metabolic background of melanoma resistant to MAPK inhibitors (MAPKi), the inventors generated a BRAF V600E mutant human melanoma A375 cell line (A375-DTR) through long-term culture in the presence of escalating doses of dabrafenib (a BRAF inhibitor) and trametinib (a MEK1 / 2 inhibitor). Figure 1A Proliferation assays were used to track the continued viability of resistant cells in the presence of the drug. Figure 1B By measuring the phosphorylation (activity) of MEK1 / 2 and ERK1 / 2 ( Figure 1C This confirmed a decrease in MAPK / ERK pathway activity. After 48 hours of DT treatment of control (A375-control) cells, MEK1 / 2 phosphorylation was inhibited, while DT-resistant cells partially recovered MEK1 / 2 phosphorylation. Furthermore, inhibition of the MAPK-ERK pathway led to increased Akt phosphorylation and activation. Figure 1D This is consistent with previous reports that increased PI3K-Akt pathway activity contributes to DT resistance. Using Qiagen's real-time quantitative PCR (RT-qPCR) chip, the inventors discovered the overexpression of several other genes associated with cancer resistance development. Figure 1E The increased expression of these genes was confirmed using custom-designed oligonucleotides (F). Figure 1E Besides the ATPase H+ transport V0 subunit d2 ( ATPase H+ transporting V0 subunit d2 ATP6V0D2), apolipoprotein E (APOE), heat shock protein B1 (HSPB1), and ATP-binding cassette transporter G subfamily member 2 ( ATP binding cassette subfamily G member 2 In addition to increased expression of the ABCG2 gene (Figure 1G), which is typically involved in the neutralization and efflux of exogenous substances, the inventors also found overexpression of cytochrome P450 family (CYP) members CYP1B1, CYP2C13, CYP2F1, and CYP17A1 (Figure 1G). CYP proteins play multiple roles in cellular metabolism by oxidizing steroids, fatty acids, and drugs and exogenous substances. Because CYPs are heme proteins and function as terminal oxidases, they are important participants in the production of endogenous reactive oxygen species (ROS) (Veith and Moorthy, 2018).

[0275] 2.2. Changes in the redox environment of DT treatment and DT resistance (DTR) in melanoma cells The inventors created A375 cells resistant to dabrafenib and trametinib (DTR). Figure 1A -C), and studied the expression of resistance-related genes ( Figure 1D 1G and Figure 8A , 8B They found that, among other factors, members of the cytochrome P450 (CYP) family were overexpressed ( Figure 1E These members, while neutralizing exogenous substances, generate reactive oxygen species (ROS) (Veith and Moorthy, 2018). Overexpression of CYP enzymes may explain previously observed phenomena: A375 cells resistant to Braf and MEK inhibitors produced higher levels of ROS (Corazao-Rozas et al., 2013; Wang et al., 2018). Overexpression of CYP enzymes—in addition to intense oxidative phosphorylation—may lead to increased oxidative flux observed in Braf inhibitor (BRAFi) resistant A375 cells (Corazao-Rozas et al., 2016; Corazao-Rozas et al., 2013; Wang et al., 2018). Furthermore, increased OXPHOS in DT treatment and DT-resistant cells may also promote ROS production (see below). To counteract oxidative stress, (BRAFi) resistant melanoma cells exhibit nuclear factor E2-related factor 2 (NGF-E2). nuclear factor-erythroid factor 2-related factor 2 Strong activation of the Nrf2 transcription factor leads to increased activation of the pentose phosphate pathway (PPP) and xCT expression (Khamari et al., 2018). Here, the inventors found a significant increase in Nrf2 levels in DT-treated cells and confirmed a slight accumulation of Nrf2 in DT-resistant cells. Figure 1FTherefore, the inventors confirmed the accumulation of Nrf2 in DTR cells and showed that Nrf2 decreased after drug deprivation, and found that Nrf2 levels in DT-treated control cells increased more significantly over 7 days. Thus, Nrf2-mediated antioxidant responses occur immediately after DT exposure and are partially retained in DTR cells. Figure 1F The study found that many key antioxidant proteins, including catalase (CAT) and superoxide dismutase 2 (SOD2), as well as members of the thioredoxin (Trx) and glutathione (GSH) systems (such as thioredoxin reductase 1 (TrxR1), 14 kDa human thioredoxin (Trx)-associated protein (TRP14), and glutathione peroxidase 1 and 4 (GPX1,4)), exhibited similar protein expression patterns, suggesting that DT-induced changes in antioxidant gene expression levels are primarily mediated by Nrf2 (Figure 1G). Among these enzymes, TrxR1 is unique, and it is also abnormally elevated in DTR cells.

[0276] In addition to elevated intracellular glutathione levels, the inventors also discovered that the enzyme responsible for neutralizing ROS was overexpressed not only in resistant cells but also in DT-treated cells. Figure 1H Compared to untreated control cells, DT-treated control cells and DT-resistant cells showed elevated levels of catalase (CAT) and superoxide dismutase 2 (SOD2), enzymes that eliminate peroxides and superoxides, while the levels of these enzymes gradually decreased in DT-deficient resistant cells. The same trend was observed with members of the thioredoxin (Trx) and glutathione (GSH) systems, such as thioredoxin reductase 1 (TrxR1), 14-kDa human thioredoxin (Trx)-associated protein (TRP14), and glutathione peroxidase 1 and 4 (GPX1, 4). Notably, TrxR1 is unique among these enzymes, exhibiting anomalous elevation in DT-resistant cells. Enzymes in the Trx and GSH systems are typically responsible for maintaining cellular redox homeostasis through a series of redox reactions on protein and peptide cysteine ​​residues (Lu and Holmgren, 2014). The core hubs of these two systems are TrxR1 and glutathione reductase (…). glutathione reductase Glucose-6-phosphate dehydrogenase (GR) converts cellular reducing power from nicotinamide-adenine dinucleotide phosphate (NADPH) into oxidized Cys-modified reductions. Most NADPH is produced via the pentose phosphate pathway (PPP), a metabolic pathway parallel to glycolysis. Glucose-6-phosphate dehydrogenaseG6PD is an enzyme in the pentose phosphate pathway (PPP) responsible for converting NADP+ to NADPH. By measuring its levels, the inventors observed the same trend as previously observed with oxidoreductases in their melanoma cell model. Figure 1I This further confirms that these cells have a higher need for enhanced antioxidant capacity.

[0277] The Trx and GSH systems utilize most of their reducing power from nicotinamide-adenine dinucleotide phosphate (NADPH), which is primarily generated by the PPP enzyme glucose-6-phosphate dehydrogenase (PPP). Glucose-6-phosphate dehydrogenase G6PD is produced. Consistent with the expected antioxidant capacity requirements of treated melanoma cells, the expression level of G6PD in the model of this invention shows a similar trend to that of the aforementioned oxidoreductases (Figure 1G).

[0278] In glucose metabolism, the flux between glycolysis and PPP is controlled by a bifunctional phosphofructokinase / fructose-2,6-bisphosphatase (PFP). 6-phosphofructo-2-kinase / fructose-2, 6-bisphosphatase The PFKFB3 family of enzymes controls glucose. The kinase activity of PFKFB3 diverts glucose to the glycolytic pathway, while the fructose-1,5-bisphosphatase activity of PFKFB4 redirects glucose to the PPP pathway (Yi et al., 2019). These enzymes are receiving increasing attention in cancer biology. For example, in a xenograft model of prostate cancer cells, PFKFB4 depletion inhibits tumor growth by allowing catastrophic ROS accumulation (Ros et al., 2012). Furthermore, the inventors have previously demonstrated elevated PFKFB4 expression in CBS-silenced breast cancer cells, which may be related to increased oxidative stress in these cells (Erdelyi et al., 2021). By measuring the protein levels of PFKFB3 and PFKFB4, the inventors found that in DT-treated control cells, PFKFB3 levels were decreased and PFKFB4 levels were increased, consistent with the redirection of glucose flux to the PPP after DT treatment to support the cells' increased demand for NADPH. Figure 1H In DT-resistant (DTR) cells, the levels of PFKFB3 and 4 almost returned to those observed in untreated control cells, which, along with the antioxidant protein expression profile, indicates a more balanced redox environment and reactivation of the glycolytic pathway. Figure 1J ).

[0279] In summary, DT treatment suppresses the increase in oxidative stress induced by the MAPK / ERK pathway in melanoma cells, which is offset by the overexpression of several antioxidant genes mediated by Nrf2. This antioxidant response is supported by the shift from glycolysis to PPP, accompanied by a corresponding increase in NADPH production, thus providing energy for the antioxidant mechanism. In DT-resistant cells, a more balanced redox environment and the restoration of glycolysis can be predicted by regulating the expression patterns of enzymes involved in cellular antioxidant responses and glucose metabolism.

[0280] 2.3. The cellular energy metabolism of cells treated with DT and DT-resistant cells undergoes remodeling.

[0281] Elevated Nrf2 levels in DT-treated and DTR cells (see above) are also responsible for redirecting glucose and glutamine to anabolism (Mitsuishi et al., 2012). Furthermore, it is generally believed that BRAF mutations can reprogram cellular metabolism; for example, the V600E mutant BRAF maintains glycolytic activity, thus the dependence on glycolysis effectively becomes a dependence on BRAF V600E itself (Hall et al., 2013). Therefore, BRAF inhibitors can profoundly alter the metabolism of melanoma cells. Other research groups have demonstrated that melanoma cells exposed to BRAFi rapidly rely on oxidative phosphorylation (OXPHOS) for survival, as evidenced by the high sensitivity of BRAFi-treated cells to apoptosis induced by several mitochondrial respiratory chain inhibitors (Corazao-Rozas et al., 2016; Corazao-Rozas et al., 2013). Therefore, the inventors used the Seahorse cell analyzer to measure oxygen consumption rates (OCR) and extracellular acidification in their cell model system. The researchers investigated the glycolytic activity of these cells (ECAR) and found that DT-treated cells exhibited higher basal respiration, but both DT-treated and DT-resistant cells showed higher non-mitochondrial oxygen consumption, maximum respiration, and higher reserve respiration capacity (Figure 2A). They also studied the glycolytic activity of these cells, finding that DT-treated control cells had lower glycolytic activity, capacity, and reserve, while these activities, capacity, and reserves were (partially) restored in DT-resistant cells (Figure 2B). A fundamental characteristic of cancer cell metabolism is enhanced aerobic glycolysis to support macromolecule synthesis, thereby meeting the metabolic demands of rapidly proliferating cells (DeBerardinis and Chandel, 2016). Therefore, it is not surprising that resistant cells need to restore glycolytic activity to regain proliferative capacity. This aligns with the aforementioned need for a more balanced redox environment and the reduction of excessive NADPH production through PPP, enabling cells to restore their anabolic mechanisms.

[0282] Consistent with the antioxidant response, increased mitochondrial respiration and decreased glycolytic activity were observed in DT-treated control cells, accompanied by elevated levels of citrate cycle proteins to balance drug-induced oxidative stress. Figure 2C (Corazao-Rozas et al., 2016; Corazao-Rozas et al., 2013). In DTR cells, the inventors found enhanced mitochondrial respiration and pyruvate dehydrogenase (PDH). pyruvate dehydrogenase PDH) and succinate dehydrogenase ( succinate dehydrogenase Increased SDHA levels and restored glycolytic activity ( Figure 2C This aligns with a balanced redox environment, which together promotes the recovery of anabolic mechanisms and cell proliferation.

[0283] Next, the inventors measured the protein levels of citric acid cycle (CAC) enzymes responsible for providing electron donors (e.g., NADH) to the electron transport chain (ETC). The inventors discovered that pyruvate dehydrogenase (PDH), responsible for producing NADH... pyruvate dehydrogenase PDH), α-ketoglutarate dehydrogenase ( oxoglutarate dehydrogenase OGDH), dihydrolipoic acid octanoate S-succinyltransferase (O ...) dihydrolipoamide S-succinyltransferase DLST was significantly elevated in the DT-treated control group, while it was moderately elevated in DTR cells. Succinate dehydrogenase (S...) uccinate dehydrogenase SDHA—not only a CAC enzyme but also a member of ETC, responsible for the reduction of coenzyme Q—was significantly elevated in DT-treated cells, but its level did not decrease in DTR cells; instead, it increased further. Figure 2C ). This enzyme pattern is consistent with the increased ETC flux under DT treatment to support the cell's increased energy demands.

[0284] Next, the inventors performed mass spectrometry metabolomics analysis to measure intracellular and extracellular amino acid levels. Targeted amino acid metabolomics analysis revealed increased levels of intracellular glutamine (Gln), asparagine (Asn), and aspartate (Asp) in DT-treated control cells, while Asp levels were slightly increased in DT-resistant cells (Fig. 2D). Furthermore, both DT-treated control cells and DTR cells absorbed more Gln (Fig. 2E), consistent with previous observations of upregulation of the Nrf2 pathway in these cells, as Nrf2 also promotes Gln consumption (Mitsuishi et al., 2012). Interestingly, the inventors found increased extracellular Asn levels in the culture medium of DT-treated control cells and DTR cells, while Asp levels were increased in DTR cells (Fig. 2E), indicating that the metabolic pathways involved in these amino acid conversions were also specifically reprogrammed. Therefore, the inventors examined the expression of genes involved in glutamate (Glu) metabolism. Glutamate, a non-essential amino acid, plays a central role in cancer cell antioxidant defense, metabolic reprogramming, and oncogenic signaling (Zhu and Thompson, 2019). Based on previous observations, glutamate can be converted into alpha-ketoglutarate (αKG) to supply CACs, a component of GSH synthesis, and is used by the xCT antitransporter to export cysteine ​​into the intracellular matrix. Glutamate synthase (GLUL) converts Glu to Gln, while glutaminases 1 and 2 (GlU and Glutamine synthase 1) convert Glu to Gln. glutaminase 1, 2 GLS1,2) enzymes synthesize Glu from Gln via glutamine degradation. Figure 2FThe study found that DT-treated control cells upregulated the expression of GLS1 and 2 genes, while resistant cells upregulated GLS1 expression and strongly suppressed GLUL expression (Figure 2G). This indicates that DT-treated cells upregulated glutamine breakdown to meet their additional demand for Glu, while DT-resistant cells inhibited the conversion of Glu to Gln to meet their increased Glu demand (Figure 2G). This is consistent with the aforementioned increased Gln uptake and previous findings (Baenke et al., 2016; Khamari et al., 2018). Previous studies have also shown that Nrf2-mediated retargeting of glucose and glutamine metabolism exists in cells resistant to MAPK inhibitors (Baenke et al., 2016; Khamari et al., 2018), although V-resistant cells were used, which is consistent with the inventors' findings. Glutamate oxaloacetate transaminase 1 (GOT1, cytoplasm) and 2 (GOT2, mitochondria) promote the reaction of aspartate with α-ketoglutarate to produce glutamate and oxaloacetate (Recasens et al., 1980). They are members of the malate-aspartate shuttle system and therefore play important roles in metabolite exchange between mitochondria and cytoplasm, amino acid metabolism, and the regulation of intracellular NAD(H) redox balance. However, in this cell model system, no significant differences in their expression levels were observed. Figure 2H ).

[0285] In summary, the data presented in this paper demonstrate that metabolic pathways involved in cellular energy metabolism are deeply reprogrammed in melanoma cells resistant to BrafV600Ei and MAPKi. This includes upregulation of OXPHOS and increased expression of CAC enzymes that produce NADH to supply the electron transport chain (ETC). In addition to the upregulation of these pathways, the inventors also found enhanced glutamine degradation in DT-treated and DT-resistant cells, indicating an increased demand for glutamate.

[0286] Previous reports have indicated that melanoma cells resistant to MAPK inhibitors are more sensitive to transcriptional repression of the xCT antiporter (Wang et al., 2018), which is responsible for the uptake of cystine (CySSyC) via extracellular transport of Glu. Based on this understanding, the inventors found that DT-resistant (DTR) cells are more sensitive to CySSyC deprivation-induced ferroptosis, but this only occurs in the absence of selenite in the culture medium (Figure 3A). Since selenocysteine-containing enzymes (selenoproteins) require selenite to synthesize selenocysteine, for consistency, unless otherwise stated, the inventors supplemented the cell culture medium with 100 nM sodium selenite. DTR cells were more sensitive to CySSyC deprivation only in the absence of selenite supplementation (compared to the control), which may be related to the adaptive overexpression of the selenoprotein GPX4 in both cell lines (see Figure 3A). Figure 1I GPX4 is one of the main protective factors against ferroptosis (Dixon et al., 2012). In fact, when cells are cultured in a medium without additional selenite, GPX4 levels (along with two other major selenoses, TrxR1 and GPX1) decrease significantly within 24 hours, making cells more susceptible to CySSyC deprivation. Figure 3B Consistent with this observation and previous reports (Khamari et al., 2018; Wang et al., 2018), the inventors found increased CySSyC uptake in DT-resistant cells by measuring decreased CySSyC levels and increased Glu levels in the culture medium above the cells. Furthermore, the inventors found that DT-treated control cells also exhibited increased CySSyC uptake (Fig. 3C). This is consistent with previous observations by the inventors that increased Glu from glutamine breakdown exists in both DT-resistant and DT-treated cells, supporting (among other factors) the increased activity of the xCT antitransporter. The inventors measured increased CySSyC inflow via xCT not only in DTR cells but also in control cells (Fig. 3C), consistent with increased Glu from glutamine breakdown in both cell lines (Fig. 2D-G). Increased intracellular glutathione levels were observed in DTR cells (Fig. 2D-G). Figure 3D (Wang et al., 2018) may be used not only for its redox buffering capacity (via GPX-catalyzed reactions, among other things), but also for glutathione S-transferase ( glutathione-S-transferase GST provides more substrates for cell protection and exogenous substance neutralization activities. In fact, in addition to increased GSH levels, the inventors also found that the expression level of GST pi, the most important exogenous substance metabolizer, was increased in DT-treated and DT-resistant (DTR) cells. Figure 3E ).

[0287] In summary, the data presented in this article indicate that DT treatment and DT-resistant cells require increased levels of CySSyC to promote GSH synthesis, which is used to counteract oxidative stress and neutralize anticancer drugs.

[0288] 2.4. MAPK Inhibitors Reprogram Cysteine ​​Metabolism Next, we investigated how increased CySSyC uptake in DT-treated and DT-resistant (DTR) cells altered Cys metabolism. Upon entering the cell, CySSyC is readily reduced to Cys by the Trx system in the cytoplasmic environment (Pader et al., 2014). DTR cells require more Cys to meet their increased GSH production, thus certainly promoting increased CySSyC uptake. However, Cys is not only used for GSH synthesis; other cellular pathways utilizing Cys can also produce taurine, hydrogen sulfide, or Cys-SSH (…). Figure 3F Interestingly, despite the increased uptake of CySSyC, the inventors found that intracellular Cys levels were lower in DT-treated and DT-resistant cells compared to untreated controls (Fig. 3G), suggesting a higher flux of Cys through its metabolic events. Furthermore, the inventors found that intracellular CySSyC levels in DT-treated control cells were 2.5 times higher than in untreated cells, and the CySSyC / Cys ratio in both DT-treated and DT-resistant cells was significantly higher than in untreated control cells, indicating a transition of CySSyC to its oxidized state. These observations are consistent with increased oxidative stress and CySSyC uptake in the presence of BrafV600E inhibitors. While Cys uptake primarily occurs in its oxidized form (CySSCy) via xCT, it can also be synthesized from methionine (Met) via a transsulfurization pathway, thus being considered a semi-essential amino acid. In this process, homocysteine ​​(HCys) is generated from Met via a multi-step reaction, and then HCys is converted via cystathionine β-synthetase (…). cystathionine beta-synthase CBS is converted to cystathionine (CTH). Figure 4B Reaction 1), CTH was subsequently lysed by cystathionine-γ-lyase ( cystathionine gamma-lyase CSE is used to generate cysteine ​​(Cys) Figure 4B (Reaction 2) (Kumar and Banerjee, 2021; Sbodio et al., 2019). Next, the inventors investigated whether the increased Cys demand after DT treatment and the sensitivity of resistant cells to CySSyC deprivation were accompanied by changes in the Cys-producing transsulfurase pattern. They found that DT inhibition of the MAPK / Erk pathway in control cells induced rapid and significant expression of CSE, accompanied by a decrease in CBS levels (…). Figure 3I / 1Interestingly, the opposite pattern was observed in DT-resistant (DTR) cells, where CBS expression was restored, while CSE decreased to almost undetectable levels. Figure 3I / 1 Upregulation of CSE was also observed in another BrafV600 mutant cell line, SK-MEL28, after 5 days of DT treatment. Figure 3I / 2 Since intracellular cysteine ​​synthesis requires the sequential action of CBS and CSE, these enzymatic patterns do not support the idea that transsulfurization is reprogrammed to meet the increased cellular cysteine ​​demand after DT treatment. However, both CBS and CSE can generate active sulfur species (RSS) independently and simultaneously via reverse transsulfurization pathways (Ida et al., 2014; Yadav et al., 2016). Indeed, the increased Cys-SSH / Cys ratio in DT-treated control cells, the increased H2S2 in DTR cells, and the increased H2S and GSSH concentrations in both DT-treated and DTR cells (Figure 3 G&J) indicate that the changes in CSE and CBS expression levels induced by DT treatment are functionally related to their RSS-generating activity. In addition to CSE and CBS, another enzyme, thiopyruvate thiotransferase (… mercaptopyruvate sulfur transferase MPST (cytoplasmic cysteine) is also involved in H2S production (Ida et al., 2014; Modis et al., 2013; Nandi et al., 2000) and cysteine ​​persulfation (Pedre and Dick, 2021; Pedre et al., 2023). The inventors found that in DT-treated control cells, cytoplasmic MPST (the upper band) was slightly increased (…). Figure 3I / 1 This suggests that MPST may contribute to the observed increase in RSS levels in these cells (Fig. 3G&J). However, MPST-mediated RSS production requires 3-mercaptopyruvate (3MP), which is produced from Cys by the GOT enzyme. Given that Asp is a preferred substrate for GOT than Cys, Asp levels were elevated in DT-treated control and DT-resistant cells (see Fig. 2D), and no increase in GOT expression was observed (see...). Figure 2H Therefore, GOT-mediated 3MP generation and thus MPST-mediated sulfide generation may not be the main factors for the observed increase in RSS levels (Pedre and Dick, 2021; Ubuka et al., 1992).

[0289] RSS plays a crucial role in cellular resistance to ferroptosis and other oxidative stresses (Barayeu et al., 2022; Doka et al., 2020; Zivanovic et al., 2019), in supporting energy production in ETC (Akaike et al., 2017; Hanna et al., 2022; Libiad et al., 2019; Szabo et al., 2014), and in the regulation of aerobic glycolysis (Vitvitsky et al., 2021). Therefore, the inventors believe that the observed adaptive changes in CSE and CBS expression levels after DT treatment may contribute to protecting melanoma cells from damage by DT-targeted therapy and promoting their survival, thereby leading to the development of resistance.

[0290] Panza et al. previously demonstrated that A375 cells are sensitive to sulfur donors because sulfur donors downregulate the MAPK / Erk and PI3K / Akt pathways, and that overexpression of CSE in A375 cells inhibits cell proliferation (Panza et al., 2015). Furthermore, Leikam et al. demonstrated that knockdown or pharmacological inhibition of CSE in A375 cells leads to reduced proliferation and senescence (Leikam et al., 2014). These observations explain why CSE levels are low in control cells and proliferating DTR cells, and why the rapid induction of CSE in control cells after DT treatment may represent an important adaptive response protecting cells from drug exposure damage. This adaptive response undoubtedly plays a crucial role in laying the foundation for the survival of resistant cells. CSE is indeed a highly inducible protein, regulated by a variety of stimuli, including oxidative stress. Several transcription factors, including Nrf2 (which coordinates the antioxidant response in melanoma cells after DT treatment (see above)) (Sbodio et al., 2019), as well as other stress response factors SP1 and ATF4, have binding sites on the CSE promoter, thereby regulating CSE expression levels.

[0291] In summary, combined with previous observations, the inventors' data indicate that CSE expression induction (Figure 3I) is a response of melanoma cells to drug-induced immediate oxidative stress (see Figure 3I). Figure 1FA rapid adaptive response to cell damage caused by glycolysis (CSE) and to provide additional fuel for energy production by increasing RSS production (Fig. 3J) (Fig. 2A-B). As resistance develops, CSE levels decrease and CBS levels increase (Fig. 3I) in lieu of this to provide a balanced but increased RSS flux (Fig. 3J), thereby restoring glycolysis (Fig. 2A-B), promoting cancer cell proliferation and tumor progression, similar to many tumor types where elevated CBS has been shown to contribute to tumor progression (Ascencao and Szabo, 2022; Coletta et al., 2012; Czikora et al., 2022; Erdelyi et al., 2021).

[0292] This observation may explain why CSE levels were low in control cells and proliferating DTR cells, and why the rapid induction of CSE in control cells after DT treatment may represent an adaptive response following drug exposure. CSE is indeed a highly inducible protein, regulated by a variety of stimuli, including oxidative stress (Sbodio et al., 2019).

[0293] Intracellular cysteine ​​levels are affected by cysteine ​​dioxygenase (CDO) cysteine ​​dioxygenase The oxidative catabolism pathway of CDO is strictly regulated, in which CDO converts cysteine ​​into cysteine ​​sulfinic acid (CSA), and CSA is either decarboxylated by cysteine ​​sulfinic acid decarboxylase (CDO) or... cysteine ​​sulfinic acid decarboxylase Cysteine ​​sulfinate decarboxylase (CSAD) is decarboxylated to produce taurine and taurine, or deaminated to release β-sulfinylpyruvate. CDO is highly sensitive to steady-state Cys levels (Stipanuk and Ueki, 2011), and its concentration in some cells can increase by up to 45-fold under excessive Cys exposure (Dominy et al., 2006). Surprisingly, despite high cysteine ​​demand and low intracellular steady-state Cys concentrations in DT-treated cells, they found that DT treatment largely induced the oxidative catabolism of Cys. At the mRNA level, they measured a 20-fold increase in CDO expression in DT-resistant cells; and a 7-fold and 1.5-fold increase in downstream cysteine ​​sulfinate decarboxylase (CSAD) expression in DT-treated and DTR cells, respectively (Fig. 3H). Increased CDO1 expression in DTR cells was confirmed at the protein level by Western blotting (Fig. 3I). These observations suggest that the oxidative catabolism of Cys may be a contributing factor to DT-treated cells. and DT-resistant cells The main reason for low to medium steady-state cysteine ​​levels.

[0294] Figure 3FThe main pathways, including GSH synthesis, RSS (H2S and cysteine ​​persulfate), and oxidative metabolism to taurine, were summarized. According to our data, these pathways are the cause of increased Cys flux when melanoma cells are exposed to DT treatment.

[0295] 2.5. To gain a deeper understanding of how Cys metabolism is remediated in A375 cells using stable isotope fluxomics. programming To gain a deeper understanding of how the Cys metabolic pathway in melanoma cells is readjusted after DT treatment and to explain the above observations, the inventors conducted a comprehensive targeted metabolomics analysis of the transsulfurization pathway. First, the inventors measured the total levels of cysteine ​​metabolic intermediates without heavy isotopes and found that the total levels of HCys, CTH, and Lanth were decreased in DT-treated control cells, but accompanied by a significant increase in Hlanth levels (Figure 4A). In DT-treated control cells, CTH levels were almost completely absent. Considering the classical Cys generation pathway, this is consistent with the fact that CBS levels, which produce CTH, are low while CSE levels, which consume CTH, are high, indicating that the non-classical activity of CSE (albeit increased) generates CTH and H2S from Cys and HCys. Figure 4E Reaction VI) can be ignored. On the other hand, Hlanth can only be produced from 2 HCys by CSE ( Figure 4E (Reaction VII), therefore, the increase in Hlanth levels and the decrease in HCys cells suggest that this reaction may have contributed to the increased sulfide levels observed in the DT-treated controls (Fig. 3J). Lanth is another metabolite that may indicate the presence of H2S catalyzed by CSE or CBS with two Cys molecules as substrates ( Figure 4E Response V). However, Lanth was lower in DT-treated control cells, meaning these responses cannot explain the observed increase in RSS. In DT-resistant cells, CTH and Lanth levels remained significantly lower than in untreated control cells but higher than in DT-treated control cells. This, while reflecting a partial recovery of CBS activity compared to DT-treated control cells, also suggests that the elevated RSS levels in DT-treated and DTR cells are not catalyzed by CBS / CSE catalyzing the conversion of Cys and HCys to CTH and H2S (Cys and H2S). Figure 4E Reaction VI) or 2 Cys are converted into Lanth and H2S ( Figure 4E The product of reaction V).

[0296] Next, the inventors measured the flux of the metabolic pathway in the culture medium using Met or CySSyC isotopes (when stable Met or CySSyC isotopes were used in the culture medium, they measured the metabolic characteristics of normal and heavy LMW thiols in the transsulfurization pathway in the cell model system). First, to study the typical functions of CSE and CBS, the inventors used Met-containing... disulfide () 34 S) Cell treatment. An 18-hour treatment was sufficient to completely exchange the Met and HCys pools for heavy Met and HCys. Under these conditions, the inventors found that even after 48 hours of cell growth, Cys synthesis from Met was negligible in all test systems (Fig. 4C), consistent with the abundant supply of CySSyC available to cells in the culture medium and the differential expression patterns of CBS and CSE (Fig. 3I). By measuring the ratio of heavy CTH to total CTH, the inventors found that approximately 60% of CTH in untreated control and DT-resistant cells originated from the classical pathway ( Figure 4B Reaction 1), while in DT-treated control cells, only 30% showed this. These data support the inventors' previous findings that DT-treated control cells overexpress CSE and downregulate CBS (Figure 3I), and therefore they cannot synthesize large amounts of CTH from HCys via the action of CBS as in untreated control cells. Figure 4B Reaction 1), but they can synthesize CTH from Cys ( Figure 4F Reaction 8 (which will be shown as light CTH in this experiment) is catalyzed not only by CBS but also by CSE. Importantly, the formation of CTH from Cys also produces H2S ( Figure 4F (Reaction 8), therefore these data suggest that elevated CSE-induced Cys to CTH metabolism may contribute to increased RSS production in DT-treated control cells. However, this conclusion is not supported by the fact that in DT-treated control cells, heavy HCys levels (rather than their ratio to the total of heavy and light analytes as above) were lower than in control cells, and heavy CTH was almost completely absent, while in DT-resistant (DTR) cells, these recovered to Ctrl levels (Fig. 4D). The latter observation can be explained by the fact that DT-resistant cells recovered CBS levels and had lower CSE levels compared to untreated control cells (Fig. 3I), thus they could synthesize CTH from HCys and Ser (via CBS). Figure 4B Reaction 1), but due to low CSE levels, they are unable to convert CTH to Cys ( Figure 4B Reaction 2). These observations are also consistent with data and conclusions derived from total metabolite measurements without isotopic labeling (see above and Figure 4A).

[0297] In summary, these metabolite patterns indicate that typical CBS activity was extremely low in DT-treated control cells, but partially recovered in DTR cells compared to controls, consistent with measured CBS protein levels (Fig. 3I). However, typical CSE activity was not prominent in any of these systems, including in DT-treated control cells where overexpression was found (Fig. 3I). It can also be concluded that the increased RSS generation in DT-treated and DTR cells cannot be explained by CSE or CBS-mediated Cys metabolism producing H2S.

[0298] In the following experiments, the inventors used a cell culture medium containing heavy carbon ( 13 C) and diazo ( 15 CySSyC (N) was measured, and normal and heavy (N) CySSyC were measured. The levels of the analytes were analyzed to better understand the function of CSE and CBS in generating RSS in these cellular systems. By calculating the ratio of re-analytes to total levels, the inventors found that after 18 hours of treatment, the intracellular CySSyC and Cys pools were completely exchanged for re-CySSyC and Cys (Fig. 4G). Next, the inventors calculated the incorporation of the carbon skeleton from CySSyC (rather than from Met in the standard pathway) into CTH, Lanth, and Ser by comparing the re-analytes with their corresponding total levels. The inventors found that under normal cell culture conditions (200 µM CySSyC), the amount of Lanth and CTH generated by Cys was significant, while the amount of Ser synthesized from Cys was negligible (Fig. 4G). By analyzing the steady-state levels of re-metabolites (rather than their ratio to the sum of light and re-metabolites), the inventors found that untreated control cells synthesized CTH from re-Cys ( Figure 4F Reaction 8) and Lanth ( Figure 4F Reaction 9) was more abundant than DT-treated or DT-resistant cells (Fig. 4G), consistent with previous findings by the inventors that untreated control cells had higher intracellular Cys concentrations (Fig. 3G) (cysteine ​​is the substrate for these reactions), as well as higher total Lanth and CTH levels (Fig. 4A). These results also confirm the findings of reactions V and VI ( Figure 4E It does not cause an increase in RSS in DT-treated and DTR cells.

[0299] Ida et al. demonstrated that CySSyC can also be directly utilized by CBS and CSE to generate CySSH (Ida et al., 2014). CySSH can oversulfide other Cys derivatives through transsulfurization reactions (Ida et al.) and increase sulfide concentrations through the action of the Trx or GSH system (Doka et al., 2020; Wedmann et al., 2016). However, kinetic simulations by the Banerjee group showed that under physiological conditions, this pathway is not prominent due to the low intracellular CySSyC concentration and high Cys level, and an increased CySSyC / Cys ratio is required for it to play a role in CySSH synthesis (Yadav et al., 2016). As described above, DT-treated control cells exhibited increased oxidative burden, while both DT-treated control cells and DT-resistant cells showed elevated CySSyC / Cys ratios. Furthermore, the inventors found that oxidative catabolism of Cys was activated in DT-treated cells and DTR cells (Figure 3H, I). The latter observation appears largely counterintuitive, given that these cells absorbed more CySSyC (Fig. 3C) and showed elevated levels of intracellular GSH, GSSH, and H2S (Fig. 3J), all of which suggest an increased demand for Cys, contradicting its oxidative catabolism. However, a plausible mechanism can explain this anomaly, and the fact that the utilization of Cys by CSE or CBS cannot explain the observed elevated RSS levels in DT-exposed cells, is as follows: Activated oxidative catabolism of Cys in DT treatment and DTR cells, along with increased oxidative stress and increased CySSy uptake, raises the CySSyC / CyS ratio to a level that makes CySSyC the primary substrate for CBS and / or CSE under these conditions, directly generating Cys-SSH. It must also be acknowledged that CySSyC is approximately two orders of magnitude more suitable as a substrate for these enzymes than Cys. This reaction would not occur under normal conditions solely due to the highly reducing environment of the cytoplasm.

[0300] However, elevated H2S and GSSH homeostasis levels in DT-treated and DTR cells can protect them from oxidative stress-induced ferroptosis (Barayeu et al., 2022; Wu et al., 2022) or metalloprotein-induced oxidative stress (Doman et al.). Furthermore, persulfation of Cys residues can protect protein function under oxidative stress because oxidatively modified persulfides (perthiosulfinates / persulfinates / persulfonic acids) can be reversibly reduced back to thiols (Doka et al., 2020; Filipovic et al., 2018). Therefore, the inventors measured the total level of high molecular weight (HMW) persulfides to assess whether DT-induced increases in RSS could protect protein Cys residues from drug-induced oxidative stress (to investigate the potential of this thiol-protective mechanism against drug-induced oxidative damage). In fact, the inventors found increased levels of protein-Cys-SSH and protein-Cys-SSSH in DT-treated control cells after 6 days of treatment, but observed no significant difference in protein hypersulfurization between untreated control cells and DT-resistant cells (Figure 4I). This may be related to the fact that DT-treated control cells need to cope with unexpected oxidative stress (their highest level of oxidative stress), which may trigger an increase in protein Cys residue hypersulfurization through a rapid CSE-mediated response to protect the most oxidant-sensitive protein thiols before the cells adapt to the stress conditions.

[0301] As described in this article, inhibition of BrafV600E and MEK1 / 2 by dabrafenib and trametinib (DT) upregulated enzymes in the sulfide catabolism pathway. This pathway is responsible for scavenging sulfides and donating electrons to the electron transport chain, thus regulating mitochondrial energy metabolism. In another set of experiments, the increased activity of this pathway was confirmed by using an alkylation scheme based on monobromodiamine followed by fluorescence detection to measure the final product, thiosulfate (S₂O₃). The treatment method for A375 cells was as described above.

[0302] Previous research has shown that DT treatment increases the activity of sulfide catabolism pathways, which may provide electrons to the electron transport chain. However, in DT-resistant A375 cells treated with dabrafenib-trametinib (DT), this activity returns to normal levels. Figure 7C ).

[0303] It is noteworthy that the enzymes in the sulfide degradation pathway appear to exhibit the same pattern. Their levels correlate with the levels of the pathway's final product (thiosulfate).

[0304] In these experiments, we also administered DT to resistant cells to maintain their resistance phenotype. This is due to the nature of cellular experiments, as cells readily alter their phenotype under changing environmental conditions. In these experiments, we were interested in the effect of DT on control cells (acute effects) and how they differed from resistant cells, which, despite receiving DT, were able to divide in the same manner as the control group. In these and other experiments, such as those measuring mitochondrial function, CSE / CBS levels, resistant cells exhibited a pattern similar to the untreated control group despite the constant presence of DT in the culture medium.

[0305] 2.6. Inhibition of BrafV600E with vemurafenib induced similar redox changes in melanoma cells. Vemurafenib is the first Braf V600E inhibitor to be approved by the FDA. Figure 5A However, tumors rapidly develop acquired resistance to this drug, primarily due to overactivation of downstream MEK kinases (Manzano et al., 2016; Robert et al., 2015), leading to the common practice in medical oncology of combining inhibition with the MAPK / ERK pathway (see combination of dabrafenib and trametinib). However, to investigate whether current observations regarding Cys and H2S metabolic remodeling represent a general adaptive response of melanoma cells to BrafV600E inhibition, the inventors investigated how Cys and H2S metabolism altered in vemurafenib (V) treatment and vemurafenib-resistant (VR) cells. First, the inventors generated a vemurafenib-resistant A375 cell line by long-term culture of cells in the presence of escalating doses of vemurafenib. Cell proliferation was studied using SRB, confirming that VR cells fully recovered their proliferative capacity (…). Figure 5B By measuring the phosphorylation of MEK1 / 2 and ERK1 / 2, it was found that V treatment effectively blocked the phosphorylation of MEK1 / 2, and that the phosphorylation of MEK1 / 2 was completely restored in VR cells. Next, similar to the DT therapy, the inventors measured the levels of proteins involved in cellular resistance to oxidative stress and / or Cys metabolism. Figure 5CSimilar to DT treatment, the inventors found that V-treated control cells resulted in decreased CBS levels, while CSE, MPST, PDH, G6PD, TrxR1, and GPX1,4 proteins were overexpressed. Furthermore, in V-resistant cells, the levels of these enzymes mostly returned to the levels observed in untreated control cells, similar to what the inventors observed in DTR cells. However, in VR cells, TrxR1 levels also recovered, in contrast to DTR cells, where the inventors detected TrxR1 concentrations even higher than in DT-treated control cells. Consistent with previous findings, vemurafenib treatment in control cells decreased homeostatic Cys, CTH, and HCys levels and increased CySSyC, H2S, GSSH, and Lanth levels. In VR cells, the inventors found significant differences only in Cys-SSH and CTH levels. Interestingly, in VR cells, Cys, CySSyC, H2S, HCys, and Lanth levels were completely restored; in fact, CTH levels were even higher than in untreated control cells (Figure 5D). These data indicate that metabolic reprogramming is involved in the development of V resistance, with a mechanism similar to that of DT resistance discovered by the inventors. However, the observed differences induced by DT treatment are more significant, and resistance to V treatment and metabolic homeostasis develop more rapidly. Consistent with metabolomics analysis, the time required for vemurafenib resistance to develop in in vitro cell culture proliferation assays is shorter than that required for dabrafenib-trametinib resistance. This is not surprising, as dual inhibition of Braf and MEK leads to complete blockade of the MAPK / ERK pathway.

[0306] 2.7. Using an in vivo xenograft model and in V-treated cells, the inhibition of BRAF induced by DT treatment was confirmed. Metabolic changes caused To investigate the metabolic changes in melanoma tissue after DT treatment in vivo, the inventors established two xenograft mouse models: (1) subcutaneous injection of A375 cells (A375-X); and (2) implantation of patient-derived tumor samples into immunodeficient mice (PDX). Dual treatment of mice with dabrafenib and trametinib resulted in a rapid decrease in tumor volume. Figure 6A and Figure 6C This indicates that this targeted therapy has high efficacy. To gain a deeper understanding of the metabolic differences in tumors treated with DT, the inventors performed metabolomics analysis on xenografts derived from the A375 cell line (A375-X) and patient-derived xenograft tumors (PDX). In both models, the rapid decrease in tumor volume indicates a high initial response rate to DT treatment ( Figure 6A and Figure 6CIn DT-treated A375-X tumors, tissue metabolomics analysis showed lower homeostatic levels of Cys, CTH, and Lanth, enhanced hypersulfurization of Cys and GSH, and increased levels of CySSyC and GSSH, consistent with the inventors' in vitro results. Furthermore, the inventors found that in DT-treated A375-X tumors, the morphology of Cys and GSH transitioned to their oxidized dimer state (Figure 6B). In DT-treated PDX tumors, the inventors also found decreased homeostatic levels of Cys, CTH, and Lanth, while increased homeostatic levels of CySSyC, Hlanth, and Cys-SSH. In PDX tissues, the transition of Cys and GSH to their oxidized forms after DT treatment was also observed (the oxidation of Cys and GSH was more pronounced) (Figure 6D). These results collectively provide in vivo evidence for the inventors' in vitro findings (Figure 6D). As in in vitro experiments, DT treatment had the greatest effect on CTH in both tumor models, resulting in a more than 90% decrease in the level of this metabolite compared to untreated tumor tissue. This, along with the observed low steady-state Cys levels, suggests that the increased RSS levels in DT-treated tumors are not due to the reverse sulfurization activity of CSE and / or CBS using Cys as a substrate to produce H2S. Figure 4E (Reaction VI). The inventors' in vitro metabolomics results indicate that, under CySSyC-sufficient conditions, the typical Cys-generating function of CBS and CSE is negligible, while their sulfide / persulfide-generating function is more prominent. However, in xenograft tumors, not all tumor cells have equal access to nutrients; nutrient availability depends on the degree of vascularization of the tumor tissue. In tumor cells with insufficient CySSyC supply, the Cys-generating function of CBS and CSE may also be crucial for survival. Further in-depth understanding of these details requires in vivo metabolomics studies, but this is a considerable undertaking and beyond the scope of this study. Furthermore, detecting human proteins in mouse xenografts is quite challenging because mouse tissues infiltrate human tumors, and the protein sequences of human and mouse CBS and CSE show high sequence homology, limiting the specificity of available antibodies and making differentiation by shotgun proteomics virtually impossible. Therefore, these in vivo metabolomics analyses are entirely consistent with the results obtained using the inventors' cell model system.

[0307] Furthermore, the inventors discovered that another BrafV600E inhibitor, vemurafenib (V) (the first FDA-approved drug for the treatment of patients with Braf-mutant melanoma), induced similar changes in Cys metabolism in melanoma cells. Importantly, downregulation of CBS, overexpression of CSE, and increased production of RSS were also observed in V-treated cells (Figure 5).

[0308] 2.8. ETHE1 silencing improved the effect of DT treatment on A375 cells. Since intracellular sulfide levels are tightly regulated by catabolism pathways, and cys-persulfide species provide the raw materials for these mechanisms (Akaike et al., 2017; Combi et al., 2023; Fujii et al., 2019; Marutani et al., 2021), the inventors investigated the levels of proteins responsible for sulfide catabolism, including quinone oxidoreductases that oxidize H2S to GSSH. sulfide:quinone oxidoreductase SQOR), a persulfide dioxygenase that catalyzes the oxidation of GSSH to sulfite and GSH. persulfide dioxygenase Thiosulfate-transferases (ETHE1 or PDO) oxidize GSSH and sulfite to thiosulfate. thiosulfate sulfurtransferase , TST), and sulfite oxidase, which is responsible for removing sulfite ( sulfite oxidase (SO). The inventors found that in control cells treated with DT and V, the levels of all four enzymes were significantly increased (see [references]). Figure 7A and Figure 7B This, along with the increased CSE levels, indicates that the RSS flux through melanoma cells is higher after BrafV600E inhibition. While high concentrations of H2S inhibit mitochondrial respiration (complex IV), at lower concentrations, it can stimulate mitochondrial respiration by donating electrons to ETC via SQOR and CoQ (Goubern et al., 2007; Szabo et al., 2014). Therefore, SQOR is responsible not only for sulfide detoxification but also for stimulating mitochondrial respiration. Furthermore, recent studies have shown that low molecular weight persulfides are also considered effective electron donors for ETC (Akaike et al., 2017; Fujii et al., 2019). These results, combined with the inventors' mitochondrial energy experiments (see above), demonstrate that the increased intracellular RSS flux is involved in meeting the greater energy demands of melanoma cells following BrafV600E inhibition. The levels of enzymes involved in the sulfide catabolism chain in DT-resistant cells returned to the levels observed in untreated control cells. This is consistent with all previous data from the inventors, indicating that after resistance development, cells are under less stress and restore their anabolic mechanisms by reducing OXPHOS and restoring glycolysis. Figure 1J(2A-B). It has been proposed that elevated H2S levels, through inhibition of complex IV or due to excessive reduction of the CoQ pool, lead to mitochondrial respiratory uncoupling and promote reverse electron transport (RET), which is associated with increased ROS production (Banerjee and Kumar, 2022; Jia et al., 2020; Kumar et al., 2022). In DT-treated and DTR cells, only a slight (1.5-fold) increase in endogenously produced H2S levels was detected. Previous studies have shown that melanoma cells treated with BrafV600E inhibitors are particularly sensitive to respiratory chain inhibitors (Corazao-Rozas et al., 2016), which together suggest that increased endogenous sulfide levels in this system do indeed promote mitochondrial respiration. However, the possibility that insufficient electron acceptors contribute to RET to some extent under these conditions cannot be ruled out.

[0309] In summary, the inventors' data indicate that increased intracellular RSS flux is not only important for resistance to oxidative stress but is also associated with observed higher electron flow through ETC to meet the increased energy demands of melanoma cells following BrafV600E inhibition (see also Section 2.3), which may be necessary to drive transporters (e.g., ABCG2) to expel DT (see Figure 1G). In DTR cells, sulfide-degrading enzymes returned to untreated Ctrl levels, consistent with previously proposed findings that cells are under less stress after resistance development (Figures 1G-I, 3G) and restore their anabolic mechanisms by reducing OXPHOS and restoring glycolysis (Figures 2A-B).

[0310] To further confirm the role of mitochondrial RSS in the development of DT resistance, the inventors established an A375 cell line with lentivirus ETHE1 silencing from a monoclonal antibody. Figure 7D The inventors found that silencing ETHE1 did not significantly alter the expression of enzymes in the Cys and H2S metabolic pathways. Figure 7EHowever, when cells were treated with DT, shETHE1 cells showed lower levels of SQOR, SO, and TST compared to shCtrl cells, while TrxR1 levels were higher. Furthermore, the inventors found that DT-treated shETHE1 cells exhibited increased TrxR1 expression compared to DT-treated shCtrl cells. The Trx system is crucial in the reduction of persulfides and polysulfides (Doka et al., 2016), therefore, TrxR1 overexpression may be a compensatory effect of reducing persulfide levels escaping to the cytoplasm in Ethe1-silenced cells. TrxR1 overexpression may be due to ETHE1-silenced cells adapting to increased persulfide levels in the cytoplasm (Doka et al., 2016). The inventors also investigated the proliferation of these cells and interestingly found that, in a 1-week in vitro proliferation assay, shETHE1 cells proliferated slightly slower than untreated control cells. Figure 7E However, when cells were treated with DT, the proliferation of shETHE1 cells became more pronounced in an in vitro proliferation assay lasting 3 weeks, suggesting that low levels of ETHE1 favored the survival of A375 cells when treated with DT, thus implying the importance of sulfides in cell survival after DT treatment (Fig. 7F).

[0311] Next, we measured LMW thiols and GSSH (ETHE1 substrates) in the lysates of shCtrl and shETHE1 cells (Figure 7G). GSSH is the most abundant LMW persulfate in cells, which is normally oxidized by ETHE1 to sulfite and GSH. The inventors compared untreated shETHE1 cells, DT-treated control cells, and DT-treated shETHE1 cells with untreated shCtrl cells, and compared DT-treated shETHE1 cells with DT-treated shCtrl cells to reveal differences that may contribute to increased resistance to DT treatment. Compared to untreated shCtrl cells, the inventors found higher levels of GSH, gGluCys, GSSH, and GSSG in DT-treated shETHE1 cells, while lower levels of CTH were measured in DT-treated shCtrl and shETHE1 cells. Unexpectedly, lower Lanth levels were found in shETHE1 cells, but not in DT-treated shETHE1 cells. Compared to DT-treated control cells, DT-treated ETHE1 cells showed higher levels of Cys, GSH, gGluCys, and GSSG, while intracellular CySSyC levels were lower. The inventors also measured LMW thiols in the culture medium and found that the GSSH level in the culture medium above DT-treated ETHE1 cells was up to 3 times higher than in all other cell types. Figure 7HIn summary, increased intracellular GSSH levels are accompanied by elevated levels of GSH, GSSG, and the GSH precursor gGluCys. Our data suggest that, since ETHE1 silencing cells are unable to recycle GSH from GSSH, these cells may need to enhance their intracellular GSH synthesis mechanisms to maintain GSH homeostasis for antioxidant defense via Gpx1, for drug metabolism via GSTpi, and to prevent ferroptosis via Gpx4 (see above). Furthermore, excess GSSH generated after DT treatment is expelled into the extracellular space when ETHE1 is no longer available for GSSH degradation. Although we did not find a significant increase in total protein persulfides in DT-resistant cells (see above), we did find higher levels of protein persulfides in DT-treated control cells and shETHE1 cells, particularly in DT-treated shETHE1 cells compared to untreated shCtrl cells (Figure 7I). These observations are consistent with our proposed mechanism that CSE-generated persulfides can also provide protein thiol protection under DT-induced oxidative stress.

[0312] 2.9. CSE was overexpressed in countersamples of melanoma patients after DT treatment.

[0313] To assess the physiological reliability of the combination therapy of CSE inhibition and BRAF V600E targeted therapy, the inventors measured CSE expression levels in patient samples after DT treatment. Since surgical resection of melanoma is only performed if treatment remains effective, collecting clinical specimens from patients receiving targeted therapy is extremely challenging. The biobank of the National Cancer Institute of Hungary houses the largest number of melanoma patients in Europe, but the inventors were only able to find one patient with pre- and post-treatment skin melanoma samples available. Immunohistochemistry clearly showed a significant increase in CSE levels in tumor samples resected during DT treatment (…). Figure 8A Elevated CSE expression (magenta staining) was commonly observed in samples from patients with metastatic disease. However, we found that in another patient with paired pre- and post-treatment samples of lymph node metastases, although CSE levels were high in the metastases, we observed even higher CSE levels in the lymph nodes removed during DT treatment. Figure 8B By comparing lymphoma metastases from different patients, we found that compared with patients who received DT treatment, 4 out of 5 untreated tumors had significantly lower CSE levels, and 1 out of 5 had higher CSE levels. Figure 8C These observations strongly suggest that CSE is indeed upregulated in melanoma exposed to DT treatment, reinforcing the view that its upregulation is an important stress response mechanism following BRAF V600E inhibition.

[0314] 2.10. CSE inhibitors inhibit the development of resistance to BrafV600E inhibitors.

[0315] Based on the results detailed above by the inventors, DT or V-treated A375 cells showed increased RSS levels (Figs. 3J and 5D), and these cells exhibited higher proliferation rates in a 3-week proliferation assay after silencing persulfate dioxygenase (Fig. 6D). Inhibition of BrafV600E and MEK did not kill all melanoma cells in vitro; some cells survived in a quiescent state. The inventors accumulated substantial data demonstrating that reprogrammed Cys and RSS metabolism plays a crucial role in protecting these cells from BrafV600E and MEK inhibitors, as well as drug-induced oxidative stress. The inventors demonstrated that the immediate adaptive response in this system is an increase in CSE levels and its sulfide / persulfide activity to protect oxidatively sensitive protein thiols and to meet the cells' increasing energy demands by providing electrons to ETC (Figs. 3I-J). To assess whether increased CSE expression following targeted therapy would become an achilles' heel for persistent melanoma cells, the inventors used selective CSE inhibitors in subsequent experiments. Importantly, the inventors discovered that untreated A375 melanoma cells respond well to the selective CSE inhibitor PAG (… Figure 9A ) and non-selective CSE inhibitor AOAA ( Figure 9B Neither was sensitive. This can be explained by the fact that CSE is low in untreated melanoma cells, while it increases after targeted therapy. In the following experiments, the inventors used the CSE inhibitor PAG and treated cells with V, CV, DT, or EB in the presence or absence of PAG to assess the importance of CSE-induced stress response in the survival of melanoma cells and the development of resistance after BrafV600E and MEK inhibition. A375 cells were cultured for 2 months in media containing V or DT with or without PAG, followed by a 7-day proliferation assay. The inventors found that A375 cells cultured in media containing only V acquired complete resistance after two months, while the proliferation of cells cultured in media containing both V and PAG was severely inhibited. Figure 10A Furthermore, resistance also emerged two months after cell treatment with DT, although to a milder degree (in vitro resistance development takes approximately four months). However, the development of resistance was prevented when DT was used in combination with PAG. After two months, the combination of DT and PAG treatment was more effective in inhibiting tumor cell growth than DT treatment alone. Figure 10B In the case of CV treatment, a significant portion of cells died due to both CV and CV+PAG treatment. After 10 weeks of CV±PAG treatment, CV-treated cells partially regained their proliferative capacity, while CV+PAG-treated cells remained in a quiescent state. Figure 10D Similar to V, CV, and DT, EB treatment also induces CSE overexpression, and after 4 months, EB+PAG treatment is more effective than EB alone. Figure 10C This phenomenon may involve several different mechanisms. As previously demonstrated by the inventors and others, CSE / CBS / MPST or CARS2-induced hypersulfurization plays an important role in several processes of cancer cell survival, including angiogenesis, hypoxia, and resistance to ferroptosis (Coletta et al., 2012; Czikora et al., 2022; Erdelyi et al., 2021; Szabo, 2016).

[0316] The restoration of phosphorylated MEK1 / 2 levels is (at least) partially necessary for acquiring resistance. Therefore, in order to find specific effects in this system, the inventors compared the levels of phosphorylated MEK1 / 2 in cells cultured with V or DT for two months in the presence or absence of PAG, and the levels of phosphorylated MEK1 / 2 in cells cultured with EB for four months in the presence or absence of PAG. Importantly, the inventors found that the levels of phosphorylated MEK1 (lower band) were lower in cells treated with PAG+V compared to those treated with V. Figure 10E Compared with EB-treated cells, EB+PAG-treated cells had lower levels of phosphorylated MEK1. Figure 10G This suggests that, in the presence of V600E inhibitors, CSE-induced RSS may promote MEK1 phosphorylation and contribute to the development of resistance (see [link to relevant documentation]). Figure 10E , Figure 10F Interestingly, MEK2 (upper band) phosphorylation was more pronounced in cells treated with V+PAG and DT+PAG than in cells treated with V or DT alone, a phenomenon that the inventors cannot currently explain. Consistent with the frequent upregulation of the PI3K / Akt pathway in human melanomas resistant to Braf / MEK inhibitors (Sun et al., 2014), increased Akt phosphorylation was also observed in the inventors' system (see...). Figure 1D Importantly, the inventors found that, compared with using these drugs alone, the level of phosphorylated (Ser473)-Akt in cells was lower when cultured in combination with Braf and / or MEK inhibitors and PAG. Figure 10E (See Figure H). This may be related to CSE-induced MEK1 hypersulfurization, which is presumably induced to induce ERK phosphorylation and activation (Zhao et al., 2014), and may (at least partially) explain the reduced cell proliferation observed in the presence of PAG. Figure 10A (See Figure D).

[0317] In vitro data from the inventors confirmed that CSE is an important stress response element after DT treatment in A375 cells and can serve as a secondary drug target to improve the efficacy of V, CV, DT, and EB targeted therapies. Next, to reveal whether combined inhibition of CSE and BRAF / MEK is beneficial under in vivo conditions, the inventors established a xenograft model derived from the A375 cell line in NOD.Cg-Prkdcscid Il2rgtm1Wjl / SzJ(NSG) mice. Treatment of tumor-bearing mice with DT or a combination of DT and PAG effectively inhibited tumor growth (…). Figure 11A In the DT-only group, the first tumor exceeding its pre-treatment size appeared on day 24 of treatment, while in the DT+PAG group, this occurred on day 38. Figure 11A In summary, after 25 days of treatment, DT-treated mice developed acquired resistance in their tumors, while the average tumor volume increase in DT+PAG-treated mice was not observed until approximately 20 days later. Figure 11A Treatment is considered effective only when the tumor volume reaches the volume measured before treatment begins (progression-free survival, PFS). Mice treated with DT+PAG showed significantly higher PFS than mice treated with DT alone. Figure 11B On day 50 of treatment, 9 out of 11 mice in the DT+PAG group showed progression-free survival (PFS), while only 1 out of 12 mice in the DT group remained in PFS. At 50 days after the initial treatment, mice were sacrificed, and tumors were removed and measured; the tumor weight in the DT+PAG group was significantly lower. Figure 11C ).

[0318] These results indicate that, under in vivo conditions, inhibition of CSE effectively delays the development of resistance to BrafV600 and MEK1 / 2 inhibitors.

[0319] Example 3 3. Combining inhibition of the MAPK / ERK pathway and CSE delays the development of acquired resistance in the SK-Mel28 cell line.

[0320] To demonstrate the benefit of combining the CSE inhibitor D-,L-propynylglycine (PAG) with Braf V600E and MEK1 / 2 inhibitors for other melanoma cell lines carrying the Braf V600E mutation, we began culturing the SK-Mel28 cell line with and without PAG, using both Braf V600E and MEK1 / 2 inhibitors. For this cell line, the time required to develop resistance was longer than for the previously used A375 cell line; however, our preliminary results indicate that the proliferation rate of SK-Mel28 cells additionally treated with PAG on top of Braf V600E and MEK1 / 2 inhibitors was slowed.

[0321] Example 4 4. After DT treatment, cells expressing CSE grew faster than cells lacking CSE in polyclonal cell populations.

[0322] To demonstrate that the beneficial effect of PAG in delaying acquired resistance is clearly due to the important role of CSE in persistent cell survival, we used CRISPR-Cas9 technology to generate stable CSE knockout A375 cell lines (see Examples). Overall, CSE knockout was successful, and CSE levels were almost undetectable in the CSE knockout cell population. Figure 12A ).

[0323] However, because the cell population was polyclonal, CSE knockout may not have been successful in all cells. After 1.5 months of DT treatment, we used Western blotting to find no difference in CSE protein levels between the control and CSE knockout cell populations. Figure 12B This means that cells expressing CSE outperformed cells that were successfully knocked out of CSE. This further reinforces our previous observation that CSE is indeed a key factor in the development of acquired resistance, and that inhibiting CSE is a feasible way to suppress or delay the development of acquired resistance.

[0324] Example 5 5.1 Exemplary Diagnosis and Treatment of Patients with BRAF V600E Mutations A patient with dark nevi visited the outpatient clinic and discovered that the number of dark nevi had increased over the past two months. A biopsy was taken from the discovered dark nevi, and the sample was sent for analysis, which diagnosed it as malignant melanoma.

[0325] The treating physician requested further analysis to assess whether the melanoma was BRAF V600 melanoma. The patient was given a combination of dabrafenib and trametinib, along with PAG therapy, with each drug administered according to its standard treatment regimen.

[0326] 5.2 Exemplary Diagnosis and Treatment of Patients with BRAF V600E Mutations A patient with cutaneous melanoma of high metastatic potential was receiving vemurafenib treatment, and the tumor regressed after 3 months of treatment. However, recurrence was observed during a follow-up examination at 6 months.

[0327] The treating physician performed a biopsy and tissue analysis to assess whether the melanoma was BRAF V600 melanoma. The melanoma was diagnosed as a BRAF V600K mutant.

[0328] The patient's treatment regimen was updated to include trametinib and PAG, with the latter at twice the dose described in Example 5.1.

[0329] Industrial application This invention is particularly applicable to preventing or delaying the development or progression of resistance in patients to treatment with MAPK inhibitors (especially Braf V600 mutation inhibitors) for Braf V600-mutant cancers (especially melanoma). This invention also relates to combination therapies (if diagnostics are required), and pharmaceutical compositions, combinations, and kits for such therapies.

[0330] References Akaike, T., Ida, T., Wei, FY, Nishida, M., Kumagai, Y., Alam, MM, Ihara, H., Sawa, T., Matsunaga, T., Kasamatsu, S., et al. (2017). Cysteinyl-tRNA synthetase governs cysteine ​​polysulfidation and mitochondrialbioenergetics. Nat Commun 8 , 1177. Asimakopoulou, A., Panopoulos, P., Chasapis, CT, Coletta, C., Zhou, Z., Cirino, G., ...&Papapetropoulos, A. (2013). Selectivity of commonly used pharmacological inhibitors for cystathionine beta synthase (CBS) and cystathionine γ lyase (CSE). British journal of pharmacology, 169 (4), 922-932. Ascencao, K., and Szabo, C. (2022). Emerging roles of cystathioninebeta-synthase in various forms of cancer. Redox Biol 53 , 102331. Baenke, F., Chaneton, B., Smith, M., Van Den Broek, N., Hogan, K.,Tang, H., Viros, A., Martin, M., Galbraith, L., Girotti, M.R., et al. (2016).Resistance to BRAF inhibitors induces glutamine dependency in melanoma cells.Mol Oncol 10 , 73-84. Banerjee, R., and Kumar, R. (2022). Gas regulation of complex IIreversal via electron shunting to fumarate in the mammalian ETC. TrendsBiochem Sci 47 , 689-698. Barayeu, U., Schilling, D., Eid, M., Xavier da Silva, T.N.,Schlicker, L., Mitreska, N., Zapp, C., Grater, F., Miller, A.K., Kappl, R.,et al. (2022). Hydropersulfides inhibit lipid peroxidation and ferroptosis byscavenging radicals. Nat Chem Biol. Bhattacharjee A, Sinha A, Ratia K, Yin L, Delgado-Rivera L, PetukhovPA, Thatcher GRJ and Wardrop DJ: (2017) 2-Arylidene hydrazinecarbodithioatesas potent, selective inhibitors of cystathionine γ-lyase (CSE). ACS Med ChemLett. 8:1241–1245.. Cirino, G., Szabo, C., and Papapetropoulos, A. (2023). Physiologicalroles of hydrogen sulfide in mammalian cells, tissues, and organs. PhysiolRev 103 , 31-276. Coletta, C., Papapetropoulos, A., Erdelyi, K., Olah, G., Modis, K.,Panopoulos, P., Asimakopoulou, A., Gero, D., Sharina, I., Martin, E., et al.(2012). Hydrogen sulfide and nitric oxide are mutually dependent in theregulation of angiogenesis and endothelium-dependent vasorelaxation. ProcNatl Acad Sci U S A 109 , 9161-9166. Combi, Z., Potor, L., Nagy, P., Sikura, K.E., Ditroi, T., Juranyi,E.P., Galambos, K., Szerafin, T., Gergely, P., Whiteman, M., et al. (2023).Hydrogen sulfide as an anti-calcification stratagem in human aortic valve:Altered biogenesis and mitochondrial metabolism of H(2)S lead to H(2)Sdeficiency in calcific aortic valve disease. Redox Biol 60 , 102629. Corazao-Rozas, P., Guerreschi, P., Andre, F., Gabert, P.E., Lancel,S., Dekiouk, S., Fontaine, D., Tardivel, M., Savina, A., Quesnel, B., et al.(2016). Mitochondrial oxidative phosphorylation controls cancer cell's lifeand death decisions upon exposure to MAPK inhibitors. Oncotarget 7 , 39473-39485. Corazao-Rozas, P., Guerreschi, P., Jendoubi, M., Andre, F., Jonneaux,A., Scalbert, C., Garcon, G., Malet-Martino, M., Balayssac, S., Rocchi, S.,et al. (2013). Mitochondrial oxidative stress is the Achille's heel ofmelanoma cells resistant to Braf-mutant inhibitor. Oncotarget 4 , 1986-1998. Cortese-Krott, M.M., Koning, A., Kuhnle, G.G.C., Nagy, P., Bianco,C.L., Pasch, A., Wink, D.A., Fukuto, J.M., Jackson, A.A., van Goor, H., etal. (2017). The Reactive Species Interactome: Evolutionary Emergence,Biological Significance, and Opportunities for Redox Metabolomics andPersonalized Medicine. Antioxid Redox Signal 27 , 684-712. Czikora, A., Erdelyi, K., Ditroi, T., Szanto, N., Juranyi, E.P.,Szanyi, S., Tovari, J., Strausz, T., and Nagy, P. (2022). Cystathionine beta-synthase overexpression drives metastatic dissemination in pancreatic ductaladenocarcinoma via inducing epithelial-to-mesenchymal transformation ofcancer cells. Redox Biol 57 , 102505. Davies, H., Bignell, G.R., Cox, C., Stephens, P., Edkins, S., Clegg,S., Teague, J., Woffendin, H., Garnett, M.J., Bottomley, W., et al. (2002).Mutations of the BRAF gene in human cancer. Nature 417 , 949-954. DeBerardinis, R.J., and Chandel, N.S. (2016). Fundamentals of cancermetabolism. Sci Adv 2 , e1600200. Dixon, S.J., Lemberg, K.M., Lamprecht, M.R., Skouta, R., Zaitsev,E.M., Gleason, C.E., Patel, D.N., Bauer, A.J., Cantley, A.M., Yang, W.S., etal. (2012). Ferroptosis: an iron-dependent form of nonapoptotic cell death.Cell 149 , 1060-1072. Doka , E. , Ida , T. , Dagnell , M. , Abiko , Y. , Luong , NC , Balog , N. ,Takata , T. , Espinosa , B. , Nishimura , A. , Cheng , Q. , et al. (2020). Control ofprotein function through oxidation and reduction of persulfidated states. SciAdv 6 , eaax8 Doka , E. , Pader , I. , Biro , A. , Johansson , K. , Cheng , Q. , Ballago , K. ,Prigge , JR , Pastor-Flores , D. , Dick , TP , Schmidt , EE , et al. (2016). Anovel persulfide detection method reveals protein persulfide- andpolysulfide-reducing functions of thioredoxin and glutathione systems. SciAdv 2 , e1500968. Doman , A. , Doka , E. , Garai , D. , Bogdandi , V. , Balla , G. , Balla , J. ,and Nagy , P. (2023). Interactions of reactive sulfur species withmetalloproteins. Redox Biol 60 , 102617. Dominy, J.E., Jr., Hirschberger, L.L., Coloso, R.M., and Stipanuk,M.H. (2006). Regulation of cysteine dioxygenase degradation is mediated byintracellular cysteine levels and the ubiquitin-26 S proteasome system in theliving rat. Biochem J 394 , 267-273. Erdelyi, K., Ditroi, T., Johansson, H.J., Czikora, A., Balog, N.,Silwal-Pandit, L., Ida, T., Olasz, J., Hajdu, D., Matrai, Z., et al. (2021).Reprogrammed transsulfuration promotes basal-like breast tumor progressionvia realigning cellular cysteine persulfidation. Proc Natl Acad Sci U S A 118 . Filipovic, M.R., Zivanovic, J., Alvarez, B., and Banerjee, R. (2018).Chemical Biology of H2S Signaling through Persulfidation. Chem Rev 118 , 1253-1337. Florent L, Saby C, Slimano F, Morjani H. BRAF V600-Mutated MetastaticMelanoma and Targeted Therapy Resistance: An Update of the Current Knowledge.Cancers. 2023; 15(9):2607. Fujii, S., Sawa, T., Motohashi, H., and Akaike, T. (2019). Persulfidesynthases that are functionally coupled with translation mediate sulfurrespiration in mammalian cells. Br J Pharmacol 176 , 607-615. Giunta, E. F., De Falco, V., Napolitano, S., Argenziano, G.,Brancaccio, G., Moscarella, E., Ciardiello, D., Ciardiello, F.,&Troiani, T.(2020). Optimal treatment strategy for metastatic melanoma patientsharboring BRAF-V600 mutations. Therapeutic advances in medical oncology , 12 ,1758835920925219. https: / / doi.org / 10.1177 / 1758835920925219 Goubern, M., Andriamihaja, M., Nubel, T., Blachier, F., andBouillaud, F. (2007). Sulfide, the first inorganic substrate for human cells.FASEB J 21 , 1699-1706. Hall, A., Meyle, K.D., Lange, M.K., Klima, M., Sanderhoff, M., Dahl,C., Abildgaard, C., Thorup, K., Moghimi, S.M., Jensen, P.B., et al. (2013).Dysfunctional oxidative phosphorylation makes malignant melanoma cellsaddicted to glycolysis driven by the (V600E)BRAF oncogene. Oncotarget 4 , 584-599. Hanna, D., Kumar, R., and Banerjee, R. (2022). A Metabolic Paradigmfor Hydrogen Sulfide Signaling via Electron Transport Chain Plasticity.Antioxid Redox Signal. Haq, R., Shoag, J., Andreu-Perez, P., Yokoyama, S., Edelman, H.,Rowe, G.C., Frederick, D.T., Hurley, A.D., Nellore, A., Kung, A.L., et al.(2013). Oncogenic BRAF regulates oxidative metabolism via PGC1alpha and MITF.Cancer Cell 23 , 302-315. Hellmich, M.R., Coletta, C., Chao, C., and Szabo, C. (2015). Thetherapeutic potential of cystathionine beta-synthetase / hydrogen sulfideinhibition in cancer. Antioxid Redox Signal 22 , 424-448. Hu, Y., Wang, L., Han, X., Zhou, Y., Zhang, T., Wang, L., ...&Wu, F.(2018). Discovery of a bioactive inhibitor with a new scaffold forcystathionine γ-lyase. Journal of Medicinal Chemistry, 62 (3), 1677-1683. Ida, T., Sawa, T., Ihara, H., Tsuchiya, Y., Watanabe, Y., Kumagai,Y., Suematsu, M., Motohashi, H., Fujii, S., Matsunaga, T., et al. (2014).Reactive cysteine persulfides and S-polythiolation regulate oxidative stressand redox signaling. Proc Natl Acad Sci U S A 111 , 7606-7611. Jia, J., Wang, Z., Zhang, M., Huang, C., Song, Y., Xu, F., Zhang, J.,Li, J., He, M., Li, Y., et al. (2020). SQR mediates therapeutic effects of H(2)S by targeting mitochondrial electron transport to induce mitochondrialuncoupling. Sci Adv 6 , eaaz5752. Jiang J, Chen HN, Jin P, Zhou L, Peng L, Huang Z, Qin S, Li B, MingH, Luo M, Xie N, Gao W, Nice EC, Yu Q, Huang C. (2023) Targeting PSAT1 tomitigate metastasis in tumors with p53-72Pro variant. Signal Transduct TargetTher. 8(1) 65. Khamari, R., Trinh, A., Gabert, P.E., Corazao-Rozas, P., Riveros-Cruz, S., Balayssac, S., Malet-Martino, M., Dekiouk, S., Joncquel ChevalierCurt, M., Maboudou, P., et al. (2018). Glucose metabolism and NRF2 coordinatethe antioxidant response in melanoma resistant to MAPK inhibitors. Cell DeathDis 9 , 325. Kumar, R., and Banerjee, R. (2021). Regulation of the redoxmetabolome and thiol proteome by hydrogen sulfide. Crit Rev Biochem MolBiol 56 , 221-235. Kumar, R., Landry, A.P., Guha, A., Vitvitsky, V., Lee, H.J., Seike,K., Reddy, P., Lyssiotis, C.A., and Banerjee, R. (2022). A redox cycle withcomplex II prioritizes sulfide quinone oxidoreductase-dependent H2Soxidation. J Biol Chem 298 , 101435. Kumar, V., Abbas, A., and Aster, J. (2017). Basic pathology(Elsevier). Leikam, C., Hufnagel, A., Walz, S., Kneitz, S., Fekete, A., Muller,M.J., Eilers, M., Schartl, M., and Meierjohann, S. (2014). Cystathionasemediates senescence evasion in melanocytes and melanoma cells. Oncogene 33 ,771-782. Li M, Liu Y, Deng Y, Pan L, Fu H, Han X, Li Y, Shi H, Wang T. (2021)Therapeutic potential of endogenous hydrogen sulfide inhibition in breastcancer (Review), Oncol. Rep., 45(5) , 68. Libiad, M., Vitvitsky, V., Bostelaar, T., Bak, D.W., Lee, H.J.,Sakamoto, N., Fearon, E., Lyssiotis, C.A., Weerapana, E., and Banerjee, R.(2019). Hydrogen sulfide perturbs mitochondrial bioenergetics and triggersmetabolic reprogramming in colon cells. J Biol Chem 294 , 12077-12090. Liu, R., Chen, Y., Liu, G., Li, C., Song, Y., Cao, Z., Li, W., Hu,J., Lu, C., and Liu, Y. (2020). PI3K / AKT pathway as a key link modulates the multidrug resistance of cancers. Cell Death Dis 11 , 797. Liu Y, Wang L, Zhang X, Deng Y, Pan L, Li H, Shi 11(1) , 8963. Lu, J., and Holmgren, A. (2014). The thioredoxin antioxidant system.Free Radic Biol Med 66 , 75-87. Luis, R., Brito, C., and Pojo, M. (2020). Melanoma Metabolism: CellSurvival and Resistance to Therapy. Adv Exp Med Biol 1219 , 203-223. Manzano, J.L., Layos, L., Buges, C., de Los Llanos Gil, M., Vila, L.,Martinez-Balibrea, E., and Martinez-Cardus, A. (2016). Resistant mechanisms to BRAF inhibitors in melanoma. Ann Transl Med 4 , 237. Marutani, E., Morita, M., Hirai, S., Kai, S., Grange, R.M.H.,Miyazaki, Y., Nagashima, F., Traeger, L., Magliocca, A., Ida, T., et al.(2021). Sulfide catabolism ameliorates hypoxic brain injury. Nat Commun 12 ,3108. Mitsuishi, Y., Taguchi, K., Kawatani, Y., Shibata, T., Nukiwa, T.,Aburatani, H., Yamamoto, M., and Motohashi, H. (2012). Nrf2 redirects glucoseand glutamine into anabolic pathways in metabolic reprogramming. CancerCell 22 , 66-79. Modis, K., Coletta, C., Erdelyi, K., Papapetropoulos, A., and Szabo,C. (2013). Intramitochondrial hydrogen sulfide production by 3-mercaptopyruvate sulfurtransferase maintains mitochondrial electron flow andsupports cellular bioenergetics. FASEB J 27 , 601-611. Mourah S, Denis MG, Narducci FE, Solassol J, Merlin JL, Sabourin JC,Scoazec JY, Ouafik L, Emile JF, Heller R, Souvignet C, Bergougnoux L, MerlioJP. Detection of BRAF V600 mutations in melanoma: evaluation of concordancebetween the Cobas® 4800 BRAF V600 mutation test and the methods used inFrench National Cancer Institute (INCa) platforms in a real-life setting.PLoS One. 2015 Mar 19;10(3):e0120232. Nair, A.B., Jacob, S. (2016). A simple practice guide for doseconversion between animals and human. J Basic Clin Pharm, 7(2), 27-31. Nandi, D.L., Horowitz, P.M., and Westley, J. (2000). Rhodanese as athioredoxin oxidase. Int J Biochem Cell Biol 32 , 465-473. Pader, I., Sengupta, R., Cebula, M., Xu, J., Lundberg, J.O.,Holmgren, A., Johansson, K., and Arner, E.S. (2014). Thioredoxin-relatedprotein of 14 kDa is an efficient L-cystine reductase and S-denitrosylase.Proc Natl Acad Sci U S A 111 , 6964-6969. Panza, E., De Cicco, P., Armogida, C., Scognamiglio, G., Gigantino,V., Botti, G., Germano, D., Napolitano, M., Papapetropoulos, A., Bucci, M.,et al. (2015). Role of the cystathionine gamma lyase / hydrogen sulfide pathwayin human melanoma progression. Pigment Cell Melanoma Res 28 , 61-72. Pavlova, N.N., Zhu, J., and Thompson, C.B. (2022). The hallmarks ofcancer metabolism: Still emerging. Cell Metab 34 , 355-377. Pedre, B., and Dick, T.P. (2021). 3-Mercaptopyruvatesulfurtransferase: an enzyme at the crossroads of sulfane sulfur trafficking.Biol Chem 402 , 223-237. Pedre, B., Talwar, D., Barayeu, U., Schilling, D., Luzarowski, M.,Sokolowski, M., Glatt, S., and Dick, T.P. (2023). 3-Mercaptopyruvate sulfurtransferase is a protein persulfidase. Nat Chem Biol. Prahallad, A., Sun, C., Huang, S., Di Nicolantonio, F., Salazar, R.,Zecchin, D., Beijersbergen, R.L., Bardelli, A., and Bernards, R. (2012).Unresponsiveness of colon cancer to BRAF(V600E) inhibition through feedbackactivation of EGFR. Nature 483 , 100-103. Qu, Kevin; Pan, Qiulu; Zhang, Xi; Rodriguez, Luis … Waldman,Frederic, Detection of BRAF V600 Mutations in Metastatic Melanoma: Comparisonof the Cobas 4800 and Sanger Sequencing Assays. (2013) The Journal ofMolecular Diagnostics, 15 (6), 790-795. Recasens, M., Benezra, R., Basset, P., and Mandel, P. (1980).Cysteine sulfinate aminotransferase and aspartate aminotransferase isoenzymesof rat brain. Purification, characterization, and further evidence foridentity. Biochemistry 19 , 4583-4589. Renga, B., Mencarelli, A., Migliorati, M., Distrutti, E., andFiorucci, S. (2009). Bile-acid-activated farnesoid X receptor regulateshydrogen sulfide production and hepatic microcirculation. World JGastroenterol 15 , 2097-2108. Robert, C., Karaszewska, B., Schachter, J., Rutkowski, P.,Mackiewicz, A., Stroiakovski, D., Lichinitser, M., Dummer, R., Grange, F.,Mortier, L., et al. (2015). Improved overall survival in melanoma withcombined dabrafenib and trametinib. N Engl J Med 372 , 30-39. Rockville, MD: US Food and Drug Administration; (2005). Guidance forIndustry: Estimating the Maximum Safe Starting Dose in Adult HealthyVolunteer. Ros, S., Santos, C.R., Moco, S., Baenke, F., Kelly, G., Howell, M.,Zamboni, N., and Schulze, A. (2012). Functional metabolic screen identifies6-phosphofructo-2-kinase / fructose-2,6-biphosphatase 4 as an importantregulator of prostate cancer cell survival. Cancer Discov 2 , 328-343. Sbodio, J.I., Snyder, S.H., and Paul, B.D. (2019). Regulators of thetranssulfuration pathway. Br J Pharmacol 176 , 583-593. Shimoi T, Sunami K, Tahara M, Nishiwaki S, Tanaka S, Baba E, Kanai M,Kinoshita I, Shirota H, Hayashi H, Nishida N, Kubo T, Mamesaya N, Ando Y,Okita N, Shibata T, Nakamura K, Yamamoto N. (2024 ) Dabrafenib and trametinibadministration in patients with BRAF V600E / R or non-V600 BRAF mutatedadvanced solid tumours (BELIEVE, NCCH1901): a multicentre, open-label, andsingle-arm phase II trial. EClinicalMedicine. 69 :102447. Sosman, J.A., Kim, K.B., Schuchter, L., Gonzalez, R., Pavlick, A.C.,Weber, J.S., McArthur, G.A., Hutson, T.E., Moschos, S.J., Flaherty, K.T., etal. (2012). Survival in BRAF V600-mutant advanced melanoma treated withvemurafenib. N Engl J Med 366 , 707-714. Stipanuk, M.H., and Ueki, I. (2011). Dealing with methionine / homocysteine sulfur: cysteine metabolism to taurine and inorganic sulfur. JInherit Metab Dis 34 , 17-32. Sun, C., Wang, L., Huang, S., Heynen, G.J., Prahallad, A., Robert,C., Haanen, J., Blank, C., Wesseling, J., Willems, S.M., et al. (2014).Reversible and adaptive resistance to BRAF(V600E) inhibition in melanoma.Nature 508 , 118-122. Sun X, Niu X, Chen R, He W, Chen D, Kang R, Tang D. (2016)Metallothionein-1G facilitates sorafenib resistance through inhibition offerroptosis. Hepatology. 64(2) 488-500. Szabo, C. (2007). Hydrogen sulphide and its therapeutic potential.Nat Rev Drug Discov 6 , 917-935. Szabo, C. (2016). Gasotransmitters in cancer: from pathophysiology toexperimental therapy. Nat Rev Drug Discov 15 , 185-203. Szabo, C., Ransy, C., Modis, K., Andriamihaja, M., Murghes, B.,Coletta, C., Olah, G., Yanagi, K., and Bouillaud, F. (2014). Regulation ofmitochondrial bioenergetic function by hydrogen sulfide. Part I. Biochemicaland physiological mechanisms. Br J Pharmacol 171 , 2099-2122. Ubuka, T., Ohta, J., Akagi, R., Hosaki, Y., Ishimoto, Y., Kiguchi,S., Ikeda, T., and Ishino, K. (1992). Metabolism ofL-cysteine viatransamination pathway (3-mercaptopyruvate pathway). Amino Acids 3 , 243-252. Veith, A., and Moorthy, B. (2018). Role of Cytochrome P450s in theGeneration and Metabolism of Reactive Oxygen Species. Curr Opin Toxicol 7 , 44-51. Vitvitsky, V., Kumar, R., Libiad, M., Maebius, A., Landry, A.P., andBanerjee, R. (2021). The mitochondrial NADH pool is involved in hydrogensulfide signaling and stimulation of aerobic glycolysis. J Biol Chem 296 ,100736. Wallace, J.L., and Wang, R. (2015). Hydrogen sulfide-basedtherapeutics: exploiting a unique but ubiquitous gasotransmitter. Nat RevDrug Discov 14 , 329-345. Wang, L., Leite de Oliveira, R., Huijberts, S., Bosdriesz, E.,Pencheva, N., Brunen, D., Bosma, A., Song, J.Y., Zevenhoven, J., Los-deVries, G.T., et al. (2018). An Acquired Vulnerability of Drug-ResistantMelanoma with Therapeutic Potential. Cell 173 , 1413-1425 e1414. Wang L, Shi H, Liu Y, Zhang W, Duan X, Li M, Shi X, Wang T. (2019)Cystathionine γ lyase promotes the metastasis of breast cancer via the VEGFsignaling pathway. Int J Oncol. 55(2) 473-487. Wang, R.H., Chu, Y.H., and Lin, K.T. (2021). The Hidden Role ofHydrogen Sulfide Metabolism in Cancer. Int J Mol Sci 22 . Wedmann, R., Onderka, C., Wei, S., Szijarto, I.A., Miljkovic, J.L.,Mitrovic, A., Lange, M., Savitsky, S., Yadav, P.K., Torregrossa, R., et al.(2016). Improved tag-switch method reveals that thioredoxin acts asdepersulfidase and controls the intracellular levels of proteinpersulfidation. Chem Sci 7 , 3414-3426. Wu, Z., Khodade, V.S., Chauvin, J.R., Rodriguez, D., Toscano, J.P.,and Pratt, D.A. (2022). Hydropersulfides Inhibit Lipid Peroxidation andProtect Cells from Ferroptosis. J Am Chem Soc 144 , 15825-15837. Yadav, P.K., Martinov, M., Vitvitsky, V., Seravalli, J., Wedmann, R.,Filipovic, M.R., and Banerjee, R. (2016). Biosynthesis and Reactivity ofCysteine Persulfides in Signaling. J Am Chem Soc 138 , 289-299. Yi, M., Ban, Y., Tan, Y., Xiong, W., Li, G., and Xiang, B. (2019). 6-Phosphofructo-2-kinase / fructose-2,6-biphosphatase 3 and 4: A pair of valvesfor fine-tuning of glucose metabolism in human cancer. Mol Metab 20, 1-13. Yoo, H.C., and Han, J.M. (2022). Amino Acid Metabolism in Cancer DrugResistance. Cells 11 . Yushak, M., Chapman, P., Robert, C.,&Kudchadkar, R. (2017). Systemictherapy options for patients with unresectable melanoma.American Society ofClinical Oncology Educational Book, 37 , 661-672. Zhao, K., Ju, Y., Li, S., Altaany, Z., Wang, R., and Yang, G. (2014).S-sulfhydration of MEK1 leads to PARP-1 activation and DNA damage repair.EMBO Rep 15 , 792-800. Zhu, J., and Thompson, C.B. (2019). Metabolic regulation of cellgrowth and proliferation. Nat Rev Mol Cell Biol 20 , 436-450. Zivanovic, J., Kouroussis, E., Kohl, J.B., Adhikari, B., Bursac, B.,Schott-Roux, S., Petrovic, D., Miljkovic, J.L., Thomas-Lopez, D., Jung, Y.,et al. (2019). Selective Persulfide Detection Reveals EvolutionarilyConserved Antiaging Effects of S-Sulfhydration. Cell Metab 30 , 1152-1170e1113.

Claims

1. A cystathionine-γ-lyase (CSE) inhibitor, in combination with one or more MAPK inhibitors, for the treatment of BRAF V600 mutation-positive cancers in patients, for the prevention or delay of the development or progression of acquired resistance in said patients to treatment of said cancers using said one or more MAPK inhibitors. in, The MAPK inhibitors include BRAF V600 mutation inhibitors.

2. The CSE inhibitor for said application according to claim 1, wherein, The CSE inhibitor is selective for CSE.

3. The CSE inhibitor for the application according to any one of claims 1 and 2, which is used to prevent or delay the development of acquired resistance in the patient to treatment of the cancer using one or more of the MAPK inhibitors, wherein the cancer is BRAF V600 mutation-positive melanoma, and the MAPK inhibitor comprises a BRAF V600 inhibitor. in, Preferably, the mutation in the BRAF V600 mutation inhibitor is selected from the group consisting of: V600D, V600K, V600R, or V600E; more preferably, V600K or V600E; even more preferably, V600E, and Preferably, the patient is a mammalian patient, and more preferably a human patient.

4. The CSE inhibitor for said application according to claim 3, in, The MAPK inhibitors include BRAF inhibitors, preferably MEK inhibitors.

5. The CSE inhibitor for the application according to any one of claims 1 to 4, which is used to prevent or delay the development of acquired resistance to the tumor in the patient, wherein the tumor is a BRAF V600 mutation-positive cancer with BRAF V600D, V600K, V600R or V600E mutations.

6. The CSE inhibitor for said application according to any one of claims 3 to 5, wherein, The BRAF inhibitor is selected from vemurafenib, dabrafenib, or encofenib.

7. The CSE inhibitor for said application according to any one of claims 3 to 6, wherein, The MEK inhibitor is selected from trametinib, cobimetinib, bimetinib, or selmetinib, more preferably from trametinib, cobimetinib, or bimetinib, and even more preferably from trametinib.

8. The CSE inhibitor for said application according to any one of claims 3 to 7, wherein, The MAPK inhibitors include BRAF V600 inhibitors selected from vemurafenib, dabrafenib, and encofenib, and MEK inhibitors selected from cobimetinib, trametinib, and bimetinib. Preferably, the combination of BRAF inhibitor and MEK inhibitor is dabrafenib + trametinib, vemurafenib + cobimetinib, or encofenib + bimetinib; more preferably, dabrafenib + trametinib.

9. The CSE inhibitor for the application according to any one of claims 3 to 8, which is used to prevent or delay the development of acquired resistance to BRAF V600E and MEK inhibitors in BRAF V600E-mutant cancers, wherein the inhibitor is specific to CSE.

10. The CSE inhibitor for said application according to claim 9, wherein, The CSE inhibitor is selected from propargyl glycine (PAG), β-cyanoalanine (BCA), L-aminoethoxyvinylglycine (AVG), hydroxylamine, I194496, I157172, S-3-carboxypropyl-L-cysteine ​​(CPC), NSC4056 (golden tricarboxylic acid), L-aminoethoxyvinylglycine, 2-arylhydrazidodithiocarbamate, or cystathionine-γ-lyase-IN-1 (CAS No. 2165706-30-7). Preferred are β-cyanoalanine (BCA), L-aminoethoxyvinylglycine (AVG) and propargylglycine (PAG), more preferably D,L-propargylglycine (2-aminopent-4-alkynic acid or H-DL-Pra-OH or N-propargylglycine (2-propyn-1-ylamino)acetic acid), and most preferably propargylglycine (PAG).

11. The CSE inhibitor for said application according to any one of claims 1 to 10, wherein, The development of resistance was delayed by at least 1, 2, 3, 4, 5, 6 months or longer.

12. The CSE inhibitor for said application according to any one of claims 1 to 11, wherein in, The CSE inhibitor is administered before the MAPK inhibitor, or Wherein, the CSE inhibitor and the MAPK inhibitor are administered in parallel, or The CSE inhibitor is administered after the MAPK inhibitor; or the CSE inhibitor and the MAPK inhibitor are administered in sequential, intermittent, or continuous therapy.

13. A pharmaceutical kit comprising a cystathionine-γ-lyase (CSE) inhibitor and a MAPK inhibitor, in combination with one or more MAPK inhibitors, for use in the treatment of BRAF V600 mutation-positive cancers in patients, preferably for the prevention or delay of the development of resistance in said patients to treatment of said cancer using said MAPK inhibitors. in, The MAPK inhibitors include BRAF V600 mutation inhibitors.

14. A pharmaceutical composition comprising a cystathionine-γ-lyase (CSE) inhibitor and a MAPK inhibitor, and a pharmaceutically acceptable excipient. The pharmaceutical composition is used to treat patients with BRAF V600 mutation-positive cancer.

15. The kit for said application according to claim 13 or the pharmaceutical composition for said application according to claim 14, wherein, The CSE inhibitor is as defined in claim 9 and / or the MAPK inhibitor is as defined in claims 6 to 8.

16. The CSE inhibitor for said application according to claim 1 or 2, the kit according to claim 13, or the pharmaceutical composition according to claim 14, wherein, The cancers, preferably tumors, are selected from the group consisting of: melanoma, skin cancer, epithelial cancer, colorectal cancer, colon cancer, rectal cancer, lung cancer, thyroid cancer, breast cancer, ovarian cancer, brain cancer, pancreatic cancer, gastrointestinal neuroendocrine tumors, neuroblastoma, glioma, astrocytoma, leukemia, piloblastic leukemia, hepatobiliary cancer, nephroblastoma (Wilmes' tumor), histiocytosis, Langerhans cell histiocytosis, and Eldheim-Chester disease; with preference given to melanoma, colorectal cancer, colon cancer, rectal cancer, and lung cancer; particularly melanoma.

Citation Information

Patent Citations

  • Cystathionine-gamma-lyase (CSE) inhibitors

    US10227314B2

  • Cystathionine-γ-lyase (CSE) inhibitors

    US9725426B2

  • A pharmaceutical combination for the treatment of melanoma

    WO2015004636A1

  • Methods of reducing kinase inhibitor resistance

    WO2015161230A1

  • A triple pharmaceutical combination comprising dabrafenib, an ERK inhibitor and a RAF inhibitor or a PD-1 inhibitor

    WO2021171260A2