Transgenic synechocystis strain with enhanced tolerance to various heavy metal ions and application of transgenic synechocystis strain in heavy metal sewage treatment

Abstract

The invention discloses a transgenic synechocystis strain with enhanced tolerance to various heavy metal ions and application of the transgenic synechocystis strain in heavy metal sewage treatment, and belongs to the technical field of sewage treatment. The transgenic synechocystis algal strain is constructed by integrating a superoxide dismutase A (SodA) gene of escherichia coli with a good oxygen stress resistance function into a synechocystis PCC6803 genome. Under the stress condition of heavy metal ions such as Cr < 6 + >, Pb < 2 + > and Cd < 2 + >, the transgenic synechocystis strain shows remarkable heavy metal ion tolerance. Compared with a wild type algal strain, the transgenic synechocystis algal strain has higher activity of superoxide dismutase (SOD) and catalase (CAT), and the content of phycobiliprotein, chlorophyll a and carotenoid is also maintained at a higher level. The invention provides a technical means for application of microalgae in heavy metal sewage treatment and physiological metabolism research.

Description

Technical Field

[0001] This invention relates to a strain of *Synostemma pentaphyllum* modified using synthetic biology transgenic technology, exhibiting enhanced tolerance to multiple heavy metal ions, and also to the application of this *Synostemma pentaphyllum* strain in the treatment of heavy metal wastewater. This invention belongs to the field of wastewater treatment technology. Background Technology

[0002] Synechocystis sp. PCC6803 is a photosynthetic prokaryote capable of both autotrophic and heterotrophic growth. Its rapid growth and ease of manipulation make it an ideal recipient for cyanobacterial genetic engineering. Recent research on cyanobacteria has shifted from gene expression to genome editing, metabolic regulation, and synthetic biology. Further development of cyanobacterial strains through multi-dimensional data analysis in bioinformatics and genomics will construct a powerful genetic engineering platform, leading to strains with higher growth rates, better carbon fixation capabilities, more high-value compounds, and improved carbon dioxide weather resistance and heat tolerance. This will promote their applications in environmental remediation and synthetic biology.

[0003] Synthetic biology is a newly emerging interdisciplinary field in the 21st century. Based on the theoretical knowledge of traditional biology and the ideas of systems biology, it uses engineering and computer science to design new life forms, biological pathways, or deeply modify existing biological systems from the bottom up. Synthetic biology represents the third biotechnology revolution after the discovery of the DNA double helix structure and genome technology. Utilizing synthetic biology technologies, it is possible to modify the genetics and metabolic pathways of microbial cells, making it possible to construct chassis cells with superior traits, and further providing an ideal platform for improving the production performance of industrial microorganisms.

[0004] Over the past decade, research and development in cyanobacterial synthetic biology have progressed rapidly and matured, finding applications in wastewater treatment, biosynthesis, and agriculture. Synechocystis polycystis (PCC6803) holds broad promise for synthetic biology applications. In its long evolutionary process, PCC6803 has evolved various regulatory mechanisms to adapt to constantly changing environments, with cells initiating different metabolic regulation mechanisms to cope with varying stress conditions. Strengthening the development and optimization of the cyanobacterial synthetic biology toolkit, and selecting and improving cyanobacteria with superior chassis performance, is crucial for production and application, and significantly promotes the development of cyanobacterial photocatalytic carbon fixation synthesis technology. Cyanobacteria face diverse environmental stresses in environmental remediation, biosynthesis, and agriculture; therefore, improving their stress resistance is essential for their application.

[0005] Microalgae hold immense potential for developing sustainable technologies to remove inorganic and organic pollutants from the environment. This potential is attributed to various mechanisms, such as biosorption, bioaccumulation, and biodegradation, involving different functional groups, proteins, and peptides responsible for the binding and detoxification of pollutants.

[0006] Heavy metal pollution in wastewater has become a major aspect of heavy metal pollution. In recent years, the application of biosorption technology in the treatment of heavy metal-polluted water has attracted widespread attention from researchers. Biosorption refers to the non-specific binding of heavy metal ions to cell surfaces or extracellular proteins or polysaccharides. Among these microorganisms, algae have unique advantages such as high affinity, numerous binding sites, and large surface area, enabling them to efficiently adsorb heavy metals. Utilizing microalgae for the bioremediation of heavy metals has become a research hotspot in recent years. For example, fungal-algae symbiotic systems (FASS) are often used to assist in immobilizing algae and enhance the adsorption of heavy metals. When adsorbing heavy metal ions, algae are often subject to the toxic effects of heavy metals. By modifying microalgae, using synthetic biology and omics to create engineered microalgae species with stronger tolerance to toxic pollutants, it is beneficial for environmental purification. Compared with wild-type microalgae species, they have a higher rate of pollutant absorption or transformation, which can further expand the application of microalgae in wastewater treatment.

[0007] Superoxide dismutase (SOD) is an important class of metallo-oxidizing enzymes in organisms. Its main function is to dismutate superoxide anion free radicals into hydrogen peroxide, which is then further broken down into harmless water molecules by catalase and other related enzymes. Through this mechanism, SOD can effectively scavenge excess free radicals in the body, mitigate damage caused by reactive oxygen species, and thus achieve cell protection. In prokaryotes, superoxide dismutase A (SodA) is mainly located in the cytoplasm, while in eukaryotes it is distributed in the mitochondrial matrix—the main site of reactive oxygen species (ROS) generation. Compared with other members of the Sod family, its core advantage lies in the fact that SodA plays a crucial role in ROS scavenging in aerobic organisms and dismutates superoxide anions (O2) into hydrogen peroxide. 2 SOD is converted into hydrogen peroxide (H2O2), which can be further broken down into water by catalase, thereby alleviating the damage of oxidative stress to cells. Studies have shown that SodA maintains cellular redox balance by regulating the generation of ROS related to oxidative phosphorylation in mitochondria. Deletion of the sodA gene leads to increased oxidative stress, shortened lifespan, and various aging-related symptoms. Therefore, SodA is not only an important enzyme for maintaining the dynamic balance of intracellular reactive oxygen species, but also provides a new perspective for the prevention and treatment of oxidative stress-related diseases. SOD helps cells respond to adverse environmental effects such as oxygen stress and heavy metal ion stress, improving the adaptability and survival of organisms, and holds promise as a functional element for chassis cell modification.

[0008] Therefore, this invention obtained a strain of Synechocystis PCC6803 with enhanced tolerance to multiple heavy metal ions by inserting the exogenous gene SodA into the genome of Synechocystis PCC6803, providing an effective technical means for constructing transgenic Synechocystis PCC6803 with strong stress resistance and for wastewater treatment. Summary of the Invention

[0009] One of the objectives of this invention is to provide a transgenic Synechocystis algae strain with enhanced tolerance to multiple heavy metal ions.

[0010] The second objective of this invention is to provide the application of the transgenic Synechocystis strain with enhanced tolerance to multiple heavy metal ions in the treatment of heavy metal wastewater.

[0011] To achieve the above objectives, the present invention employs the following technical means:

[0012] This invention constructs a SodA transgenic *Syntrophus synergists* PCC6803 by integrating the *E. coli* superoxide dismutase A (SodA) gene into the genome of *Syntrophus synergists* PCC6803. Growth curves of the newly constructed SodA transgenic *Syntrophus synergists* PCC6803 and wild-type *Syntrophus synergists* PCC6803 were measured to determine their growth differences. Simultaneously, Cr... 6+ Pb 2+ and Cd 2+ Physiological indicators such as chlorophyll content were measured in wild-type and SodA transgenic *Syntrophus cytokines* PCC6803 under metal ion stress to verify the differences in stress resistance before and after modification. The results showed that inserting the functional element gene SodA into the genome of *Syntrophus cytokines* PCC6803 effectively improved the algal strain's tolerance to multiple heavy metal ions. Under normal culture conditions, there was no difference in growth between wild-type and SodA transgenic *Syntrophus cytokines* PCC6803 strains; however, under Cr... 6+ Pb 2+ and Cd 2 + When cultured under metal ion stress, the SodA transgenic Synechocystis PCC6803 showed better tolerance and better growth than the wild-type algae. At the same time, the content of various growth-related photosynthetic pigments and proteins in the SodA transgenic Synechocystis PCC6803 was higher than that in the wild-type algae.

[0013] Based on the above research, this invention proposes the application of the Escherichia coli superoxide dismutase A gene (SodA) in enhancing the tolerance of Synechocystis PCC6803 to multiple heavy metal ions.

[0014] Preferably, the multiple heavy metal ions include Cr 6+ Pb2+ and Cd 2+ .

[0015] Preferably, the Escherichia coli superoxide dismutase A gene is inserted into the genome of Synechocystis PCC6803, thereby improving the tolerance of Synechocystis PCC6803 to multiple heavy metal ions.

[0016] Preferably, the nucleotide sequence of the *Escherichia coli* superoxide dismutase A gene is shown in SEQ ID NO: 1.

[0017] Preferably, the superoxide dismutase A gene of *Escherichia coli* is regulated by the promoter PpsbA2.

[0018] Furthermore, the present invention also proposes a transgenic Synechocystis PCC6803 with enhanced tolerance to multiple heavy metal ions. The genome of the transgenic Synechocystis PCC6803 contains an Escherichia coli superoxide dismutase A gene, and the nucleotide sequence of the superoxide dismutase gene is shown in SEQ ID NO: 1.

[0019] Preferably, the transgenic Synechocystis PCC6803 is obtained by inserting a recombinant fragment containing, in sequence, an upstream homologous arm, a promoter PpsbA2, a SodA gene, a Kan resistance gene, and a downstream homologous arm into the genome of Synechocystis PCC6803 through homologous recombination.

[0020] Preferably, the nucleotide sequence of the recombinant fragment comprising the upstream homologous arm, the promoter PpsbA2, the SodA gene, the Kana resistance gene, and the downstream homologous arm is shown in SEQ ID NO: 2.

[0021] Furthermore, this invention also proposes a method for constructing the aforementioned transgenic Synthocodile PCC6803, comprising the following steps:

[0022] (I) Construction of pMD19T-SodA recombinant plasmid:

[0023] Using the genome of Synechocystis PCC6803 as a template, the upstream homologous arm up and the downstream homologous arm down fragment were amplified using primer pairs up-F / up-R and down-F / down-R, respectively.

[0024] Using plasmid pET-28a as a template, the Kan resistance fragment was amplified using primer pair Kan-F / Kan-R. Using the genome of Synechocystis PCC6803 as a template, the promoter ppsbA2 fragment was amplified using primer pair Ppsb-F / Ppsb-R. Then, using primer pair up-F / down-R with a mixture of fragments up, ppsbA2, kan, and down in equal proportions as a template, overlap PCR was performed to amplify the up-ppsbA-kan-down fragment. This fragment was then ligated to the pMD19T vector using T4 ligase and transformed into E. coli TG1. Finally, PCR detection and verification were performed using primer pair up-F / down-R, and the correctly constructed plasmid was named pMD19T-ppabA-kan.

[0025] Using Escherichia coli as a template, the SodA fragment was amplified using primer pair SodA-F / SodA-R. The plasmid pMD19T-ppabA-kan and the SodA fragment were digested with restriction endonucleases BglII and SpeI, respectively, and then recovered. They were then ligated and transformed into Escherichia coli TG1. PCR detection was performed using primer Ppsb-F / SodA-R, and the correctly constructed plasmid was named pMD19T-SodA.

[0026] The primer sequences described above are shown below:

[0027] up-F:TTGGGTAGCAAGGAAATATCAAC

[0028] up-R: GAACGCTAAAGCCGCATTTAGGGGGCGGAATAAAAC

[0029] Kan-F:GGACTAGTAGTTGGGTAACGCCAGG

[0030] Kan-R: CACTTTATGCTTCCGGCT

[0031] Ppsb-F: TGCGGCTTTAGCGTTC

[0032] Ppsb-R: GGAAGATCTGGTTATAATTCCTTATGTATTTGTCGAT

[0033] down-F:AGCCGGAAGCATAAAGTGTTGACCCACTAAAGCTCCG

[0034] down-R:AACTCGGTCAAAATTAGTACCG

[0035] SodA-F:GGAAGATCTAGTGTTCGTTGCAACAAATTGATGA

[0036] SodA-R:GGACTAGTGTTCGTTGCAACAAATTGATAAG

[0037] (II) Obtaining the SodA transgenic Synechocystis PCC6803:

[0038] (1) Preparation of mixed cellulose ester membrane: The mixed cellulose ester membrane was rinsed three times with distilled water, placed in a glass dish and boiled to sterilize it for later use;

[0039] (2) Preparation of algal strain: scrape a small amount of Synechocystis PCC6803 algal strain from BG11 plate and culture it in BG-11 liquid medium. When the algal solution grows to the logarithmic phase, take the algal solution into a centrifuge tube and centrifuge to obtain algal cell precipitate.

[0040] (3) Wash the algal cell precipitate three times with fresh BG-11 liquid medium, and resuspend the algal cells in BG-11 liquid medium;

[0041] (4) Add pMD19T-SodA to the resuspended algal cells, mix well, and incubate at 30°C and 1400 lux for 6-8 hours;

[0042] (5) Lay a treated mixed cellulose ester membrane on a non-resistant BG-11 solid medium, ensuring that there are no air bubbles between the membrane and the plate, and evenly spread the incubated algal cells on the surface of the mixed cellulose ester membrane.

[0043] (6) After 18-24 h of light culture, the membrane was transferred to BG-11 solid medium containing kanamycin for continued light culture;

[0044] (7) After 10-14 days, pick a single algae and streak it on BG-11 solid medium containing kanamycin and continue to culture;

[0045] (8) The single algal colony marked with the line was inoculated into BG-11 liquid medium containing kanamycin and cultured for growth. Its DNA was extracted and PCR was performed using specific primers SodA-F / R. If the SodA gene band was amplified, it indicates that the exogenous target gene was correctly transferred, which is the SodA transgenic Synechocystis PCC6803 obtained by screening.

[0046] Finally, the present invention also proposes the following applications of the transgenic Synechocystis PCC6803:

[0047] (1) Application in heavy metal wastewater treatment;

[0048] (2) Application of model strains in the study of the physiological and metabolic functions of microalgae under heavy metal environment.

[0049] Compared with the prior art, the beneficial effects of the present invention are:

[0050] 1. This invention identifies the functional element SodA, which is available in Synechocystis PCC6803. By inserting the exogenous gene SodA into the genome of Synechocystis PCC6803, the tolerance of Synechocystis PCC6803 to various heavy metal ions can be significantly enhanced. (The text abruptly ends here, likely due to an incomplete sentence or missing information.) 6+ Pb 2+ and Cd 2+ Heavy metal ion stress was investigated by analyzing differences in physiological indicators and stress resistance among different algal strains. Under heavy metal stress, photosynthesis in wild-type (WT) algal strains was significantly inhibited, manifested as reduced content of photosynthetic pigments (chlorophyll a, carotenoids) and phycobiliproteins, leading to growth retardation. In contrast, the SodA transgenic *Synostemma pentaphyllum* PCC6803 of this invention maintained higher levels of photosynthetic pigments and reduced phycobiliprotein loss, thereby better maintaining photosynthetic efficiency, ensuring biomass accumulation, and exhibiting significant growth advantages. Heavy metal stress disrupts the balance between intracellular reactive oxygen species (ROS) generation and scavenging, leading to ROS accumulation and oxidative damage. Expressing superoxide dismutase A (SODA) to scavenge ROS alleviates oxidative damage and effectively enhances overall stress resistance. Under heavy metal stress, the total protein content of the SodA transgenic *Synostemma pentaphyllum* PCC6803 was higher than that of the wild type, and the degree of protein damage was lower, indicating that the expression of exogenous genes helps maintain the stability and integrity of intracellular protein synthesis and mitigates toxic effects. Therefore, the SodA transgenic Synechocystis PCC6803 obtained in this invention can be applied to the treatment of heavy metal wastewater and can achieve good results.

[0051] 2. Using the transgenic Synechocystis PCC6803 proposed in this invention as a platform, we systematically apply synthetic biology technology to develop novel algal species that are "editable, controllable, and scalable". We conduct in-depth research, redesign, and targeted modification of the physiological and metabolic functions of Synechocystis PCC6803, laying the foundation for the research of microalgal synthetic biology. Attached Figure Description

[0052] Figure 1 Construction and identification of transgenic Synechocystis PCC6803 (SodA);

[0053] In the figure: M is the marker; + is the positive control; - is the negative control; 1 and 2 are different transgenic Synechocystis PCC6803 (SodA);

[0054] Figure 2Normal and different concentrations of Pb 2+ Figure showing the growth of wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress culture conditions;

[0055] In the figure: A represents wild-type algal strains at different concentrations of Pb. 2+ Growth curves under stress culture conditions; B represents WT and SodA in Pb-free conditions. 2+ Coercion and Pb 2+ Growth curves under stress culture conditions;

[0056] Figure 3 Normal and different concentrations of Cd 2+ Figure showing the growth of wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress culture conditions;

[0057] In the figure: A represents wild-type algal strains at different concentrations of Cd. 2+ Growth curves under stress culture conditions; B represents WT and SodA in the absence of Cd. 2+ Coercion and Cd 2+ Growth curves under stress culture conditions;

[0058] Figure 4 For normal and different concentrations of Cr 6+ Figure showing the growth of wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress culture conditions;

[0059] In the figure: A represents wild-type algal strains at different concentrations of Cr 6+ Growth curves under stress culture conditions; B represents WT and SodA in Cr-free culture. 6+ Stress and Cr 6+ Growth curves under stress culture conditions;

[0060] Figure 5 For Pb 2+ Graph showing chlorophyll a and carotene content in wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0061] In the figure: A represents the determination of chlorophyll a; B represents the determination of carotenoids.

[0062] Figure 6 For Pb 2+ Physiological parameters of wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0063] In the diagram: A represents Pb. 2+ The total protein (TP) content of the algal strain under stress; B represents Pb. 2+The content of phycobiliproteins (PBP) under stress;

[0064] Figure 7 For Pb 2+ Graphs of reactive oxygen species and other related oxidative physiological indicators in wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0065] In the diagram: A represents Pb. 2+ Stress affects the content of reactive oxygen species (ROS) in algal strains; B represents Pb. 2+ Comparison of superoxide dismutase (SodA) levels in algal strains under stress; C represents Pb². + The content of catalase (CAT) in algal strains under stress;

[0066] Figure 8 For Cd 2+ Graph showing chlorophyll a and carotene content in wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0067] In the figure: A represents the determination of chlorophyll a; B represents the determination of carotenoids.

[0068] Figure 9 For Cd 2+ Physiological parameters of wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0069] In the diagram: A represents Cd 2+ The total protein (TP) content of the algal strain under stress; B represents Cd. 2+ The content of phycobiliproteins (PBP) under stress;

[0070] Figure 10 For Cd 2+ Graphs of reactive oxygen species and other related oxidative physiological indicators in wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0071] In the diagram: A represents Cd 2+ Stress affects the content of reactive oxygen species (ROS) in algal strains; B is Cd 2+ Comparison of superoxide dismutase (Sod) levels in algal strains under stress; C represents Cd. 2+ The content of catalase (CAT) in algal strains under stress.

[0072] Figure 11 For Cr 6+ Graph showing chlorophyll a and carotene content in wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0073] In the figure: A represents the determination of chlorophyll a; B represents the determination of carotenoids.

[0074] Figure 12 For Cr 6+ Physiological parameters of wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0075] In the diagram: A represents Cr 6+ Under stress, the total protein (TP) content of the algal strain; B is Cr 6+ The content of phycobiliproteins (PBP) under stress;

[0076] Figure 13 For Cr 6+ Graphs of reactive oxygen species and other related oxidative physiological indicators in wild-type algae (WT) and transgenic Synechocystis PCC6803 (SodA) under stress;

[0077] In the diagram: A represents Cr 6+ Stress affects the content of reactive oxygen species (ROS) in algal strains; B represents Cr. 6+ Comparison of superoxide dismutase (SodA) levels in algal strains under stress; C represents Cr. 6+ The content of catalase (CAT) in algal strains under stress. Detailed Implementation

[0078] The present invention will be further illustrated below through embodiments, the purpose of which is only to better understand the research content of the present invention and not to limit the scope of protection of the present invention. Unless otherwise specified, the following embodiments are all conventional experimental methods and operating procedures in the art.

[0079] The main sources of experimental materials are as follows:

[0080] The Synechocystis sp. PCC6803 used in this study was purchased from the Freshwater Algae Culture Collection of the Chinese Academy of Sciences.

[0081] Escherichia coli TG1, used for DNA cloning and plasmid construction, was purchased from Beijing Solarbio Science & Technology Co., Ltd.

[0082] pMD19T plasmid was purchased from TAKARA Biotechnology (Beijing) Co., Ltd.

[0083] Restriction endonucleases were all purchased from TaKaRa Biotechnology (Beijing) Co., Ltd.

[0084] The Universal DNA Purification and Recovery Kit (DP210), Plasmid Mini-Prep Kit (DP103), and Bacterial Genomic DNA Extraction Kit (DP302) were all purchased from Tiangen Biotech (Beijing) Co., Ltd.

[0085] The DNA ligation kit (AG11801) was purchased from Hunan Aikerui Biotechnology Co., Ltd.

[0086] The total SOD activity assay kit (S0109), reactive oxygen species assay kit (S0033S), and lipid oxidation (MDA) assay kit (S0131S) were all purchased from Beyotime Biotechnology Co., Ltd.

[0087] The catalase (CAT) activity assay kit (D799598-0100) was purchased from Sangon Biotech (Shanghai) Co., Ltd.

[0088] The cyanobacteria BG-11 freshwater liquid medium (hereinafter referred to as "BG-11 liquid medium") was purchased from Sigma-Aldrich (Shanghai) Trading Co., Ltd., product number C3061. Adding an appropriate amount of agar (e.g., 15-20 g / L) to the BG-11 liquid medium yields the BG-11 solid medium.

[0089] Example 1: Construction of SodA transgenic Synechocystis PCC6803

[0090] 1. Method

[0091] (I) Construction of pMD19T-SodA recombinant plasmid:

[0092] Using the genome (GCF_000009725.1) of *Synechocystis* sp. PCC6803 as a template, upstream homologous arm "up" and downstream homologous arm "down" fragments were amplified using primer pairs up-F / up-R and down-F / down-R, respectively. Using the antibiotic plasmid pET-28a as a template, the Kan antibiotic fragment was amplified using primer pairs Kan-F / Kan-R. Using the *Synechocystis* PCC6803 genome as a template, the promoter ppsbA2 fragment was amplified using primer pairs Ppsb-F / Ppsb-R. Subsequently, overlapping PCR was performed using primer pairs up-F / down-R with a mixture of fragments up, ppsbA2, kan, and down in equal proportions as a template to amplify the up-ppsbA-kan-down fragment (sequence shown in SEQ ID NO.2). This fragment was then ligated to the pMD19T vector using T4 ligase and transformed into *E. coli* TG1. PCR verification was performed using primers up-F / down-R. After identifying the correct strain, the plasmid was extracted and named pMD19T-ppabA-kan. Using *E. coli* BL21(DE3) as a template, the SodA fragment was amplified using primer pair SodA-F / SodA-R. The pMD19T-ppabA-kan plasmid and the SodA fragment were digested with restriction endonucleases BglII and SpeI, recovered, and then ligated into *E. coli* TG1. PCR verification was performed using primers SodA-F / SodA-R. After identifying the correct strain, the plasmid was extracted and sequenced, and the correctly constructed plasmid was named pMD19T-SodA. The nucleotide sequence of the SodA gene is shown in SEQ ID NO.1. Primer sequences are shown in Table 1.

[0093] Table 1 Primer sequences

[0094]

[0095] The PCR amplification system is as follows:

[0096] 2×ApeMix 25 µL, template DNA 2 µL, primer F 2 µL, primer R 2 µL, ddH2O 19 µL, total 50 µL;

[0097] The PCR amplification procedure is as follows:

[0098] Pre-denaturation at 95℃ for 5 min, denaturation at 95℃ for 30 s, annealing at 50℃ for 30 s, extension at 72℃ for 1 min, 31 cycles, and final extension at 72℃ for 10 min.

[0099] (II) Obtaining the SodA transgenic Synechocystis PCC6803:

[0100] (1) Preparation of mixed cellulose ester membrane: The mixed cellulose ester membrane was rinsed three times with distilled water, placed in a glass dish and boiled for 5 minutes, and then sterilized for use.

[0101] (2) Preparation of algal strain: A small amount of *Synthia suspensa* PCC6803 algal strain was scraped from a BG11 plate and cultured in BG-11 liquid medium until the algal solution reached the logarithmic growth phase (OD2). 730 When the algal concentration is 0.6-0.8, take 10 mL of algal solution into a 15 mL centrifuge tube, centrifuge at 1800g for 5 min.

[0102] (3) Wash the algal cell precipitate three times with fresh BG-11 liquid medium and resuspend the algal cells in 400 µL of BG-11 liquid medium.

[0103] (4) Add plasmid pMD19T-SodA to the resuspended algal cells, mix well, and incubate at 30°C and 1400 lux for 6-8 h.

[0104] (5) Place a treated mixed cellulose ester membrane on the non-resistant BG-11 solid medium, ensuring that there are no air bubbles between the membrane and the plate, and evenly spread 200 µL of incubated algal cells on the surface of the mixed cellulose ester membrane.

[0105] (6) After 18-24 h of light culture, the membrane was transferred to BG-11 solid medium containing 50 μg / mL kanamycin and continued to be cultured under light.

[0106] (7) After 10-14 days, pick a single algae and streak it on BG-11 solid medium containing 50 μg / mL kanamycin and continue to culture.

[0107] (8) The streaked single algal colony was inoculated into BG-11 liquid medium containing kanamycin and cultured for growth. Its DNA was extracted and detected by PCR using specific primers SodA-F / R. Figure 1 The amplification of the SODA gene band in the algal strain indicates that the exogenous target gene was correctly transferred, which is the SodA transgenic Synechocystis PCC6803 obtained through screening.

[0108] Example 2: Wild-type Synechocystis PCC6803 (WT) and SodA transgenic Synechocystis PCC6803 (SodA) in heavy metal ion (Pb) 2+ Cd 2+ Cr 6+ Measurement of growth under stress

[0109] The SodA transgenic Synechocystis PCC6803 (SodA) constructed in Example 1 and the wild-type Synechocystis PCC6803 (WT) were simultaneously inoculated into 10 mL of BG-11 liquid medium and then cultured in a light incubator. OD was measured after 10 days. 730 Value, adjust OD 730 If the values ​​are consistent, transfer them to 10 mL of BG-11 liquid medium, and add Pb at concentrations of 0 mg / L, 2.0 mg / L, 4.0 mg / L, 6.0 mg / L, and 8.0 mg / L, respectively. 2+ , 0 mg / L, 0.6 mg / L, 0.8 mg / L, 1.0 mg / L, 1.2 mg / L Cd 2+ , 0 mg / L, 0.5 mg / L, 1 mg / L, 1.5 mg / L, 2 mg / L Cr 6+ Incubate in a light-controlled shaker, with three replicates per group. Ensure initial OD. 730 Consistent, OD was measured every 24 hours. 730 Value, cultured continuously for 10 days, and plotted the growth curve.

[0110] To determine different concentrations of Pb 2+ The effect on algal growth was investigated by setting different Pb values. 2+ Concentration gradient, with Pb 2+ As the concentration increased, the growth status of all algal strains gradually deteriorated; at 8.0 mg / L Pb 2+ Under these conditions, wild-type algal strains grow slowly. This is due to the 6.0 mg / L Pb concentration. 2+ The treatment caused limited damage to the algal strains and was not lethal; therefore, this concentration was chosen for subsequent index determinations. Figure 2 A).

[0111] Depend on Figure 2 B shows that, at different Pb 2+ Under the influence of concentration, the growth of wild-type algal strains was gradually inhibited, and the degree of inhibition became more significant with increasing concentration. Furthermore, in the absence of Pb... 2+ And Pb 2+ Under stress conditions, compared to the wild-type algal strain, the SodA transgenic Synechocystis PCC6803 showed less growth inhibition and better growth at 6.0 mg / LPb². + After treatment, the growth inhibition rate of wild-type algae was 45.75%, while that of SodA transgenic Synechocystis PCC6803 was 27.20%.

[0112] To determine different concentrations of Cd 2+The effect on algal growth was investigated at concentrations of 0 mg / L, 0.6 mg / L, 0.8 mg / L, 1.0 mg / L, and 1.2 mg / L Cd. 2+ The growth of the algal strain was measured under stress, and Cd was also measured. 2+ Stress significantly inhibited the growth of algal strains, and the degree of inhibition increased with increasing Cd content. 2+ The concentration increases with increasing concentration. Based on experimental data, the median lethal concentration is estimated to be between 0.6 and 0.8 mg / L; therefore, 0.7 mg / L Cd was selected. 2+ Subsequent stress experiments were conducted to measure various physiological indicators. Figure 3 A).

[0113] Depend on Figure 3 A shows that, with Cd 2+ As the concentration increased, the growth of wild-type algal strains gradually deteriorated. Figure 3 B shows that in Cd 2+ Under heavy metal stress, the SodA transgenic *Syntrophus synergae* PCC6803 showed better growth than the wild-type strain, likely because the expression of the exogenous gene SodA helped alleviate ROS accumulation caused by heavy metal ion stress. At 0.7 mg / L Cd 2+ After treatment, the growth inhibition rate of wild-type algae was 40.05%, while that of SodA transgenic Synechocystis PCC6803 was 18.12%.

[0114] To determine different concentrations of Cr 6+ The effect on algal growth was investigated at concentrations of 0 mg / L, 0.5 mg / L, 1 mg / L, 1.5 mg / L, and 2 mg / L Cr. 6+ The growth of the algal strain was measured under stress. Cr 6+ Stress significantly inhibited the growth of algal strains, and the degree of inhibition increased with increasing ion concentration. When Cr 6+ Algal strains even died when the concentration was >1.5 mg / L; due to Cr 6+ The median lethal concentration (LD50) for *Synthia spp.* is approximately 1.0 mg / L, therefore it can be used as a reference for studying the Cr levels in *Synthia spp.* 6+ Treatment concentrations for stress tolerance ( Figure 4 A).

[0115] Depend on Figure 4 A shows that, with Cr 6+ As the concentration increased, the growth of wild-type algal strains gradually deteriorated. Figure 4 B shows that in Cr 6+ Under stress, the SodA transgenic *Syntrophus* PCC6803 showed better growth compared to the wild-type strain. At 1.0 mg / L Cr... 6+After treatment, the growth inhibition rate of wild-type algae was 49.20%, while that of SodA transgenic Synechocystis PCC6803 was 31.66%.

[0116] Example 3: Wild-type Synechocystis PCC6803 (WT) and SodA transgenic Synechocystis PCC6803 (SodA) in heavy metal ion (Pb) 2+ Cd 2+ Cr 6+ Measurement of physiological indicators under stress

[0117] The contents of chlorophyll, carotenoids, total protein (TP), phycobiliprotein (PBP), reactive oxygen species (ROS), superoxide dismutase (SOD), and catalase (CAT) in wild-type algae strains and SodA transgenic Synechocystis PCC6803 were determined respectively.

[0118] 1. At 6 mg / L Pb 2+ Measurement of physiological indicators under stress

[0119] Depend on Figure 5 As shown in A and 5B, measurements of photosynthetic pigment content revealed that the transgenic *Syntrophus synergists* PCC6803 exhibited significantly higher chlorophyll and carotenoid content than the wild type, with inhibition rates of 24.56% and 39.91%, respectively, lower than the wild type (45.08% and 43.05%). This indicates that the Pb... 2+ It is possible that the synthesis of photosynthetic pigments in microalgae can be disrupted by influencing the degradation of photosynthetic pigments through the synthesis of ROS or by increasing the activity of photosynthetic pigment enzymes, thereby affecting the growth of algal strains.

[0120] Depend on Figure 6 A shows that at 6 mg / L Pb 2+ Under stress conditions, the total protein content of the SodA transgenic Synechocystis PCC6803 was significantly higher than that of the wild-type strain. At 6 mg / L Pb... 2+ Under stress, the total protein content of the wild-type algal strain was 0.0772 mg / OD. 730 (36.87% damaged), the total protein content of SodA transgenic Synechocystis PCC6803 was 0.1021 mg / OD. 730 (12.13% damage), significantly lower than the loss rate of wild-type algae. This suggests that the insertion of the exogenous gene SodA has a certain impact on the stress resistance and protein expression of algae.

[0121] Depend on Figure 6 B shows that under normal growth conditions and with 6 mg / L Pb 2+Under stress, the PBP content of SodA transgenic Synechocystis PCC6803 was higher than that of wild-type algae (0.2994 mg) (0.3476 mg). Furthermore, under stress, the damage rate of wild-type algae was 44.70%, which was much higher than that of transgenic Synechocystis PCC6803 (37.69%). This suggests that the wild-type algae suffered greater damage to phycobilisomes, while the transgenic Synechocystis PCC6803 showed stronger resistance to lead stress.

[0122] Depend on Figure 7 A can see that, under the influence of Pb 2+ After stress, the ROS levels in each algal strain changed significantly, and the stress resistance of the algal strains could be assessed by measuring ROS content. At 6 mg / L Pb... 2+ Under stress conditions, the ROS accumulation levels of different algal strains showed significant differences. Compared with the wild-type algal strain, the ROS content of the SodA transgenic Synechocystis PCC6803 was significantly reduced, indicating that its stress resistance was significantly enhanced.

[0123] Depend on Figure 7 B shows that at 6 mg / L Pb 2+ Under stress, significant differences in SOD enzyme activity were observed among different algal strains. The SOD activity of the wild-type algae was 9.83 U / mg prot, while the SOD activity of the SodA transgenic *Syntrophus synergae* PCC6803 was 12.59 U / mg prot, which was 1.28 times that of the wild-type algae. This difference stems from the fact that the accumulation of heavy metal ions in the cell stimulates ROS production, which in turn induces the upregulation of SOD expression. The expression of the exogenous SodA gene promoted the rapid accumulation of heavy metal ions, thereby promoting SOD expression, resulting in higher SOD activity than the wild-type algae.

[0124] Depend on Figure 7 C shows that after 7 days of stress treatment, at 6 mg / L Pb 2+ Under the given conditions, the CAT activity of the transgenic *Syntrophus synergae* PCC6803 was significantly higher than that of the wild-type strain (WT, 262.70 U). The CAT activity of the SodA transgenic *Syntrophus synergae* PCC6803 was 314.82 U / mg, 1.19 times that of the wild-type strain. It is speculated that the insertion of the exogenous gene alleviates metal ion stress by increasing the activity of reactive oxygen species (ROS) proteins; that is, heavy metal ions cause an increase in ROS content, which in turn promotes the expression of superoxide dismutase (SOD). SOD can convert O2 into oxygen... 2- It is disproportionated into hydrogen peroxide; the increase in hydrogen peroxide content leads to an increase in CAT expression, and CAT can remove hydrogen peroxide from the body.

[0125] 2. 0.7 mg / L Cd 2+ Measurement of physiological indicators under stress

[0126] Depend on Figure 8 As can be seen from A and 8B, compared to the SodA transgenic Synechocystis PCC6803, the wild-type algal strain exhibits weaker growth and contains less chlorophyll and carotenoids. The SodA transgenic Synechocystis PCC6803 has a higher content of photosynthetic pigments, and the growth of the algal strain is positively correlated with its photosynthetic pigment content.

[0127] Depend on Figure 9 A shows that at 0.7 mg / L Cd 2+ Under stress conditions, the total protein content of the SodA transgenic Synechocystis PCC6803 was significantly higher than that of the wild-type strain. At 0.7 mg / L Cd... 2+ Under stress, the total protein loss rate of the wild-type algae was 38.18%, while that of the SodA transgenic *Syntrophus synergia* PCC6803 was 18.30%, significantly lower than that of the wild-type algae. This suggests that the insertion of the exogenous gene SodA has a certain impact on the algae's stress resistance and protein expression.

[0128] Depend on Figure 9 B shows that under normal growth conditions and with 0.7 mg / L Cd... 2+ Under stress conditions, the wild-type algal strain had a lower PBP content, while the SodA transgenic Synechocystis PCC6803 had a higher PBP content. Furthermore, under stress conditions, the damage rate of the wild-type algal strain was 60.68%, which was much higher than the 53.45% damage rate of the SodA transgenic Synechocystis PCC6803. This indicates that the wild-type algal strain suffered greater damage to its phycobilisomes, and the PBP content was affected, which corresponds to its growth status.

[0129] Depend on Figure 10 A can see that, under the influence of Cd 2+ After stress, the ROS content of the SodA transgenic *Synostemma pentaphyllum* PCC6803 was significantly reduced compared with the wild-type strain, indicating a significant improvement in its stress resistance. When encountering excessive ROS, *Synostemma pentaphyllum* PCC6803 activates both enzymatic and non-enzymatic protective mechanisms to protect itself from oxidative damage.

[0130] Depend on Figure 10 B shows that there are significant differences in superoxide dismutase (SOD) activity among the algal strains. Under conditions without cadmium ion stress, the SOD activity of the wild-type algal strain is 8.97 U / mg, while the SOD activity of the SodA transgenic *Syntrophus cylindrica* PCC6803 is 10.14 U / mL. 2+Under stress, the SOD activity of the wild-type algae was 22.14 U / mg, while that of the SodA transgenic *Syntrophus synergae* PCC6803 was 27.94 U / mg, which was 1.26 times that of the wild-type algae. Under heavy metal ion stress, intracellular heavy metal ions accumulate, leading to an increase in ROS levels and subsequently inducing increased SOD expression. The expression of the exogenous SodA gene causes a faster accumulation of heavy metal ions in the body, thus promoting SOD expression, resulting in higher SOD activity compared to the wild-type algae.

[0131] Depend on Figure 10 C indicates that, compared to the SodA transgenic Synechocystis PCC6803, the wild-type algal strain exhibits lower CAT activity. (0.7 mg / L Cd) 2+ Under stress conditions, the CAT activity of the wild-type algal strain was 161.19 U / mg, while that of the SodA transgenic *Syntrophus synergae* PCC6803 was 219.42 U / mg, which was 1.36 times that of the wild-type strain. Heavy metal ions increased ROS levels, which in turn promoted SOD expression. SOD can convert O2 into oxygen. 2- It is disproportionated into hydrogen peroxide; the increase in hydrogen peroxide content leads to an increase in CAT expression, and CAT can remove hydrogen peroxide from the body.

[0132] 3. 1.0 mg / L Cr 6+ Measurement of physiological indicators under stress

[0133] Depend on Figure 11 As shown in A and 11B, the carotenoid and chlorophyll contents of SodA transgenic Synechocystis PCC6803 were significantly different from those of the wild type. The chlorophyll damage rate of SodA transgenic Synechocystis PCC6803 was 26.07%, which was lower than that of the wild type (36.23%); the carotenoid damage rate was 11.53%, which was lower than that of the wild type (41.26%).

[0134] This indicates that Cr 6+ It is possible that photosynthetic pigment synthesis in microalgae is disrupted by affecting the degradation of photosynthetic pigments through the synthesis of ROS or the increase of photosynthetic pigment enzyme activity, thereby affecting algal growth. It is speculated that the exogenous gene transformed into the SodA transgenic *Syntrophus cristatus* PCC6803 can mitigate this effect, thus alleviating Cr. 6+ Under growth stress, the SodA transgenic Synechocystis PCC6803 showed improved resistance to chromium ion stress.

[0135] Depend on Figure 12 A shows that at 1.0 mg / L Cr 6+ Under stress, the total protein content of the wild-type algal strain was 0.0714 mg / OD. 730(39.73% damaged), the total protein content of SodA transgenic Synechocystis PCC6803 was 0.1025 mg / OD. 730 (12.58% damage). The total protein TP content of the SodA transgenic Synechocystis PCC6803 was significantly higher than that of the wild-type algae. This suggests that the insertion of exogenous genes has a certain influence on the stress resistance, protein expression, and degree of damage of the algae.

[0136] Depend on Figure 12 B shows that at 1.0 mg / L Cr 6+ The PBP content of WT and SodA transgenic *Syntrophus cytotoxicus* PCC6803 cells grown under stress was measured on day 10. The PBP damage in the wild-type strain was 62.18%, while that in the SodA transgenic *Syntrophus cytotoxicus* PCC6803 was 51.01%, significantly lower than the wild type. This indicates that the phycobilisomes in the SodA transgenic *Syntrophus cytotoxicus* PCC6803 suffered less damage, resulting in a higher PBP content than the wild-type strain, and significantly enhancing the resistance to chromium stress.

[0137] Depend on Figure 13 A shows that in Cr 6+ After 10 days of treatment under stress, at 1.0 mg / L Cr 6+ The ROS content in SodA transgenic Synechocystis PCC6803 cells was measured under stress conditions. The ROS accumulation level of SodA transgenic Synechocystis PCC6803 cells was significantly different from that of the wild type, being 0.39 times higher, indicating a significantly enhanced stress resistance.

[0138] Depend on Figure 13 B shows that the SodA transgenic Synechocystis PCC6803 at 1.0 mg / L Cr 6+ The SOD enzyme activity under stress was measured, and the results showed that the wild-type (WT) algal strain had an SOD activity of 17.81 U / mg prot, while the SodA transgenic *Syntrophus synergae* PCC6803 showed an activity of 21.62 U / mg prot (1.21-fold). This indicates that the expression of the exogenous SodA gene promotes the rapid accumulation of heavy metal ions, and the intracellular accumulation of heavy metal ions stimulates ROS production, thereby inducing the upregulation of SOD expression.

[0139] Depend on Figure 13 C shows that at 1.0 mg / L Cr 6After 10 days of stress treatment, the CAT activity of the SodA transgenic *Synostemma pentaphyllum* PCC6803 was significantly higher than that of the WT (167.49 U), with the SodA transgenic *Synostemma pentaphyllum* PCC6803 showing 240.80 U / mg prot (1.44-fold). This indicates that heavy metal stress regulates the antioxidant system through a ROS-SOD-CAT cascade: heavy metal accumulation → increased ROS → increased SOD expression → hydrogen peroxide accumulation → enhanced CAT activity, forming a complete reactive oxygen species scavenging pathway. Therefore, it is speculated that the insertion of the exogenous SodA gene alleviates metal ion stress by increasing the activity of reactive oxygen species enzymes.

Claims

1. Application of Escherichia coli superoxide dismutase A gene (SodA) in enhancing tolerance of Synechocystis sp PCC6803 to multiple heavy metal ions.

2. Use according to claim 1, wherein The plurality of heavy metal ions includes Cr 6+ , Pb 2+ , and Cd 2+ .

3. Use according to claim 1 or 2, characterized in that, The Escherichia coli superoxide dismutase A gene is inserted into the genome of Synechocystis sp PCC6803, thereby improving the tolerance of Synechocystis sp PCC6803 to multiple heavy metal ions.

4. The use according to claim 1, wherein The nucleotide sequence of the Escherichia coli superoxide dismutase A gene is shown in SEQ ID NO:

1.

5. The use according to claim 1, wherein The Escherichia coli superoxide dismutase A gene is regulated by the promoter PpsbA2.

6. A transgenic Synechocystis sp. PCC 6803 having enhanced tolerance to a plurality of heavy metal ions, characterized in that, The nucleotide sequence of the Escherichia coli superoxide dismutase A gene is shown in SEQ ID NO:

1.

7. The transgenic Synechocystis sp. PCC 6803 according to claim 6, wherein, The transgenic Synechocystis sp PCC6803 is obtained by inserting a recombinant fragment comprising an upstream homologous arm, a promoter PpsbA2, a SodA gene, a Kan resistance gene, and a downstream homologous arm into the genome of Synechocystis sp PCC6803 by homologous recombination.

8. The transgenic Synechocystis sp. PCC 6803 according to claim 6, wherein, The nucleotide sequence of the recombinant fragment comprising an upstream homologous arm, a promoter PpsbA2, a SodA gene, a Kan resistance gene, and a downstream homologous arm is shown in SEQ ID NO:

2.

9. A method of constructing a transgenic Synechocystis sp. PCC 6803 according to any one of claims 6 to 8, characterized in that, The method comprises the following steps: (I) Construction of pMD19T-SodA recombinant plasmid: The upstream homologous arm up and the downstream homologous arm down fragments are amplified using the primer pairs up-F / up-R and down-F / down-R, respectively, with the genome of Synechocystis sp PCC6803 as the template; The Kan resistance fragment is amplified using the primer pair Kan-F / Kan-R with the plasmid pET-28a as the template, and the promoter ppsbA2 fragment is amplified using the primer pair Ppsb-F / Ppsb-R with the genome of Synechocystis sp PCC6803 as the template; then, the up, ppsbA2, kan, and down fragments are mixed in a certain proportion, and an overlap PCR is performed using the primer pair up-F / down-R to amplify the up-ppsbA-kan-down fragment, which is then ligated with the pMD19T vector and transformed into Escherichia coli TG1; then, PCR detection is performed using the primer pair up-F / down-R, and the correctly constructed plasmid is named pMD19T-ppabA-kan; The SodA fragment is amplified using the primer pair SodA-F / SodA-R with Escherichia coli as the template; the plasmid pMD19T-ppabA-kan and the SodA fragment are treated with restriction endonuclease BglII and SpeI, respectively, and then recovered; then, the two are ligated and transformed into Escherichia coli TG1, and PCR detection is performed using the primer pair Ppsb-F / SodA-R, and the correctly constructed plasmid is named pMD19T-SodA; The primer sequences are as follows: ； (II) Obtaining of SodA transgenic Synechocystis sp PCC6803: (1) Preparation of mixed cellulose ester membrane: the mixed cellulose ester membrane was rinsed with distilled water for three times, and then boiled in a glass dish after sterilization for standby; (2) Preparation of algal species: a small amount of Synechocystis PCC6803 algal species was scraped from the BG11 plate and cultured in BG-11 liquid medium. When the algal liquid grew to the logarithmic phase, the algal liquid was centrifuged to obtain algal cell precipitate; (3) The algal cell precipitate was washed with fresh BG-11 liquid medium for three times, and the algal cells were resuspended by adding BG-11 liquid medium; (4) pMD19T-SodA was added to the resuspended algal cells, and after mixing, the mixture was incubated at 30°C, 1400 lux for 6-8 h; (5) A treated mixed cellulose ester membrane was laid on a non-resistant BG-11 solid medium, and the membrane was ensured to be free of air bubbles between the membrane and the plate. The incubated algal cells were evenly coated on the surface of the mixed cellulose ester membrane; (6) After 18-24 h of light culture, the membrane was moved to BG-11 solid medium containing kanamycin for further light culture; (7) After 10-14 d, single algae were picked and streaked on BG-11 solid medium containing kanamycin and continued to be cultured; (8) The streaked single algae were inoculated in BG-11 liquid medium containing kanamycin for culture and growth, and the DNA was extracted. The specific primers SodA-F / R were used for PCR detection. If the SodA gene band was amplified, it indicated that the foreign target gene was correctly transferred, which was the screened SodA transgenic Synechocystis PCC6803.

10. The use of the transgenic Synechocystis PCC6803 according to any one of claims 6-8 in the following aspects: (1) Application in heavy metal wastewater treatment; (2) Application as a model strain in the study of physiological and metabolic functions of microalgae in heavy metal environment.

Images