A genetically engineered strain for dha oil production of schizochytrium sp. based on carbon flux guidance and fatty acid transport enhancement, method and application thereof

By introducing the ACLY and Fat1p genes into Schizochytrium, a genetically engineered strain was constructed, which solved the problem of carbon flux loss, improved the production efficiency and economy of DHA oil, and reduced production costs.

CN121538090BActive Publication Date: 2026-06-09NANJING NORMAL UNIVERSITY
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202610066532.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-19
Publication Date
2026-06-09
Estimated Expiration
2046-01-19

AI Technical Summary

Technical Problem

The current production of DHA oil from Schizochytrium involves significant carbon flux loss, resulting in high production costs. Existing research has failed to effectively address the carbon flux loss problem, thus limiting the efficiency and economic viability of industrial-scale DHA oil production.

Method used

By introducing optimized ACLY and Fat1p encoding genes related to guiding carbon flux and fatty acid transport into Schizochytrium, a genetically engineered strain was constructed. Combined with metabolic engineering techniques, carbon flux was guided for lipid synthesis and fatty acid decomposition was prevented, thereby improving the production efficiency of DHA lipids.

Benefits of technology

It significantly improves the production efficiency and economy of DHA oil, reduces carbon source costs, increases the yield and production capacity of DHA oil, and saves time and glucose usage.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121538090B_ABST
    Figure CN121538090B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of bioengineering, and discloses a genetically engineered strain for DHA oil production of Schizochytrium sp. based on carbon flux guidance and enhanced fatty acid transport, a method and application thereof. The genetically engineered strain is obtained by introducing optimized coding genes ACLY and / or Fat1p coding genes related to carbon flux guidance and fatty acid transport into Schizochytrium sp. in vivo. The gene sequence of the gene ACLY is SEQ ID No. 9, and the gene sequence of the gene Fat1p is SEQ ID No. 10. Through metabolic engineering, the application constructs a Schizochytrium sp. engineering strain for DHA oil production based on carbon flux guidance and enhanced fatty acid transport. The Schizochytrium sp. engineering strain is based on the combination of carbon flux guidance and fatty acid transport, which can not only be used for oil synthesis by guiding carbon flux, but also avoid oil degradation by fatty acid transport.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of bioengineering technology, and in particular to a genetically engineered strain, method and application of Schizochytrium malachite for DHA lipid production based on carbon flux guidance and fatty acid transport enhancement. Background Technology

[0002] Omega-3 fatty acids are a class of long-chain unsaturated fatty acids with multiple double bonds, mainly including eicosapentaenoic acid (EPA, C20:5) and docosahexaenoic acid (DHA, C22:6). DHA, as an essential fatty acid, cannot be efficiently synthesized by the body and must be obtained through diet or supplements. It is a key substance for infant brain and nerve development, cardiovascular protection, and anti-inflammatory effects, and is widely used in infant formula, health supplements, and pharmaceuticals. However, traditional Omega-3 fatty acid production methods rely on fish oil extraction, leading to overexploitation of fishery resources and a decline in resource levels of approximately 90%. Furthermore, fish oil products have a heavy metal contamination rate as high as 15%, with a processing efficiency of only 30-40% and severe pollution, making it difficult to meet the demands of sustainable production.

[0003] Schizochytrium sp., a marine single-celled heterotrophic protozoan, is a microorganism with the greatest potential for industrial DHA production. Its core advantage lies in its ability to efficiently synthesize and accumulate polyunsaturated fatty acids. This marine fungus can rapidly proliferate through heterotrophic fermentation, achieving an oil content of over 50% of cell dry weight under optimized culture conditions, with DHA accounting for a breakthrough 45%–60% of total fatty acids. Its unique carbon metabolism pathway efficiently converts inexpensive carbon sources such as glucose into the target product. Through process innovations such as staged dissolved oxygen control, the DHA yield can be increased to 16.27 mg / L / h. Schizochytrium is particularly outstanding in its environmental adaptability and production controllability—it is not limited by marine pollution, seasonal climate, or geographical location. The fully enclosed fermentation process avoids heavy metal residues. Combined with extraction technologies such as the acidic n-hexane method, it achieves high-purity, low-cost, and pollution-free sustainable production. These characteristics make it a successful alternative to fish oil, becoming a core biomanufacturing platform to meet global DHA demand, and it is currently being used on a large scale in infant formula, pharmaceutical preparations, and aquatic feed.

[0004] However, it cannot be ignored that the cost of large-scale industrial fermentation production of DHA oil is still very high, mainly due to the cost of carbon source, which accounts for about 80% of substrate cost and 60% of total fermentation cost. Currently, many studies are dedicated to developing cost-effective fermentation carbon sources, including lignocellulose hydrolysate, corn stalk hydrolysate, waste acid oil, and molasses (Bao, Z., Zhu, Y., Zhang, K., Feng, Y., Chen, X., Lei, M., Yu, L., 2021. High-value utilization of the waste hydrolysate of Dioscorea zingiberensis fordocosahexaenoic acid production in Schizochytrium sp. Bioresour. Technol. 2021, 336, 125305; Gupta, A., Barrow, CJ, Puri, M., 2021. Multiproduct biorefinery from marine thraustochytrids towards a circular bioeconomy. Trends Biotechnol. 2021, 40(4), 448-462; 221-226; Ye, H., He, Y., Xie, Y.,Sen, B., Wang, G., 2020. Fed-batch fermentation of mixed carbon

[0005] The source significantly enhances the production of docosahexaenoic acidin in *Thaustochytriidae* sp. PKU#Mn16 by differentially regulating fatty acids biosynthetic pathways. (Bioresour. Technol. 2020, 297, 122402). While these strategies have successfully reduced the fermentation costs of *Thaustochytriidae* and contributed to the development of a circular economy, the complexity of pretreatment, unstable sources, low concentrations, and difficulties in analysis limit the ability of these carbon sources to completely replace glucose in microbial fermentation.

[0006] In fact, existing research shows that the main reason for the high production cost of DHA lipids by Schizochytrium using glucose is that less than 20% of the carbon flux of glucose is converted into lipids. More than 80% of the carbon flux is consumed in three ways: (1) some carbon flux is converted into biomass to ensure the normal life activities of Schizochytrium; (2) some carbon flux is converted into carbon dioxide through the TCA cycle and consumed; (3) in addition, the lipids accumulated by Schizochytrium will be decomposed by lipases in the body to generate free fatty acids, which will be... β - It is oxidized to produce acetyl-CoA, which is then consumed.

[0007] Chinese patent publication CN120026063A utilizes *Schizochytrium* fermentation to produce DHA oil from *Alternaria alternata*, but after 120 hours of fermentation, only 10.72 g / L of DHA oil is obtained. Chinese patent publication CN120866432A involves adding... β- Carotene and reduced glutathione promoted DHA production by Schizochytrium, but only increased DHA yield by 10.9% in a 5L fermenter, and oil yield also increased by only 10.9%. Not only did the production cost increase compared to this study, but the improvement in oil production capacity was also very limited because the carbon flux loss problem was not addressed. Chinese patent publication CN120775934A involved fermenting Schizochytrium strains until the growth phase ended (nitrogen source depletion); at the end of the Schizochytrium growth phase, exogenous hydrogen peroxide was added, followed by culturing, and then exogenous para-aminobenzoic acid was added again; this process was repeated several times, and after 72 hours of fermentation, only 1.49 g / L DHA oil was obtained. Therefore, existing research has not developed a targeted method for addressing carbon flux loss in Schizochytrium.

[0008] Therefore, developing a strategy that can guide carbon flux and protect fatty acids from decomposition is of great significance for enhancing the industrial production of Schizochytrium DHA oil. Summary of the Invention

[0009] The purpose of this invention is to overcome the shortcomings of the prior art and provide a genetically engineered strain, method and application of Schizochytrium malaccensis for DHA lipid production based on carbon flux guidance and fatty acid transport enhancement.

[0010] The technical solution adopted by this invention to solve its technical problem is:

[0011] A genetically engineered strain for enhancing DHA lipid production in Schizochytrium based on carbon flux guidance and fatty acid transport enhancement, wherein the genetically engineered strain is obtained by introducing optimized carbon flux guidance and fatty acid transport related coding genes ACLY and / or Fat1p coding genes into Schizochytrium.

[0012] The gene sequence of ACLY is SEQ ID No. 9, and the gene sequence of Fat1p is SEQ ID No. 10.

[0013] Furthermore, the schistocytrium is an oil-producing schistocytrium HX-308.

[0014] The method for constructing the genetically engineered strain as described above includes the following steps:

[0015] The ATP-citrate lyase ACLY gene from Apiospora arundinis and the fatty acid transporter Fat1p gene from Saccharomyces cerevisiae were cloned and inserted into the pBS-Zeo plasmid using homologous recombination technology to construct overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p, and pBS-Zeo-ACLY-Fat1p. The overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p, and pBS-Zeo-ACLY-Fat1p were then electroporated into Schizochytrium sp. HX-308 to obtain the genetically engineered strain.

[0016] Furthermore, the specific steps are as follows:

[0017] (1) Cloning ACLY and Fat1p gene fragments;

[0018] (2) Amplify the homologous arms of the FACLY and Fat1p genes to obtain gene fragments with homologous arms ACLY and Fat1p;

[0019] (3) Connecting reaction;

[0020] The digested vector pBS-Zeo fragment and the gene fragment with homologous arms ACLY and Fat1p obtained in step (2) were ligated using Gibson assembly to obtain the ligation products, namely the recombinant overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p and pBS-Zeo-ACLY-Fat1p;

[0021] (4) The ligation products were transformed into Escherichia coli DH5α competent cells to obtain overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p and pBS-Zeo-ACLY-Fat1p;

[0022] (5) The overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p and pBS-Zeo-ACLY-Fat1p were transferred into Schizochytrium to construct Schizochytrium AC, FA and ACF engineered strains, and the genetically engineered strains were obtained.

[0023] The application of the genetically engineered strains described above in enhancing the production of DHA oil from Schizochytrium.

[0024] A method for producing DHA lipids using the genetically engineered strains described above, wherein the genetically engineered strains are inoculated into a seed culture medium to obtain primary seeds; the primary seeds are inoculated into a seed culture medium to obtain secondary seeds; the secondary seeds are inoculated into a seed culture medium to obtain tertiary seeds, which are used as fermentation strains; the fermentation strains are inoculated into a fermentation culture medium, and DHA lipids are obtained through fermentation.

[0025] Furthermore, it includes the following steps:

[0026] (1) After culturing the cultured Schizochytrium from the cryopreserved tubes on a plate medium at 28°C for 72 hours, pick a single colony;

[0027] (2) Single colonies were inoculated into seed culture medium, and cultured at 28°C and 230 rpm for 48 h without adjusting the pH to obtain primary seeds;

[0028] (3) Primary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170 rpm for 24 h to obtain secondary seeds. OD at 24 h 600 >3. Furthermore, microscopic examination revealed no bacterial contamination, indicating the ability to transmit the virus to the next generation;

[0029] (4) Secondary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170rpm for 24h to obtain tertiary seeds. The OD at 24h was... 600 >5. And microscopic examination showed no bacteria, indicating that it can be transmitted to the next generation;

[0030] (5) The third-generation seeds were inoculated into seed tanks at an inoculation rate of 2%. The seed tanks were filled with seed culture medium and cultured at 28℃, 150 rpm, and 20 L / min for 24 h to obtain the first generation seeds. The OD of the seed tanks was measured at 20 h. 600 >8. And microscopic examination showed no bacteria, indicating that it can be transmitted to the next generation;

[0031] (6) The first-generation seed was inoculated into the fermenter at an inoculum rate of 2%. The fermenter was filled with fermentation medium and incubated at 28°C, 100 rpm, and 15 minutes. 3 Fermentation begins at 100 rpm and the rotation speed is gradually increased to 300 rpm. Fermentation is carried out for 48-120 hours.

[0032] Furthermore, the fermentation time is 48h, 60h, 72h, 84h, 96h or 120h;

[0033] Alternatively, the plate culture medium has a pH of 6.0–6.5 and comprises: agar 15–20 g / L, glucose 30–60 g / L, yeast extract 8–15 g / L, sodium sulfate 10–15 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 6–12 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 8–12 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, and manganese chloride tetrahydrate 3–5 mg / L. Sodium molybdate dihydrate 0.04 mg / L, Vitamin B6 4-10 mg / L, Vitamin B 12 0.1-1.5 mg / L.

[0034] Further, the seed culture medium has a pH of 6.0–6.5 and comprises: 40–60 g / L glucose, 4–6 g / L yeast extract, 5–8 g / L sodium sulfate, 2–4 g / L magnesium sulfate, 4–8 g / L ammonium sulfate, 1–2 g / L potassium chloride, 0.1–0.2 g / L calcium chloride, 0.5–1 g / L potassium sulfate, 0.5–2 g / L potassium dihydrogen phosphate, 8–12 g / L monosodium glutamate, 1–5 mg / L zinc sulfate heptahydrate, 0.01–0.1 mg / L cobalt chloride hexahydrate, 2–6 mg / L copper sulfate pentahydrate, 1–2 mg / L nickel sulfate hexahydrate, 8–15 mg / L ferric sulfate heptahydrate, 2–4 mg / L calcium pantothenate, 3–5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.

[0035] The fermentation medium has a pH of 5.0–6.5 and includes: glucose 60–100 g / L, yeast extract 5–15 g / L, sodium sulfate 5–12 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 4–8 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 15–20 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, manganese chloride tetrahydrate 3–5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 4–10 mg / L, and vitamin B1. 12 0.1-0.5 mg / L.

[0036] Furthermore, the method for collecting bacterial cells to extract oil includes:

[0037] 1) After fermentation culture is completed, add NaOH solution to the fermentation broth to adjust the pH to 10-13, then add 0.01-0.5% of cell wall breaking enzyme at a final mass concentration, and shake at 100-200 r / min for 5-15 h at 40-60℃.

[0038] 2) Cool to room temperature and add an equal volume of anhydrous ethanol to the fermentation broth to inactivate the cell wall-breaking enzyme;

[0039] 3) Extract with n-hexane and collect the upper organic phase;

[0040] 4) Repeat step 3) several times, combine the organic phases, evaporate the solvent, and obtain the oil.

[0041] The advantages and positive effects of this invention are as follows:

[0042] 1. This invention utilizes metabolic engineering techniques to construct a Schizochytrium strain that enhances DHA lipid production through carbon flux guidance and fatty acid transport. This Schizochytrium strain, combining carbon flux guidance and fatty acid transport, can not only guide carbon flux for lipid synthesis but also prevent lipid degradation through fatty acid transport.

[0043] 2. Using the engineered strain of Schizochytrium of this invention to produce DHA can efficiently convert glucose into oil, significantly improving the economics of industrial production of DHA oil.

[0044] 3. This invention constructs a recombinant Schizochytrium strain that guides carbon flux and fatty acid transport to produce DHA oil through genetic engineering, providing an effective approach for the industrial-scale and economical production of DHA oil.

[0045] 4. Currently, the market price of glucose is around 4,000 yuan per ton. The normal cost of producing 1 ton of DHA oil carbon source using the Schizochytrium HX-308 strain is around 21,300 yuan. However, the cost of producing 1 ton of DHA oil carbon source using the Schizochytrium AC strain is only around 18,100 yuan, the cost of producing 1 ton of DHA oil carbon source using the Schizochytrium FA strain is only around 16,400 yuan, and the cost of producing 1 ton of DHA oil carbon source using the Schizochytrium ACF strain is only around 12,800 yuan. The carbon source cost of producing DHA oil using the Schizochytrium AC, FA, and ACF strains has decreased by 17.6%, 29.8%, and 65.9% respectively, greatly improving economic efficiency.

[0046] 5. The oil production capacity using the Schizochytrium ACF strain is 69.3 g / L, which is 42.9% higher than that of the HX-308 strain. Using the Schizochytrium ACF strain to produce DHA oil can greatly save time and costs.

[0047] 6. The Schizochytrium ACF strain can efficiently convert glucose into DHA lipids, which not only saves production costs and time, but also saves a large amount of glucose. Attached Figure Description

[0048] Figure 1 The structural diagrams of the overexpression plasmids pBS-Zeo-ACLY, pBS-Zeo-Fat1p, and pBS-Zeo-ACLY-Fat1p used in this invention are shown below.

[0049] Figure 2 This is a pathway diagram of the conversion of glucose into DHA lipids by Schizochytrium in this invention.

[0050] Figure 3 This is a comparative diagram of oil production by Schizochytrium HX-308 and Schizochytrium AC, FA and ACF strains in this invention.

[0051] Figure 4 This is a comparison chart of the oil yield of Schizochytrium HX-308 and Schizochytrium AC, FA and ACF strains in this invention. Detailed Implementation

[0052] The present invention will be further described below with reference to the embodiments. The following embodiments are descriptive and not limiting, and should not be used to limit the scope of protection of the present invention.

[0053] The various experimental operations involved in the specific embodiments are all conventional techniques in the field. For parts not specifically annotated in this document, those skilled in the art can refer to various commonly used reference books, scientific and technological documents or related instructions and manuals prior to the filing date of this invention to carry out the operations.

[0054] A genetically engineered strain for enhancing DHA lipid production in Schizochytrium based on carbon flux guidance and fatty acid transport enhancement, wherein the genetically engineered strain is obtained by introducing optimized carbon flux guidance and fatty acid transport related coding genes ACLY and / or Fat1p coding genes into Schizochytrium.

[0055] The gene sequence of ACLY is SEQ ID No. 9, and the gene sequence of Fat1p is SEQ ID No. 10.

[0056] Furthermore, the schistocytrium is an oil-producing schistocytrium HX-308.

[0057] The method for constructing the genetically engineered strain as described above includes the following steps:

[0058] The ATP-citrate lyase ACLY gene from Apiospora arundinis and the fatty acid transporter Fat1p gene from Saccharomyces cerevisiae were cloned and inserted into the pBS-Zeo plasmid using homologous recombination technology to construct overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p, and pBS-Zeo-ACLY-Fat1p. The overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p, and pBS-Zeo-ACLY-Fat1p were then electroporated into Schizochytrium sp. HX-308 to obtain the genetically engineered strain.

[0059] Furthermore, the specific steps are as follows:

[0060] (1) Cloning ACLY and Fat1p gene fragments;

[0061] (2) Amplify the homologous arms of the FACLY and Fat1p genes to obtain gene fragments with homologous arms ACLY and Fat1p;

[0062] (3) Connecting reaction;

[0063] The digested vector pBS-Zeo fragment and the gene fragment with homologous arms ACLY and Fat1p obtained in step (2) were ligated using Gibson assembly to obtain the ligation products, namely the recombinant overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p and pBS-Zeo-ACLY-Fat1p;

[0064] (4) The ligation products were transformed into Escherichia coli DH5α competent cells to obtain overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p and pBS-Zeo-ACLY-Fat1p;

[0065] (5) The overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p and pBS-Zeo-ACLY-Fat1p were transferred into Schizochytrium to construct Schizochytrium AC, FA and ACF engineered strains, and the genetically engineered strains were obtained.

[0066] The application of the genetically engineered strains described above in enhancing the production of DHA oil from Schizochytrium.

[0067] A method for producing DHA lipids using the genetically engineered strains described above, wherein the genetically engineered strains are inoculated into a seed culture medium to obtain primary seeds; the primary seeds are inoculated into a seed culture medium to obtain secondary seeds; the secondary seeds are inoculated into a seed culture medium to obtain tertiary seeds, which are used as fermentation strains; the fermentation strains are inoculated into a fermentation culture medium, and DHA lipids are obtained through fermentation.

[0068] Furthermore, it includes the following steps:

[0069] (1) After culturing the cultured Schizochytrium from the cryopreserved tubes on a plate medium at 28°C for 72 hours, pick a single colony;

[0070] (2) Single colonies were inoculated into seed culture medium, and cultured at 28°C and 230 rpm for 48 h without adjusting the pH to obtain primary seeds;

[0071] (3) Primary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170 rpm for 24 h to obtain secondary seeds. OD at 24 h 600 >3. Furthermore, microscopic examination revealed no bacterial contamination, indicating the ability to transmit the virus to the next generation;

[0072] (4) Secondary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170rpm for 24h to obtain tertiary seeds. The OD at 24h was... 600 >5. And microscopic examination showed no bacteria, indicating that it can be transmitted to the next generation;

[0073] (5) The third-generation seeds were inoculated into seed tanks at an inoculation rate of 2%. The seed tanks were filled with seed culture medium and cultured at 28℃, 150 rpm, and 20 L / min for 24 h to obtain the first generation seeds. The OD of the seed tanks was measured at 20 h. 600 >8. And microscopic examination showed no bacteria, indicating that it can be transmitted to the next generation;

[0074] (6) The first-generation seed was inoculated into the fermenter at an inoculum rate of 2%. The fermenter was filled with fermentation medium and incubated at 28°C, 100 rpm, and 15 minutes. 3 Fermentation begins at 100 rpm and the rotation speed is gradually increased to 300 rpm. Fermentation is carried out for 48-120 hours.

[0075] Furthermore, the fermentation time is 48h, 60h, 72h, 84h, 96h, or 120h;

[0076] Alternatively, the plate culture medium has a pH of 6.0–6.5 and comprises: agar 15–20 g / L, glucose 30–60 g / L, yeast extract 8–15 g / L, sodium sulfate 10–15 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 6–12 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 8–12 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, and manganese chloride tetrahydrate 3–5 mg / L. Sodium molybdate dihydrate 0.04 mg / L, Vitamin B6 4-10 mg / L, Vitamin B 12 0.1-1.5 mg / L.

[0077] Further, the seed culture medium has a pH of 6.0–6.5 and comprises: 40–60 g / L glucose, 4–6 g / L yeast extract, 5–8 g / L sodium sulfate, 2–4 g / L magnesium sulfate, 4–8 g / L ammonium sulfate, 1–2 g / L potassium chloride, 0.1–0.2 g / L calcium chloride, 0.5–1 g / L potassium sulfate, 0.5–2 g / L potassium dihydrogen phosphate, 8–12 g / L monosodium glutamate, 1–5 mg / L zinc sulfate heptahydrate, 0.01–0.1 mg / L cobalt chloride hexahydrate, 2–6 mg / L copper sulfate pentahydrate, 1–2 mg / L nickel sulfate hexahydrate, 8–15 mg / L ferric sulfate heptahydrate, 2–4 mg / L calcium pantothenate, 3–5 mg / L manganese chloride tetrahydrate, and 0.04 mg / L sodium molybdate dihydrate.

[0078] The fermentation medium has a pH of 5.0–6.5 and includes: glucose 60–100 g / L, yeast extract 5–15 g / L, sodium sulfate 5–12 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 4–8 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 15–20 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, manganese chloride tetrahydrate 3–5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 4–10 mg / L, and vitamin B1. 12 0.1-0.5 mg / L.

[0079] Furthermore, the method for collecting bacterial cells to extract oil includes:

[0080] 1) After fermentation culture is completed, add NaOH solution to the fermentation broth to adjust the pH to 10-13, then add 0.01-0.5% of cell wall breaking enzyme at a final mass concentration, and shake at 100-200 r / min for 5-15 h at 40-60℃.

[0081] 2) Cool to room temperature and add an equal volume of anhydrous ethanol to the fermentation broth to inactivate the cell wall-breaking enzyme;

[0082] 3) Extract with n-hexane and collect the upper organic phase;

[0083] 4) Repeat step 3) several times, combine the organic phases, evaporate the solvent, and obtain the oil.

[0084] Specifically, the relevant preparation and testing methods are as follows:

[0085] This invention uses Schizochytrium sp. HX-308 as the original strain, and obtains engineered strains of Schizochytrium AC, FA and ACF through rational design. DHA oil is obtained by fermenting the engineered strains of Schizochytrium AC, FA and ACF in a 5000L fermenter, laying a theoretical foundation for the industrialization of the product.

[0086] Unless otherwise specified, the equipment, reagents, processes, parameters, etc. involved in this invention are all conventional equipment, reagents, processes, parameters, etc., and no further examples will be provided.

[0087] All ranges listed in this invention include all point values ​​within that range.

[0088] In this invention, unless otherwise specified or generally applicable within the field, % refers to mass percentage and ratio refers to mass proportion. The unit of mass is, for example, grams, kilograms, or tons.

[0089] In this invention, "room temperature" refers to the normal ambient temperature, which can be 10 to 30°C.

[0090] The culture media used in the following examples are as follows:

[0091] The plate culture medium has a pH of 6.6 and consists of the following components: agar 15-20 g / L, glucose 40 g / L, yeast extract 10 g / L, sodium sulfate 10 g / L, magnesium sulfate 2 g / L, ammonium sulfate 6 g / L, potassium chloride 1 g / L, calcium chloride 0.1 g / L, potassium sulfate 0.6 g / L, potassium dihydrogen phosphate 1 g / L, monosodium glutamate 10 g / L, 0.1% trace minerals (i.e., zinc sulfate heptahydrate 3 g / L, cobalt chloride hexahydrate 0.05 g / L, copper sulfate pentahydrate 5 g / L, nickel sulfate hexahydrate 1 g / L, ferric sulfate heptahydrate 10 g / L, calcium pantothenate 4 g / L, manganese chloride tetrahydrate 5 g / L, sodium molybdate dihydrate 0.04 g / L), vitamin B6 5 mg / L, and vitamin B1. 12 0.5 mg / L.

[0092] The seed culture medium had a pH of 6.6 and included: 50 g / L glucose, 5 g / L yeast extract, 5 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 10 g / L monosodium glutamate, 0.1% trace minerals (i.e., 3 g / L zinc sulfate heptahydrate, 0.05 g / L cobalt chloride hexahydrate, 5 g / L copper sulfate pentahydrate, 1 g / L nickel sulfate hexahydrate, 10 g / L ferric sulfate heptahydrate, 4 g / L calcium pantothenate, 5 g / L manganese chloride tetrahydrate, 0.04 g / L sodium molybdate dihydrate), 5 mg / L vitamin B6, and vitamin B1. 12 0.5 mg / L.

[0093] The fermentation medium has a pH of 6.0–7.5 and includes: 80 g / L glucose, 10 g / L yeast extract, 10 g / L sodium sulfate, 2 g / L magnesium sulfate, 6 g / L ammonium sulfate, 1 g / L potassium chloride, 0.1 g / L calcium chloride, 0.6 g / L potassium sulfate, 1 g / L potassium dihydrogen phosphate, 20 g / L monosodium glutamate, 0.1% trace minerals (i.e., 3 g / L zinc sulfate heptahydrate, 0.05 g / L cobalt chloride hexahydrate, 5 g / L copper sulfate pentahydrate, 1 g / L nickel sulfate hexahydrate, 10 g / L ferric sulfate heptahydrate, 4 g / L calcium pantothenate, 5 g / L manganese chloride tetrahydrate, 0.04 g / L sodium molybdate dihydrate), 5 mg / L vitamin B6, and vitamin B1. 12 0.5 mg / L.

[0094] Example 1. Constructing the engineered strain AC of Schizochytrium overexpressing the ATP-citrate lyase (ACLY) gene from Apiospora arundinis, the engineered strain FA of Schizochytrium overexpressing the fatty acid transporter (Fat1p) gene from Saccharomyces cerevisiae, and the engineered strain ACF of Schizochytrium overexpressing both the ATP-citrate lyase (ACLY) gene from Apiospora arundinis and the fatty acid transporter (Fat1p) gene from Saccharomyces cerevisiae.

[0095] 1. Cloning ACLY and Fat1p gene fragments

[0096] Based on the sequence information of the ACLY and Fat1p genes, primers P1 and P2 as shown in SEQ ID No. 1 and SEQ ID No. 2, and primers P3 and P4 as shown in SEQ ID No. 3 and SEQ ID No. 4, were designed. Using the relevant genome as a template, the ACLY and Fat1p gene fragments were amplified by PCR using primers P1 / P2 or P3 / P4 and PrimerStar high-fidelity polymerase. The PCR program was: 94℃ for 30s, 55℃ for 30s, 70℃ for 20s, for 32 cycles, and the PCR products were purified.

[0097] SEQ ID No.1 P1(sense):ATGCCCACTCCTCTGCCCAAG

[0098] SEQ ID No.2 P2(antisense):CTAACCCTGGAACTCCTGAAC

[0099] SEQ ID No.3 P3(sense):ATGTCTCCCATACAGGTTGTT

[0100] SEQ ID No.4 P4(antisense):TAATTTAATTGTTTGTGCATC

[0101] 2. Amplification of the homologous arms of the FACLY and Fat1p genes

[0102] Homologous arm sequences (SEQ ID No. 5 P5, SEQ ID No. 6 P6, SEQ ID No. 7 P7, SEQ ID No. 8 P8) were designed for the ACLY and Fat1p genes and added to both ends of the ACLY and Fat1p genes by PCR, followed by gel recovery.

[0103] Table 1 PCR methods

[0104]

[0105] Table 2 PCR Mixture Formulation

[0106]

[0107] The primer sequences are shown below:

[0108] SEQ ID No. 5 P5(sense):

[0109] TGCAGCACTCGCTCGCGCATAAATGCCCACTCCTCTGCCCAAG

[0110] SEQ ID No. 6 P6 (antisense):

[0111] GACTGGATCTTGAGATACATAACTAACCCTGGAACTCCTGAAC

[0112] SEQ ID No.7 P7(sense):

[0113] TTATGTATCTCAAGATCCAGTCATGTCTCCCATACAGGTTGTT

[0114] SEQ ID No. 8 P8 (antisense):

[0115] TTTTTGTGGAGATGGGGTTTTTAATTTAATTGTTTGTGCATC

[0116] 3. Connection reaction

[0117] The digested vector pBS-Zeo fragment was ligated with the ACLY and Fat1p gene fragments using Gibson assembly to obtain the recombinant overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p, and pBS-Zeo-ACLY-Fat1p. The ligation system (25 μL) consisted of: 2 μL target gene fragment, 1 μL digested vector fragment, 2.5 μL ligase buffer, and 19.5 μL ddH2O. Ligation was carried out at 50°C for 2 h.

[0118] 4. The ligation product was transformed into E. coli DH5α competent cells. The transformation method is as follows:

[0119] (1) Under sterile conditions, take 100 μL of competent cells, add the ligation product, mix well, and place on ice for 30 min.

[0120] (2) Heat shock at 42℃ for 90s, then quickly place on ice for 2min.

[0121] (3) Add 900 μL of LB medium and incubate at 37°C and 180 r / min for 1 h.

[0122] (4) Spread 200 μL onto an LB plate containing 100 μg / mL Zeo resistance. Incubate inverted at 37°C overnight. Select positive transformants, extract plasmids, and sequence verification results show that the ligation was successful, obtaining overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p, and pBS-Zeo-ACLY-Fat1p.

[0123] 5. The overexpression vector was transferred into Schizochytrium to construct Schizochytrium AC, FA and ACF engineered strains.

[0124] 5.1 Preparation of Schizochytrium competent cells

[0125] (1) Pick a single colony of activated Schizochytrium sp. HX-308 from the plate and transfer it to 50 mL of seed culture medium. Incubate at 28 °C and 170 r / min for 24 h.

[0126] (2) Transfer 5% of the inoculum to 50 mL of seed culture medium and culture at 28 °C and 170 r / min for 24 h.

[0127] (3) Repeat step (2).

[0128] (4) Take 25 mL of bacterial culture, centrifuge at 4000 rpm for 2 min at room temperature, and discard the supernatant.

[0129] (5) Resuspend the cells in 25 mL of pretreatment solution (20 mM DTT and 0.1 M CaCl2 dissolved in pH 6.5 Tris-HCl buffer) and gently shake to loosen the cell walls.

[0130] (6) After centrifugation, wash the bacterial cells twice with 25 mL of pre-cooled sterile water. The centrifugation conditions were 4000 rpm and 4℃ for 2 min.

[0131] (7) Wash the cells twice with 1M sterile pre-cooled sorbitol solution (containing 0.1M CaCl2), and centrifuge at 4000 rpm and 4℃ for 2 min.

[0132] (8) Resuspend the bacterial cells in 200 μL of 1M sterile pre-cooled sorbitol solution (containing 0.1M CaCl2), dispense 100 μL into 1.5 mL sterile centrifuge tubes, and keep on ice for later use.

[0133] 5.2 Electroconversion of Schizochytrium

[0134] (1) Add 10 μL of linearized recombinant overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p and pBS-Zeo-ACLY-Fat1p to 100 μL of Schizochytrium competent cells, mix well and transfer to a pre-cooled electroporation vessel, and incubate on ice for 30 min.

[0135] (2) Electric shock, 2KV, one pulse.

[0136] (3) Immediately add 1 mL of pre-cooled seed culture medium containing 1 M sorbitol to the electric transfer cup, mix well, and then transfer to seed culture medium containing 1 M sorbitol.

[0137] (4) Incubate at 28℃ and 180rpm for 2-3 hours.

[0138] (5) Take an appropriate amount of bacterial solution, spread it on a plate, and incubate at 28°C for 2 to 4 days.

[0139] 5.3 Screening and identification of Schizochytrium genetically engineered strains expressing recombinant overexpression vectors pBS-Zeo-ACLY, pBS-Zeo-Fat1p, and pBS-Zeo-ACLY-Fat1p genes

[0140] (1) Pick a plate colony and inoculate it into a seed culture medium containing 50 mg / L bleomycin. Incubate at 28°C and 180 rpm for 24 h.

[0141] (2) Passage five times to ensure stable inheritance of the overexpression vector, and repeat the experiment described in step (1) in each generation.

[0142] (3) The stable genetic strains were the strains of Schizochytrium AC, FA and ACF overexpressing pBS-Zeo-ACLY, pBS-Zeo-Fat1p and pBS-Zeo-ACLY-Fat1p, and were stored at -80℃.

[0143] A schematic diagram of the overexpression plasmid is shown below. Figure 1 As shown.

[0144] Example 2. Scale-up test of Schizochytrium fermentation tank

[0145] 1. The specific fermentation steps for Schizochytrium HX-308 and engineered strains AC, FA, and ACF are as follows:

[0146] (1) Streak the culture plate of Schizochytrium from the cryopreservation tube, incubate at 28°C for 72 hours and then pick a single colony;

[0147] (2) Inoculate a single colony in a test tube (1st generation) (5 mL of seed culture medium, without adjusting pH), and incubate at 28℃ and 230 rpm for 48 h;

[0148] (3) 1% inoculum was inoculated into a 250mL baffled shake flask (50mL seed culture medium, pH not adjusted), and cultured at 28℃ and 170rpm for 24h (2 generations in shake flask). If OD600>3 at 24h and no bacterial contamination was observed under a microscope, the virus could be transmitted to the next generation;

[0149] (4) 1% inoculum was inoculated into a 1000mL baffle shake flask (200mL seed culture medium, pH not adjusted), and cultured at 28℃ and 170rpm for 24h (3 generations of shake flasks). If OD600>5 and no bacteria were found under microscopic examination after 24h, it can be transmitted to the next generation.

[0150] (5) 2% inoculum was inoculated into a 50L seed tank (total 40L seed culture medium), and cultured at 28℃, 150rpm, 20L / min for 24h (one generation in the tank). If OD600>8 and no bacteria were found under microscopic examination after 20h, it can be transmitted to the next generation.

[0151] (6) 2% inoculum was inoculated into a 5000L fermenter (total 2000L fermentation broth), at 28℃, 100rpm, and 15m. 3 Fermentation begins at / h, with speed control set at a maximum of 300 rpm and aeration set at 15m. 3 / h remains unchanged.

[0152] (7) Detection of glucose and monosodium glutamate: 1 mL of fermentation broth was taken every 12 hours, centrifuged at 12,000 rpm, and the supernatant was serially diluted to 100 times. The diluted solution was centrifuged and detected using a biosensor SBA-40ES. Glucose and monosodium glutamate were measured using different enzyme membranes and calibrated with standard solutions in advance.

[0153] 2. Collect the bacterial cells and extract the oil, including the following steps:

[0154] (1) After fermentation culture is completed, add NaOH solution to adjust the pH to 10-13, then add 0.01-0.2% commercial Schizochytrium cell wall breaking enzyme at a final mass concentration, and shake at 100-200 r / min for 5-15 h at 40-60℃.

[0155] (2) Cool to room temperature and add an equal volume of anhydrous ethanol to the fermentation broth to inactivate the cell-wall breaking enzyme;

[0156] (3) Add n-hexane to extract the oil:

[0157] After extraction, the organic phase was allowed to stand for 5 hours until the upper and lower layers clearly separated. The upper organic phase was then collected. The upper organic phase was removed and placed in a rotary evaporator flask. The organic phase was then evaporated by rotary evaporation at 45°C in a water bath and at 120 r / min. After the organic phase stopped evaporating, the rotary evaporator flask was removed and dried in a 60°C oven until its weight no longer changed. The oil was then weighed to obtain the oil.

[0158] (4) Gas phase detection and analysis of fatty acids, the specific procedure is as follows:

[0159] 20 μL of oil was added to an EP tube containing 1 ml of 1M potassium hydroxide-methanol solution. The mixture was shaken at 20℃ and 1000 r / min for 6 h. The reaction was terminated by adding 50 μL of concentrated sulfuric acid. Then, 1 ml of n-hexane was added, and the mixture was shaken at 20℃ and 1000 r / min for 0.5 h to extract the oil. The extracted phase was transferred to a liquid chromatography vial for gas chromatography analysis. Analysis was performed using a GC-2010 (Shimadzu, Japan) gas chromatography system equipped with a DB-23 capillary column (60 m). A 0.22 mm column and a flame ionization detector (FID) were used. Nitrogen was used as the carrier gas. The injection volume was 1 μL, and the injection temperature was 250 °C. The column temperature was increased from 100 °C to 200 °C at a rate of 25 °C / min, then increased to 230 °C at a rate of 4 °C / min and held for 9 min. The FID detector temperature was 280 °C. Different fatty acid compositions were identified by comparison with Sigma standards (Sigma, USA). The content of individual fatty acids was calculated from the peak area on the chromatogram using non-endogenous fatty acids (C19:0) as internal standards.

[0160] A schematic diagram of the pathway by which Schizochytrium utilizes glucose to accumulate DHA lipids is shown below. Figure 2 As shown. Acetyl-CoA is the substrate for DHA production, but the TCA cycle consumes a large amount of acetyl-CoA, generating carbon dioxide and causing a loss of carbon flux. ATP-citrate lyase (ACLY) can convert citrate, a key intermediate in the TCA cycle, into acetyl-CoA, directing carbon flux towards DHA lipid synthesis. The generated DHA lipids are degraded by lipases in Schizochytrium and then processed through... β Oxidation causes the loss of lipids. However, the fatty acid transporter protein (Fat1p) can transfer the generated DHA lipids from the Schizochytrium cell to the outside, thus protecting the lipids from degradation.

[0161] Oil results as follows Figure 3As shown, after fermentation, the *Schizochytrium* HX-308 strain yielded 48.5 g / L of oil, while the *Schizochytrium* AC strain yielded 55.3 g / L, the *Schizochytrium* FA strain yielded 59.2 g / L, and the *Schizochytrium* ACF strain yielded 69.3 g / L, representing increases of 14.1%, 22.1%, and 42.9% respectively compared to the *Schizochytrium* HX-308 strain.

[0162] Oil yield results as follows Figure 4 As shown, the oil yield of *Schizochytrium* strain HX-308 was 0.188 g / g glucose, while that of *Schizochytrium* strain AC was 0.221 g / g glucose, strain FA was 0.244 g / g glucose, and strain ACF was 0.2312 g / g glucose, representing increases of 17.6%, 29.8%, and 65.9% respectively compared to strain HX-308.

[0163] This is because the *Schizochytrium* HX-308 strain relies on glucose as a carbon source to produce lipids, but only 18.8% of the carbon flux flows to lipid synthesis, while 81.2% is used for the synthesis of other biomass and is lost through respiration via the TCA cycle to generate CO2. In contrast, the *Schizochytrium* AC strain can convert citrate, a key intermediate in the TCA cycle, into acetyl-CoA, directing the carbon flux towards DHA lipid synthesis. Furthermore, the generated DHA lipids are degraded by lipases within the *Schizochytrium* and then... β Oxidation leads to lipid loss. However, the *Schizochytrium* FA strain can transfer the generated DHA lipids from within the *Schizochytrium* cell to outside the cell, thus protecting the lipids from degradation. Most importantly, the *Schizochytrium* ACF strain can not only convert citrate, a key intermediate in the TCA cycle, to acetyl-CoA, but also transfer the generated DHA lipids from within the *Schizochytrium* cell to outside the cell. Therefore, up to 31.2% of the carbon flux of the *Schizochytrium* ACF strain flows to lipid synthesis, while only 68.8% of the carbon flux is used for other biomass synthesis and CO2 loss through respiration.

[0164] Table 3 shows that the DHA content in the oil produced by *Schizochytrium* strain HX-308 was 45.8%, while that of *Schizochytrium* strain AC was 47.4%, strain FA was 48.3%, and strain ACF was 53.2%. Furthermore, the C14:0 and C16:0 contents in the oil produced by *Schizochytrium* strain HX-308 were 11.9% and 20.4%, respectively, while those in *Schizochytrium* strain AC were 9.6% and 19.1%, strain FA was 10.1% and 19.3%, and strain ACF was 8.6% and 17.2%. This indicates that the oils produced by *Schizochytrium* strains AC, FA, and ACF have lower saturated fatty acid content and are of higher quality. Furthermore, the oil produced by the Schizochytrium HX-308 strain contained 0.9% and 16.9% EPA and DPA, respectively, while the oil produced by the Schizochytrium AC strain contained 1.5% and 16.7% EPA and DPA, the oil produced by the Schizochytrium FA strain contained 1.2% and 16.5% EPA and DPA, and the oil produced by the Schizochytrium ACF strain contained 2.1% and 14.2% EPA and DPA, respectively. This indicates that the oil produced by the Schizochytrium ACF strain has a higher EPA content and is of higher quality.

[0165] Table 3. Comparison of fatty acid profiles of Schizochytrium strain HX-308 and strains AC, FA, and ACF.

[0166]

[0167] In fact, the current market price of glucose is around 4,000 yuan per ton. The normal cost of producing 1 ton of DHA oil carbon source using the *Schizochytrium* HX-308 strain is around 21,300 yuan, while the cost using the *Schizochytrium* AC strain is only around 18,100 yuan, the cost using the *Schizochytrium* FA strain is only around 16,400 yuan, and the cost using the *Schizochytrium* ACF strain is only around 12,800 yuan. Using *Schizochytrium* AC, FA, and ACF strains to produce DHA oil reduces carbon source costs by 17.6%, 29.8%, and 65.9% respectively, significantly improving economic efficiency. Furthermore, the oil production capacity using the *Schizochytrium* ACF strain is 69.3 g / L, 42.9% higher than that of the HX-308 strain, and using the *Schizochytrium* ACF strain to produce DHA oil greatly saves time and costs.

[0168] This invention fills a gap in the relevant field by employing a strategy that enhances DHA lipid production from Schizochytrium based on carbon flux guidance and fatty acid transport.

[0169] Most importantly, the Schizochytrium ACF strain can efficiently convert glucose into DHA lipids, which not only saves production costs and time, but also saves a large amount of glucose.

[0170] The relevant sequences are as follows:

[0171] ATP-citrate lyase (ACLY) gene (SEQ ID No. 9):

[0172]

[0173] Fatty acid transporter protein (Fat1p) gene (SEQ ID No. 10):

[0174]

[0175] Although embodiments of the invention have been disclosed for illustrative purposes, those skilled in the art will understand that various substitutions, variations, and modifications are possible without departing from the spirit and scope of the invention and the appended claims. Therefore, the scope of the invention is not limited to the contents disclosed in the embodiments.

Claims

1. A genetically engineered strain of Schizochytrium that enhances DHA lipid production based on carbon flux guidance and fatty acid transport, characterized in that: The genetically engineered strain was obtained by introducing optimized genes encoding ACLY and Fat1p, which are related to guiding carbon flux and fatty acid transport, into Schizochytrium. Among them, the gene sequence of ACLY is SEQ ID No. 9, and the gene sequence of Fat1p is SEQ ID No. 10; The schistocytic fungus is the oil-producing schistocytic fungus HX-308; The method for constructing the genetically engineered strain includes the following steps: The ATP-citrate lyase ACLY gene from Apiospora arundinis and the fatty acid transporter Fat1p gene from Saccharomyces cerevisiae were cloned and inserted into the pBS-Zeo plasmid using homologous recombination technology to construct the overexpression vector pBS-Zeo-ACLY-Fat1p. The overexpression vector pBS-Zeo-ACLY-Fat1p was electroporated into Schizochytrium sp. HX-308 to obtain the genetically engineered strain. The oil produced using the genetically engineered strain has a production capacity of 69.3 g / L, and the DHA content in the oil produced by the Schizochytrium ACF strain is 53.2%.

2. The genetically engineered strain according to claim 1, characterized in that: The specific steps for constructing the method are as follows: (1) Cloning ACLY and Fat1p gene fragments; (2) Amplify the homologous arms of the FACLY and Fat1p genes to obtain gene fragments with homologous arms ACLY and Fat1p; (3) Connecting reaction; The digested vector pBS-Zeo fragment and the gene fragment with homologous arms ACLY and Fat1p obtained in step (2) were ligated using Gibson assembly to obtain the ligation product, namely the recombinant overexpression vector pBS-Zeo-ACLY-Fat1p; (4) The ligation product was transformed into Escherichia coli DH5α competent cells to obtain the overexpression vector pBS-Zeo-ACLY-Fat1p; (5) The overexpression vector pBS-Zeo-ACLY-Fat1p was transferred into Schizochytrium to construct Schizochytrium AC, FA and ACF engineered strains, and the genetically engineered strains were obtained.

3. The application of the genetically engineered strain as described in claim 1 or 2 in enhancing the production of DHA oil from Schizochytrium.

4. A method for producing DHA lipids using the genetically engineered strain as described in claim 1 or 2, characterized in that: The method involves inoculating a genetically engineered strain into a seed culture medium to obtain a primary seed; inoculating the primary seed into a seed culture medium to obtain a secondary seed; inoculating the secondary seed into a seed culture medium to obtain a tertiary seed, which is used as a fermentation strain. After the fermentation strain is inoculated into a fermentation culture medium, DHA lipids are produced through fermentation.

5. The method according to claim 4, characterized in that: Includes the following steps: (1) After culturing the cultured Schizochytrium from the cryopreserved tubes on a plate medium at 28°C for 72 hours, pick a single colony; (2) Single colonies were inoculated into seed culture medium, and cultured at 28°C and 230 rpm for 48 h without adjusting the pH to obtain primary seeds; (3) Primary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170 rpm for 24 h to obtain secondary seeds. OD at 24 h 600 >3. Furthermore, microscopic examination revealed no bacterial contamination, indicating the ability to transmit the virus to the next generation; (4) Secondary seeds were inoculated into seed culture medium at a 1% inoculum, without pH adjustment, and cultured at 28℃ and 170rpm for 24h to obtain tertiary seeds. The OD at 24h was... 600 >5. And microscopic examination showed no bacteria, indicating that it can be transmitted to the next generation; (5) The third-generation seeds were inoculated into seed tanks at an inoculation rate of 2%. The seed tanks were filled with seed culture medium and cultured at 28℃, 150 rpm, and 20 L / min for 24 h to obtain the first generation seeds. The OD of the seed tanks was measured at 20 h. 600 >8. And microscopic examination showed no bacteria, indicating that it can be transmitted to the next generation; (6) The first-generation seed was inoculated into the fermenter at an inoculum rate of 2%. The fermenter was filled with fermentation medium and incubated at 28°C, 100 rpm, and 15 minutes. 3 Fermentation begins at 100 rpm and the rotation speed is gradually increased to 300 rpm. Fermentation is carried out for 48-120 hours.

6. The method according to claim 5, characterized in that: Fermentation time is 48h, 60h, 72h, 84h, 96h or 120h; Alternatively, the plate culture medium has a pH of 6.0–6.5 and comprises: agar 15–20 g / L, glucose 30–60 g / L, yeast extract 8–15 g / L, sodium sulfate 10–15 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 6–12 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 8–12 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, and manganese chloride tetrahydrate 3–5 mg / L. Sodium molybdate dihydrate 0.04 mg / L, Vitamin B6 4-10 mg / L, Vitamin B 12 0.1-1.5 mg / L.

7. The method according to any one of claims 4 to 6, characterized in that: The seed culture medium has a pH of 6.0–6.5 and includes: glucose 40–60 g / L, yeast extract 4–6 g / L, sodium sulfate 5–8 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 4–8 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 8–12 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, manganese chloride tetrahydrate 3–5 mg / L, and sodium molybdate dihydrate 0.04 mg / L. The fermentation medium has a pH of 5.0–6.5 and includes: glucose 60–100 g / L, yeast extract 5–15 g / L, sodium sulfate 5–12 g / L, magnesium sulfate 2–4 g / L, ammonium sulfate 4–8 g / L, potassium chloride 1–2 g / L, calcium chloride 0.1–0.2 g / L, potassium sulfate 0.5–1 g / L, potassium dihydrogen phosphate 0.5–2 g / L, monosodium glutamate 15–20 g / L, zinc sulfate heptahydrate 1–5 mg / L, cobalt chloride hexahydrate 0.01–0.1 mg / L, copper sulfate pentahydrate 2–6 mg / L, nickel sulfate hexahydrate 1–2 mg / L, ferric sulfate heptahydrate 8–15 mg / L, calcium pantothenate 2–4 mg / L, manganese chloride tetrahydrate 3–5 mg / L, sodium molybdate dihydrate 0.04 mg / L, vitamin B6 4–10 mg / L, and vitamin B12. 12 0.1-0.5 mg / L.

Citation Information

Patent Citations

  • Method for producing DHA in schizochytrium limacinum through fermentation of sargassum horneri

    CN120026063A

  • Application of regulatory factor in promoting production of DHA (docosahexaenoic acid) from schizochytrium limacinum, method for improving production of DHA from schizochytrium limacinum and preparation method of microbial oil

    CN120866432A

  • Method for producing EPA and DHA through schizochytrium limacinum fermentation

    CN114561434A

  • Method for producing docosahexaenoic acid by strengthening schizochytrium limacinum

    CN120775934A

  • Fermentation method for enhancing production capacity of schizochytrium limacinum phospholipid DHA and application

    CN120888620A