Multiplex digital PCR (polymerase chain reaction) primer probe group, kit and method for detecting GI type and GII type of norovirus

Abstract

The invention belongs to the technical field of biological detection, and provides a multiplex digital PCR (polymerase chain reaction) primer probe group, a kit and a method for detecting GI type and GII type noroviruses. In order to cope with the current situations that the current digital PCR platform brands are numerous, reagent consumable boxes are incompatible and special kits are deficient, the kit developed by the invention can be used on various digital PCR platforms and shows excellent universality and stability. According to the method, synchronous detection, accurate typing and quantification of the norovirus in samples such as faeces and anal swabs are realized in one hole, high sensitivity, high specificity and good reproducibility are achieved, and an efficient and reliable solution is provided for early diagnosis and large-scale screening of the norovirus.

Description

Technical Field

[0001] This invention belongs to the field of biological detection technology, specifically relating to multiplex digital PCR primer and probe sets, kits, and methods for detecting norovirus GI and GII types. Background Technology

[0002] Norovirus (NV) is one of the most common pathogens causing viral diarrhea. It is a single-stranded positive-sense RNA virus belonging to the family Caliciviridae and the genus Norovirus. Its genome is approximately 7642 nucleotides long and contains three major open reading frames (ORFs): ORF1 encodes a non-structural protein precursor, ORF2 encodes a capsid protein, and ORF3 encodes a small peptide with an unclear function. Based on differences in the RNA polymerase and capsid protein regions, noroviruses can be divided into five gene groups (GI–GV). Of these, the GI, GII, and GIV groups are the main ones capable of infecting humans, with the GII group being the most common pathogenic type causing viral diarrhea in humans worldwide. Norovirus is the leading cause of nonbacterial acute gastroenteritis in children and adults worldwide, exhibiting a significant seasonal epidemic pattern in temperate climates during autumn and winter. This virus is highly contagious and can spread rapidly through the fecal-oral route, aerosols, and contaminated environments, food, or water sources. It frequently causes outbreaks in semi-enclosed settings such as hospitals, nursing homes, and schools, accounting for over 70% of reported outbreaks. The incubation period for norovirus infection is 12 to 48 hours. Typical clinical symptoms include projectile vomiting, non-bloody diarrhea, abdominal cramps, and low-grade fever. Although it often presents as a self-limiting illness in healthy adults (usually not exceeding 48 to 72 hours), infections in infants, the elderly, and immunocompromised individuals are often more severe, with prolonged illness and complications such as dehydration, significantly increasing the risk of hospitalization.

[0003] There are four main methods for detecting norovirus infection: (1) Electron microscopy: Electron microscopy includes direct electron microscopy (EM) and immunoelectron microscopy (IEM). Direct electron microscopy requires at least about 105 to 106 virus particles per milliliter of sample. It has low sensitivity and the detection rate is only 10% to 20% when patients shed large amounts of virus in the early stages. Immunoelectron microscopy uses serum to capture antigens, making the detection rate 10 to 100 times higher than that of direct electron microscopy. Electron microscopy equipment is expensive and has high technical requirements, so it is not suitable for routine detection. (2) ELISA technology: It is used to detect capsid proteins or intact viral particle antigens. It is simple to operate and has low detection cost, but the detection sensitivity is low and the detection limit is 10. 5 ~10 6The number of copies / mL is low, which can easily lead to missed detection in early infections. The detection specificity is poor, and it may bind non-specifically with other viruses, and it is difficult to distinguish between norovirus GI / GII genotypes. (3) Immunogold immunoassay is an important method for rapid on-site detection of norovirus and is widely used in the initial screening of outbreaks. It has the advantages of fast detection speed, simple operation and low cost, but the sensitivity is significantly low and the detection limit is 10. 6 ~10 7 The sensitivity is 50-70%, and the false negative rate is 30-50%. This method has poor specificity, with a false positive rate of 10-20%, and may cross-react with rotavirus, etc. This method is limited to acute phase detection and is ineffective for the recovery phase, and its detection effect is poor in early infection detection. It is a qualitative detection and cannot distinguish between GI / GII genotypes. (4) Nucleic acid detection technology mainly includes conventional PCR, conventional multiplex RT-PCR, multiplex nested PCR, real-time fluorescence quantitative PCR, and gene chips. At present, qRT-PCR is the gold standard for nucleic acid detection, but qRT-PCR is a relatively quantitative method that requires quantification using a standard curve. The accuracy of quantification depends on the quality of the standard and the amplification efficiency. This method is sensitive to PCR inhibitors, and complex sample matrices may affect detection. For low copy number samples, the accuracy decreases when approaching the detection limit. In the detection of norovirus, there is still a lack of an accurate detection method that can be absolutely quantified, especially when it is necessary to detect extremely low viral loads or when extremely high quantitative accuracy is required. Summary of the Invention

[0004] Technical Problem Solved: Currently available norovirus detection kits have low sensitivity and insufficient accuracy, and the same kit is often incompatible with most digital PCR detection platforms. To address these issues, this invention proposes a digital PCR method combined with multiplex detection technology, providing a feasible path for absolute quantification of norovirus. Based on multiplex digital PCR technology, this invention significantly improves detection efficiency by simultaneously adding multiple sets of primers and probes. It can not only detect norovirus in a single well but also differentiate between norovirus GI and GII types.

[0005] In a first aspect, the present invention provides a multiplex digital PCR primer and probe set for detecting norovirus GI and GII types, employing the following technical solution: the multiplex digital PCR primer and probe set for detecting norovirus GI and GII types includes: a norovirus GI type primer and probe set, a norovirus GII type primer and probe set, an extraction quality control phage MS2 primer and probe set, and a human internal reference gene detection primer and probe set; the norovirus GI type primer and probe set includes 11 specific primer pairs and probes, the norovirus GII type primer and probe set includes 16 specific primer pairs and probes; the extraction quality control phage MS2 primer and probe set includes 1 specific primer pair and probe; and the human internal reference gene detection primer and probe set includes 1 specific primer pair and probe. Preferably, the multiplex digital PCR primer and probe set for detecting norovirus GI and GII types includes the following nucleotide sequences: the norovirus GI primer and probe set includes the nucleotide sequences shown in SEQ ID NO.1 to SEQ ID NO.25; the norovirus GII primer and probe set includes the nucleotide sequences shown in SEQ ID NO.26 to SEQ ID NO.51; the human internal reference gene detection primer and probe set includes the nucleotide sequences shown in SEQ ID NO.52 to SEQ ID NO.54; and the extraction quality control phage MS2 primer and probe set includes the nucleotide sequences shown in SEQ ID NO.55 to SEQ ID NO.57.

[0006] SEQ ID NO.1 CGATCTCTTGCCCGATTATGT。SEQ ID NO.2 HEX-CCCAACAAACATGGATGGCACCAG-BHQ1。SEQ ID NO.3 CAGCTGTATTTGCCTCTGGTA。SEQ ID NO.22CGATCTCCTGCCCGATTATGT。SEQ ID NO.23 CAGCTGTGTTTGCCTCTGGAA。SEQ ID NO.24CAGCTGTATTTGCCTCTGGAC。SEQ ID NO.4 CTGGATGCGCTTCCATGATCTG。SEQ ID NO.5 HEX-CCGCGATCTCTTGCCCGATTATGT-BHQ1。SEQ ID NO.6 GGTGCCATCCATGTTTGTTG。SEQ ID NO.25TTCCGCTGGATGCGATTC。SEQ ID NO.7 TTCCGCTGGATGCGGTTC。SEQ ID NO.8 HEX-TTTGAGCTTGTGGACAGGAGACCG-BHQ1。SEQ ID NO.9 GTCCTTAGACGCCATCATCATT。SEQ ID NO.10AAATGATGATGGCGTCTAAGGA。SEQ ID NO.11 HEX-CCCAACAAACATGGATGGCACCAG-BHQ1。SEQ IDNO.12 CCATTGATATAGGYTCAGCTGTATTTG。SEQ ID NO.13 GCCATGTTCCGCTGGAT。SEQ ID NO.14HEX-TTTGAGCTTGTGGACAGGAGACCG-BHQ1。SEQ ID NO.15 CATCATTTACATAATCGGGCARGAG。SEQID NO.16 CGATTCCATGATTTGAGCTTGT。SEQ ID NO.17 HEX-CCGCGATCTCTTGCCCGATTATGT-BHQ1。SEQ ID NO.18 CCACTGGTGCCATCCAT。SEQ ID NO.19 GCCCGATTATGTAAATGATGATGG。SEQID NO.20 HEX-CCCAACAAACATGGATGGCACCAG-BHQ1。SEQ ID NO.21TGGATCCATTGATATAGGTTCAGC。SEQ ID NO.26 TGCCAAGACAGGAACCTATG。SEQ ID NO.27 FAM-ACCTTCGGGAGCAAGATTGCGATC-BHQ1。SEQ ID NO.28 CATTCGACGCCATCTTCATTC 。SEQ IDNO.29 ACCTATGTTCAGATGGATGAGATT。SEQ ID NO.41 ACCAATGTTCAGATGGATGAGATT。SEQ IDNO.30 FAM-TCCCGAAGGTGTGAATGAAGATGGC-BHQ1。SEQ ID NO.31 CTAGATGGAGCAGCGTCATT。SEQ ID NO.42 TTAGATGGAGCAGCGTCATT。SEQ ID NO.32 AGACAGGAACCTATGTTCAGATG。SEQ IDNO.43 AGACAGGAACCCATGTTCAGATG。SEQ ID NO.44 AGACAGGAACCTATGTTCAGGTG。SEQ IDNO.33 FAM-TCCCGAAGGTGTGAATGAAGATGGC-BHQ1。SEQ ID NO.34 CACCATCACTAGATGGAGCAG。SEQ ID NO.45 CACCATCAGTAGATGGAGCGG。SEQ ID NO.35 TTTCTATGTGCCAAGACAGGA。SEQ IDNO.46 TTTCTATGTACCAAGACAGGA。SEQ ID NO.47 TTTCTACGTGCCAAGACAGGA。SEQ ID NO.48ATTTTATGTGCCCAGACAGGA。SEQ ID NO.36 FAM-TTCTCGGATCTCAGTACTTGGGAGGG-BHQ1。SEQ IDNO.37 CACCTTCGGGAGCAAGATT。SEQ ID NO.49 CACCCTCGGGAGCAAGATT。SEQ ID NO.38CAGATGGATGAGATTCTCGGAT。SEQ ID NO.50 CAGGTGGATGAGATTCTCTGAT。SEQ ID NO.39 FAM-TACTTGGGAGGGCGATCGCAATC-BHQ1。SEQ ID NO.40 GCCATCTTCATTCACACCTTC。SEQ ID NO.51GCCATCTTCATTCACACCCTC。SEQ ID NO.52 CCCTGCTATCAAAGACTCCAC。SEQ ID NO. 53 Cy5-TCCAGTGCCCTCAATTTGATGCAA-BHQ3. SEQ ID NO. 54 CACGTCATATGGGCCCTCTTATT. SEQ ID NO.55 GGCCCCAAGGTTAACAACCT. SEQ ID NO. 56 ROX-AGAGCGATAACCAGGCGTTCTAAGGTACA-BHQ2. SEQ ID NO. 57 ATGTCAGACCTTCCTGTCGAT.

[0007] This invention provides a dual-quality control system for detecting norovirus GI and GII using a multiplex digital PCR primer-probe set, in which the quality control phage MS2 is extracted and combined with a human internal reference gene. This invention screens for norovirus GI and GII genome-specific sequences based on intraspecific homology and stability, interspecific specificity, and copy number, selecting gene fragments specific to norovirus GI and GII that are absent or have low homology in other viruses as detection sequences. This invention also incorporates multiple primer-probe sets targeting GI and GII, significantly improving the coverage of GI and GII types. The primer-probe design not only avoids non-specific cross-reactivity between primers and probes but also overcomes the shortcomings of existing single-reaction systems, such as low coverage and time-consuming processes. This primer-probe set can specifically and sensitively amplify norovirus GI and GII types and perform absolute quantification. This detection method is rapid, accurate, highly sensitive, and highly specific. It has high specificity, can distinguish between norovirus and rotavirus, and performs well in the detection of samples with low viral load, with a LOD as low as 2 copies / reaction.

[0008] Primer design requires consideration of factors such as the likelihood of mismatches, amplified fragment length, and reaction temperature. The main genotype of norovirus isolated in China is GII4, accounting for approximately 70%. This invention uses 11 sets of norovirus GI sequences and 16 sets of norovirus GII sequences downloaded from GenBank to design primers and probes from conserved regions of specific gene fragments of norovirus GI and GII types. Preferably, the multiplex digital PCR primer and probe set for detecting norovirus GI and GII types includes a norovirus GI primer and probe set capable of detecting one or more genotypes of GI.1, GI.2, GI.3, GI.5, GI.6, GI.7, GI.8, GI.9, GI.10, GI.12, GI.13, and GI.14; and a norovirus GII primer and probe set capable of detecting one or more genotypes of GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.8, GII.9, GII.12, GII.13, GII.14, GII.16, GII.17, GII.20, and GII.21.

[0009] Secondly, the kit provided by the present invention is used in the preparation of diagnostic agents for assisting in the diagnosis of GI kits and / or GII norovirus infection.

[0010] Thirdly, this invention provides a multiplex digital PCR kit for detecting norovirus GI and GII types, employing the following technical solution: The multiplex digital PCR kit for detecting norovirus GI and GII types includes the aforementioned multiplex digital PCR primer and probe set for detecting norovirus GI and GII types. Primer design for norovirus detection kits needs to consider factors such as the likelihood of mismatches, amplification fragment length, and reaction temperature. The main norovirus genotype isolated in China is GII type 4, accounting for approximately 70%. This invention uses 11 sets of norovirus GI type sequences and 16 sets of norovirus GII type sequences downloaded from GenBank, selecting conserved regions of specific gene fragments for norovirus GI and GII types for primer and probe design.

[0011] A multiplex digital PCR kit for detecting norovirus GI and GII types, specifically, the kit includes: NoroV RT-dPCR primer-probe mixture, NoroV RT-dPCR premix, NoroV RT-dPCR enzyme mixture, DTT or TCEP, negative control, and positive control. Preferably, the multiplex digital PCR kit for detecting norovirus GI and GII types includes the above-mentioned multiplex digital PCR primer-probe set for detecting norovirus GI and GII types. Preferably, in the multiplex digital PCR kit for detecting norovirus GI and GII types, specifically, the NoroV RT-dPCR premix is ​​selected from dNTPs and / or Mg. 2+ The NoroVRT-dPCR enzyme mixture consists of reverse transcriptase and Taq hot-start enzyme; positive controls include norovirus GI plasmid, norovirus GII plasmid, phage MS2 plasmid, and human internal reference gene plasmid; negative controls are enzyme-free water. Preferably, the multiplex digital PCR kit for detecting norovirus GI and GII types can detect one or more of the following GI norovirus genotypes: GI.1, GI.2, GI.3, GI.5, GI.6, GI.7, GI.8, GI.9, GI.10, GI.12, GI.13, and GI.14; wherein the detectable GII norovirus genotypes include one or more of the following GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.8, GII.9, GII.12, GII.13, GII.14, GII.16, GII.17, GII.20, and GII.21.

[0012] Digital PCR is an absolute quantitative nucleic acid detection technique that requires no standard curve and boasts extremely high sensitivity. This invention incorporates multiple primer-probe sets targeting GI and GII, significantly improving the coverage of GI and GII types. The primer-probe design not only avoids non-specific cross-reactivity between primers and probes but also overcomes the shortcomings of existing single-reaction systems, such as low coverage and time-consuming processes. This primer-probe set can specifically and sensitively amplify norovirus GI and GII types and perform absolute quantification. This detection method is rapid, accurate, highly sensitive, and highly specific.

[0013] The sequence numbers of the 11 sets of norovirus GI primer and probe sets are shown in Table 1. The sequence numbers of the 16 sets of norovirus GII primer and probe sets are shown in Table 2. The sequence numbers of the human internal reference gene detection primer and probe sets are shown in Table 3. The sequence numbers of the extraction quality control phage MS2 primer and probe sets are shown in Table 4.

[0014] Table 1

[0015] Table 2

[0016] Table 3

[0017] Table 4

[0018] The multiplex digital PCR primer and probe set for detecting norovirus GI and GII provided in this application, as well as the multiplex digital PCR kit containing it for detecting norovirus GI and GII, employ a dual quality control system with the following advantages: (1) It can eliminate false negative results and improve the reliability of detection. This is the most important value of dual quality control, which can eliminate negative results caused by non-disease reasons from two dimensions. First, it can eliminate false negatives caused by extraction failure. If norovirus is negative, but the quality control phage MS2 is positive, it means that extraction and amplification are successful and the result is true and reliable. If the quality control phage MS2 is also negative, it proves that extraction or amplification has failed and retesting is required. Second, it can eliminate false negatives caused by sampling failure. If norovirus detection is negative, but human internal reference gene is also negative, it means that no effective human cells were collected from the sample. At this time, even if norovirus is negative, a report cannot be issued and resampling is required. (2) It can monitor digital PCR reaction inhibitors and improve detection accuracy. Blood samples often contain digital PCR reaction inhibitors. The copy number of the exogenous nucleic acid extracted from the quality control phage MS2 can reflect the degree of inhibition in the sample. If the copy number of phage MS2 is significantly low or absent, it indicates that digital PCR amplification has been inhibited, and even if norovirus is positive, the quantitative result may be inaccurate. (3) It can verify the stability and batch consistency of the kit. As a fixed internal standard, the copy numbers of phage MS2 and human internal reference genes should usually be kept within a certain range. If the internal control copy number of all samples shows a systematic drift in batch testing, it can indicate that the batch quality of the kit, the calibration status of the instrument, or the laboratory operating conditions have changed, thus ensuring the quality management of the test. The dual quality control system in the multiplex digital PCR kit provided by this invention is a golden combination to ensure that the digital PCR test results are true, reliable, and trustworthy. It effectively prevents false negatives caused by extraction failure, sampling failure, and digital PCR inhibition, and is the basis for high-quality molecular diagnostic reports.

[0019] Beneficial effects:

[0020] 1. Digital PCR can achieve absolute quantification, avoiding the introduction of a standard curve. It accurately reflects the true copy number of norovirus in the patient's body, which helps in disease diagnosis, treatment selection, and monitoring treatment effectiveness. Compared with qPCR technology, it has higher sensitivity and is particularly suitable for detecting extremely low concentration samples.

[0021] 2. Primers and probes designed for the specific conserved sequence of norovirus have higher specificity and avoid cross-reaction with other diarrhea viruses such as rotavirus and enteric adenovirus.

[0022] 3. Multiple sets of primers and probes targeting GI and GII are placed in each well, greatly improving the coverage and detection efficiency of GI and GII types. The reagents are prepared using a lyophilization method, making the kit convenient for transportation and storage, reducing transportation and storage costs. Pre-alication and strip addition simplify the operation steps, making experimental operations simpler and avoiding errors during the aliquoting process.

[0023] 4. The kit provided by this invention adopts a dual quality control system detection method, which improves the accuracy of norovirus detection. This method greatly reduces the requirements for sample extraction. PCR inhibitors that affect ordinary PCR are diluted in digital PCR. Furthermore, the multiplex digital PCR kit provided by this invention is compatible with most digital PCR detection platforms on the market. Attached Figure Description

[0024] Figure 1 This invention provides a two-dimensional scatter plot for the detection of norovirus genotypes GI and GII.

[0025] Figure 2 The present invention provides a two-dimensional scatter plot of the extraction of quality control phage MS2 and detection of human internal reference genes.

[0026] Figure 3 This invention uses Stilla digital PCR to perform one-dimensional result graphs for sample detection. Detailed Implementation

[0027] The technical solution of the present invention will be described in detail below with reference to the embodiments.

[0028] Example 1: One-step detection of norovirus using a nucleic acid detection kit

[0029] This invention develops a multiplex digital PCR kit for detecting norovirus GI and GII types in samples such as feces, sewage, and food. The kit contains a NoroV RT-dPCR primer-probe mixture, a NoroV RT-dPCR premix, a NoroV RT-dPCR enzyme mixture, 0.1M DTT, negative controls, and positive controls. For each sample, the kit's NoroV RT-dPCR primer-probe mixture, NoroV RT-dPCR premix, NoroV RT-dPCR enzyme mixture, and 0.1M DTT are used to generate digital PCR droplets and perform PCR amplification. Specifically, the volume of the NoroV RT-dPCR primer-probe mixture is 3 μL, the NoroV RT-dPCR premix is ​​8 μL, the NoroV RT-dPCR enzyme mixture is 1 μL, the 0.1M DTT is 1 μL, and the RNA sample volume is 7 μL, for a total reaction volume of 20 μL. The reaction system for digital PCR amplification is shown in Table 5:

[0030] Table 5

[0031] The main components of the multiplex digital PCR kit of the present invention are shown in Table 6:

[0032] Table 6

[0033] The multiplex digital PCR kit of this invention incorporates an internal quality control system to monitor sample collection and extraction processes, preventing false negatives. The kit includes negative and positive quality controls to monitor digital PCR amplification and chip reading of the samples. Fluorescence is detected using a microchip reader, and the results are interpreted based on the presence and intensity of fluorescence in each droplet. The specific steps are as follows: Step 1: Release the nucleic acid from the sample to be tested; Step 2: Using the nucleic acid obtained in Step 1 as a template, add NoroV RT-dPCR premix, NoroV RT-dPCR primer-probe mixture, NoroV RT-dPCR enzyme mixture, and 0.1M DT to one well of the microfluidic chip; Step 3: Droplet generation and PCR amplification: Detection is performed using a Dscanner4-1000 microchip reader from Ruixin Biotechnology Co., Ltd. The specific steps are as follows: Add 75 μL of oil-phase-coated reagent and 20 μL of amplification mixture to the oil wells and reagent wells of the digital PCR chip, respectively. After sealing the chip, place it in a PCR amplification instrument to complete droplet generation and PCR amplification. Step 4: Amplification; Perform the amplification according to the amplification procedure in Table 7. Step 5: Signal collection: Using the nucleic acid obtained in Step 4 as a template, after completing reverse transcription and amplification, use the entire chip as the detection object and collect fluorescence signals using a biochip reader. The detection results are interpreted by identifying the presence and intensity of fluorescence signals in each droplet.

[0034] Table 7

[0035] Result interpretation method: Data analysis was performed using genecount software. The specific steps are as follows: 1. Select all detection wells of the target site, and divide the model area according to the fluorescence signal distribution of the positive control through the graphical analysis in the software. Specifically, the operation is performed by clicking on the scatter plot analysis interface presented in the form of a two-dimensional scatter plot. The definitions of each color marker point are as follows: (1) Black point: negative droplet without amplification template; (2) Green point (HEX): positive droplet containing norovirus GI nucleic acid; (3) Blue point (FAM): positive droplet containing norovirus GII nucleic acid; (4) Orange point (ROX): positive droplet containing extraction quality control (phage MS2); (5) Dark red point (Cy5): positive droplet containing human internal reference gene; (6) Red point: droplet containing any two of the above markers. The droplet scatter plot results of digital PCR are as follows Figure 1 and Figure 2As shown in the scatter plot, the droplet clusters are clearly distinguished based on their fluorescence signals: the black droplet cluster in the lower left represents the negative cluster; the blue droplet cluster in the upper left represents the norovirus GII type positive cluster; the green droplet cluster in the lower right represents the norovirus GI type positive cluster; and the red droplet cluster in the upper right represents the GI and GII double positive cluster. In addition, the figure also shows the orange droplet cluster representing the extracted quality control phage MS2, the dark red droplet cluster representing the human internal control gene positivity in the lower right, and the MS2 and human internal control double positive droplet cluster in the upper right. The results are interpreted as shown in Table 8; a detailed explanation of the results is shown in Table 9.

[0036] Table 8

[0037] Table 9

[0038] The detection method provided in this technical solution employs a one-step approach, where the reverse transcription and PCR processes are performed in the same reaction system. Total nucleic acids isolated from fecal samples contain biological interfering agents, such as nucleic acids from intestinal bacteria and those from the test subject. Furthermore, conventional methods and kits are primarily designed to prepare DNA or RNA from small samples (e.g., samples weighing less than 1 gram, such as 50 mg to 200 mg), thus limiting the yield of target nucleic acids from complex samples to extremely low levels. Digital PCR, however, has the ability to enrich and concentrate sample nucleic acids, significantly improving sensitivity compared to qPCR.

[0039] Example 2

[0040] This embodiment compares the primers and probes provided by this invention with a national industry standard method based on existing technology. The standard method is SN / T 5325.4-2020 Digital PCR Method for Quantitative Detection of Foodborne Viruses in Exported Food - Part 1: Norovirus. The primer pairs and probe sequences used in this standard are consistent with those published by Kageyama T et al. in 2003 and adopted by the Japanese Ministry of Health, Labour and Welfare as the official detection standard. The following comparative experiments aim to demonstrate the superiority of the primers and / or probes provided by this invention compared to this industry standard method.

[0041] The primer pairs and probe serial numbers used in the official Japanese testing standards are shown in Table 10:

[0042] Table 10

[0043] China's standard for quantitative detection of foodborne viruses in exported food using digital PCR method, Part 1: Norovirus SN / T 5325.4-2020 (industry standard), is shown in Table 11.

[0044] Table 11

[0045] The primer and probe sequences used in this invention are shown in Tables 1 to 4.

[0046] Compared to industry standards, this method exhibits higher detection sensitivity. In different sample matrices, the detection limits of this method are: 1800 copies / 2g for shellfish digestive glands, and 1800 copies / 100 cm² for hard-surface foods. 2 Raw vegetables and soft fruits: 3600 copies / 25g. The corresponding limits of quantification are: shellfish digestive glands: 3600 copies / 2g; hard-surface foods: 3600 copies / 100cm³. 2 7200 copies / 25g of raw vegetables and soft fruits.

[0047] This embodiment provides primer and probe sequences given by the Japanese invention and industry standards. Bioinformatics comparison revealed that the primer and probe sequences involved in this invention have a higher matching degree with the currently included GI and GII norovirus strains in the database. Experimental data demonstrate the superior performance of the patented method. Higher amplification efficiency means more reliable detection of trace amounts of virus and more stable performance near the critical value. The primer and probe combination used in this embodiment, while maintaining high specificity, may have a wider coverage of virus strains and higher detection sensitivity compared to existing industry standards, providing a superior technical option for the accurate quantification of norovirus in imported and exported food.

[0048] Example 3: Multi-platform compatibility verification

[0049] Digital PCR, a high-precision absolute nucleic acid quantification technique, relies on dividing the reaction system into tens of thousands of independent microreaction units. Based on the different methods of unit formation, it is mainly divided into two categories: chip-based digital PCR and droplet-based digital PCR. These two technical approaches have different characteristics in principle, process, and application, which directly leads to compatibility issues with equipment and reagents. In this invention, the digital PCR reagent system has been optimized, enabling its application on digital PCR systems from different manufacturers. Through optimization of buffer composition, enzyme concentration, stabilizers, and reaction conditions, this embodiment verifies its universality and detection performance on digital PCR systems from different manufacturers and with different technical principles.

[0050] This embodiment includes multiple batches of clinical and environmental samples, specifically: Bio-Rad QX600 platform: 35 samples, including 23 food samples and 12 pathological samples; Stilla Naica platform: 20 samples, including 6 environmental samples and 14 human stool samples; Qiagen QIAcuity platform: 67 samples, including 55 food samples and 12 patient samples; DropDx platform: 67 samples, with some overlap or parallel testing with the Qiagen platform.

[0051] Reagents and Instruments: The reagents used in this embodiment employ the optimized multiplex digital PCR reaction system of this invention, as shown in Table 5, and the specific components are shown in Table 6. Instruments selected include: Bio-Rad QX600 droplet digital PCR system (including droplet generator, PCR amplification instrument, and droplet reader); Stilla Technologies Naica microdroplet chip digital PCR system (including Sapphire chip and Prism3 reader); Qiagen QIAcuity nanoplate digital PCR system; and Ruixin DropDx droplet digital PCR system (including chip reader). The target genes are norovirus GI and GII nucleic acids.

[0052] The specific testing steps are as follows: Prepare multiplex digital PCR reaction systems according to Tables 1 to 5. Specifically, prepare a total reaction volume of 20 μL (or 30 μL, depending on the platform requirements) based on the volumes of each component in Table 5; the primer and probe sets used in this system cover norovirus GI type in Table 1, norovirus GII type in Table 2, extraction quality control phage MS2 in Table 4, and human internal reference gene in Table 3, enabling quadruple simultaneous detection; the specific components and functions of the reagents used in the system are completely consistent with the kit components listed in Table 6; place the prepared system in a digital PCR instrument and amplify according to the program set in Table 7, including reverse transcription, pre-denaturation, 40 cycles of denaturation-annealing / extension, enzyme inactivation, and final cooling steps.

[0053] Testing and detection procedures for each platform:

[0054] Bio-Rad QX600 Platform: A droplet generator is used to generate droplets from a 20 μL reaction system, which are then transferred to PCR tubes. Amplification is performed on a conventional PCR instrument according to the procedure in Table 7. After amplification, the PCR plate is placed in a QX600 droplet reader for fluorescence signal acquisition and analysis (FAM corresponds to GII, HEX / VIC corresponds to GI). Stilla Naica Platform: A 20 μL reaction system is added to a Sapphire chip, and droplet generation and PCR amplification are automatically completed within the Naica system. Three-dimensional fluorescence signal acquisition and result interpretation are then performed using a Prism3 reader. Qiager QIAcuity Platform: A 30 μL reaction system is added to a nanoplatelet and placed in the QIAcuity system for one-click amplification and fluorescence signal reading. Ruixun DropDx Platform: A 20 μL reaction system is added to a dedicated chip and placed in the device for droplet generation and PCR amplification. After amplification, signal collection is performed using a chip reader.

[0055] Data Analysis: All platforms use the same threshold setting and positive droplet / microwell interpretation logic (as described in Example 1) to directly read the absolute concentration of the target nucleic acid (copies / μL).

[0056] Experimental Results: The optimized reaction system performed well on all four test platforms, successfully achieving dual detection of norovirus GI and GII, demonstrating its excellent cross-platform compatibility. Specific test results for each platform are as follows:

[0057] (1) The results of the Bio-Rad digital PCR test are as follows: In this example, a total of 35 samples were tested, of which the first 23 were food samples and the last 12 were pathological samples. The results showed that 10 samples were positive for GI and 1 sample was positive for GII. There was also 1 sample that was positive for both GI and GII. The concentration of GI ranged from 6.67 to 2138 copies / μL. The results of the Bio-Rad digital PCR test are shown in Table 12.

[0058] Table 12

[0059] (2) The results of the Stilla digital PCR test are as follows: In this embodiment, a total of 20 samples were tested, of which the first 6 were environmental samples and 14 were human fecal samples. The results showed that 16 samples were GI positive and 15 samples were GII positive. 13 samples were positive for both GI and GII. The results of the Stilla digital PCR test are shown in Table 13. The one-dimensional result diagram of the sample detection using Stilla digital PCR is shown below. Figure 3 As shown.

[0060] Table 13

[0061] (3) The results of the Qiager digital PCR test are as follows: In this embodiment, a total of 67 samples were tested, of which 55 were food samples and 12 were patient samples. The results showed that 12 samples were positive for GI and 18 samples were positive for GII. There were also 12 samples that were positive for both GI and GII. The quantitative detection results of digital PCR on some food samples are shown in Table 14. The detection results of digital PCR on clinical case samples are shown in Table 15.

[0062] Table 14

[0063] Table 15

[0064] (4) The results of the Ruixun digital PCR equipment test are as follows: In this example, a total of 67 samples were tested, and 32 samples were positive for GI and 13 samples were positive for GII. There were also 11 samples that were positive for both GI and GII. The results of the Suzhou Ruixun digital PCR equipment test are shown in Table 16.

[0065] Table 16

[0066] The results of this embodiment demonstrate that the optimized multiplex digital PCR reaction system of this invention can operate stably and efficiently on four commercial digital PCR systems based on different technical principles, including droplet (Bio-Rad QX600, DropDx), microdroplet chip (Stilla Naica), and nanoplate (QIAcuity) systems, successfully achieving dual absolute quantitative detection of norovirus GI / GII. The detection results on each platform exhibit good sensitivity, specificity, and wide dynamic range, fully demonstrating the excellent cross-platform compatibility and versatility of this optimized reagent system, effectively solving the industry pain point of reagent and consumable incompatibility between different digital PCR systems.

[0067] The above embodiments are merely illustrative of the technical concept of the present invention and should not be construed as limiting the scope of protection of the present invention. Any modifications made to the technical solutions based on the technical concept proposed in this invention shall fall within the scope of protection of this invention.

Claims

1. A multiplex digital PCR primer and probe set for detecting norovirus types GI and GII, characterized in that, include: Norovirus GI primer and probe set, norovirus GII primer and probe set, extraction quality control phage MS2 primer and probe set, and human internal reference gene detection primer and probe set; The norovirus GI primer and probe set includes 11 sets of specific primer pairs and probes; the norovirus GII primer and probe set includes 16 sets of specific primer pairs and probes. The extraction quality control phage MS2 primer and probe set includes a set of specific primer pairs and probes; The human internal reference gene detection primer and probe set includes a set of specific primer pairs and probes.

2. The multiplex digital PCR primer and probe set for detecting norovirus GI and GII types according to claim 1, characterized in that, The nucleotide sequences of the norovirus GI primer and probe set are shown in SEQ ID NO.1 to SEQ ID NO.25; the nucleotide sequences of the norovirus GII primer and probe set are shown in SEQ ID NO.26 to SEQ ID NO.51; the nucleotide sequences of the human internal reference gene detection primer and probe set are shown in SEQ ID NO.52 to SEQ ID NO.54; and the nucleotide sequences of the extraction quality control phage MS2 primer and probe set are shown in SEQ ID NO.55 to SEQ ID NO.

57.

3. The multiplex digital PCR primer and probe set for detecting norovirus types GI and GII according to claim 1, characterized in that, The norovirus GI primer and probe set can detect one or more of the following genotypes: GI.1, GI.2, GI.3, GI.5, GI.6, GI.7, GI.8, GI.9, GI.10, GI.12, GI.13, and GI.

14.

4. The multiplex digital PCR primer and probe set for detecting norovirus types GI and GII according to claim 1, characterized in that, The norovirus GII type primer and probe set can detect one or more of the following genotypes: GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.8, GII.9, GII.12, GII.13, GII.14, GII.16, GII.17, GII.20, and GII.

21.

5. The use of the multiplex digital PCR primer and probe set for detecting norovirus GI and GII types as described in any one of claims 1 to 4 in the preparation of auxiliary diagnostic agents for norovirus GI and / or GII type infection.

6. A multiplex digital PCR kit for detecting norovirus types GI and GII, characterized in that, The kit includes NoroV RT-dPCR primer-probe mixture, NoroV RT-dPCR premix, NoroV RT-dPCR enzyme mixture, DTT or TCEP, negative control and positive control.

7. The multiplex digital PCR kit for detecting norovirus GI and GII types according to claim 6, characterized in that, The NoroV RT-dPCR primer-probe mixture consists of the multiplex digital PCR primer-probe set for detecting norovirus GI and GII types as described in any one of claims 1 to 4.

8. The multiplex digital PCR kit for detecting norovirus GI and GII types according to claim 7, characterized in that, The NoroV RT-dPCR premix is ​​selected from dNTPs and / or Mg. 2+ The NoroV RT-dPCR enzyme mixture consists of reverse transcriptase and Taq hot-start enzyme; the positive control includes norovirus GI plasmid, norovirus GII plasmid, bacteriophage MS2 plasmid, and human internal reference gene plasmid; the negative control is enzyme-free water.

9. The multiplex digital PCR kit for detecting norovirus GI and GII types according to claim 6, characterized in that, The kit can detect one or more of the following norovirus GI genotypes: GI.1, GI.2, GI.3, GI.5, GI.6, GI.7, GI.8, GI.9, GI.10, GI.12, GI.13, and GI.

14.

10. The multiplex digital PCR kit for detecting norovirus GI and GII types according to claim 6, characterized in that, The kit can detect one or more of the following norovirus GII genotypes: GII.1, GII.2, GII.3, GII.4, GII.5, GII.6, GII.7, GII.8, GII.9, GII.12, GII.13, GII.14, GII.16, GII.17, GII.20, and GII.21.

Images