Nanobodies targeting nkg2a and methods of making and uses thereof

By preparing nanobodies targeting NKG2A, the problems of large molecular weight and limited penetration of monoclonal antibodies have been solved, achieving high affinity and strong blocking effect, enhancing NK cell killing effect, and making it suitable for the treatment of various cancers and autoimmune diseases.

CN121574251BActive Publication Date: 2026-04-24CHENGDU RONGSHENG PHARMA
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202610117514.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2026-01-28
Publication Date
2026-04-24
Estimated Expiration
2046-01-28

Smart Images

  • Figure CN121574251B_ABST
    Figure CN121574251B_ABST
Patent Text Reader

Abstract

The application belongs to the technical field of nanobodies, and particularly relates to a nanobody or antigen binding fragment thereof targeting NKG2A, nucleic acid, recombinant vector, host cell and preparation method and use thereof. The application provides a nanobody which has high affinity with NKG2A protein, can block the combination of HLA-E on the surface of tumor cells and NKG2A on the surface of NK cells, and thus improves the killing effect of NK cells on tumor cells. The nanobody of the application has wide application prospect in the preparation of drugs for preventing and / or treating tumors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of nanobody technology, specifically relating to a nanobody targeting NKG2A or its antigen-binding fragment, nucleic acid, recombinant vector, host cell, preparation method and use thereof. Background Technology

[0002] Immuno-oncology has revolutionized cancer treatment. Therapeutic blocking antibodies that release immunosuppressive "checkpoints" (immune checkpoint inhibitors, ICIs) have achieved unprecedented improvements in tumor control. In particular, therapeutic monoclonal antibodies targeting the PD-1 and PD-L1 axes have been approved for monotherapy or combination therapy in various cancer indications. However, a significant proportion of patients exhibit primary or acquired resistance to ICIs, making it difficult to determine predictive biomarkers for efficacy or recurrence.

[0003] Tumor escape involves the downregulation of anti-inflammatory cytokines TGF-β, IL-6, IL-10, inhibitory metabolic factors, interferon signaling defects, and classical HLA class I molecules. Among these, the loss of HLA class I molecules on tumor cells is a recognized and common phenotype, associated with many tumor types and poor prognosis. Unlike classical HLA molecules, HLA-E protein levels are typically higher in cancer patients than in healthy individuals, such as in lung, kidney, pancreas, stomach, colon, head and neck, liver, melanoma, prostate, and rectal tumor tissues, and in some leukemia patients, and are associated with poor prognosis.

[0004] NKG2A (Natural Killer Group 2 member A), as a novel checkpoint inhibitor, is effective against NK cells and activated CD8 cells. + NKG2A is expressed on T cell subsets and binds to the non-classical molecule HLA-E. Antibodies can block immune checkpoints, and whether used alone or in combination with other checkpoint inhibitors, they can enhance the activity of effector cells (CD-11 cells). 8+ Monalizumab, developed by Innate-Pharma, is a relatively mature and advanced (Phase III clinical trial) monoclonal antibody targeting NKG2A, which has entered clinical trials for the treatment of recurrent or metastatic head and neck squamous cell carcinoma, non-small cell lung cancer, and colorectal cancer. Monalizumab is a humanized anti-NKG2A blocking monoclonal antibody that can increase the killing effect of NKG2A. + NK cells against HLA-E +Monalizumab promotes NK cell effector function by degranulating target cells and producing IFN-γ. Importantly, when used in combination with the anti-PD-L1 monoclonal antibody (durvalumab), it exhibits promotion of NKG2A. + PD-1 + NK cells and CD4 8+ The cumulative effect of T cell effector function. In addition, when used in combination with cetuximab, monolithiasis enhances NK cell-mediated killing.

[0005] However, monoclonal antibodies suffer from drawbacks such as large molecular weight, limited tissue penetration, requirement for mammalian expression, and long half-life. Nanobodies (VHH), with their small molecular weight, high stability, ease of engineering, and rapid preparation using *E. coli*, have shown potential as alternatives in oncology and inflammation. However, high-affinity nanobodies targeting NKG2A are currently lacking.

[0006] Therefore, developing NKG2A nanobodies targeting NKG2A remains a challenge in the field of tumor therapy. Summary of the Invention

[0007] To address the shortcomings of existing technologies, this invention provides a nanobody targeting NKG2A or its antigen-binding fragment, nucleic acid, recombinant vector, host cell, preparation method, and uses thereof.

[0008] The present invention provides a nanobody or antigen-binding fragment thereof targeting NKG2A, which includes a complementarity-determining region; the complementarity-determining region includes CDR1, CDR2 and CDR3;

[0009] The amino acid sequence of CDR1 is shown in SEQ ID NO:1;

[0010] The amino acid sequence of CDR2 is shown in SEQ ID NO:2;

[0011] The amino acid sequence of CDR3 is shown in SEQ ID NO:3.

[0012] Preferably, the nanobody targeting NKG2A further includes a framework region, wherein the complementarity-determining region is separated by the framework region, which includes FR1, FR2, FR3 and FR4;

[0013] The amino acid sequence of FR1 is shown in SEQ ID NO:4;

[0014] The amino acid sequence of FR2 is shown in SEQ ID NO:5;

[0015] The amino acid sequence of FR3 is shown in SEQ ID NO:6;

[0016] The amino acid sequence of FR4 is shown in SEQ ID NO:7.

[0017] Preferably, its amino acid sequence is shown in SEQ ID NO:8.

[0018] The present invention provides a nucleic acid that encodes a nanobody or antigen-binding fragment thereof targeting NKG2A as described in any of the preceding claims.

[0019] Preferably, its nucleotide sequence is shown in SEQ ID NO:9.

[0020] The present invention provides a recombinant vector comprising the nucleic acid as described in any of the preceding claims.

[0021] The present invention provides a host cell comprising the recombinant vector as described above.

[0022] This invention provides a method for preparing a nanobody targeting NKG2A or an antigen-binding fragment thereof as described in any of the preceding claims, comprising:

[0023] The nucleic acid encoding the nanobody targeting NKG2A or its antigen-binding fragment is inserted into a recombinant vector, then transformed into host cells for expression, and finally isolated and purified.

[0024] The present invention provides the use of nanobodies targeting NKG2A as described in any of the preceding claims, or antigen-binding fragments thereof, nucleic acids as described in any of the preceding claims, recombinant vectors as described above, or host cells as described above in the preparation of medicaments for the prevention and / or treatment of cancer or autoimmune diseases.

[0025] Preferably, the cancer includes at least one of recurrent or metastatic head and neck squamous cell carcinoma, non-small cell lung cancer, colorectal cancer, advanced solid malignant tumors, chronic lymphocytic leukemia, and acute myeloid leukemia; the autoimmune disease includes at least one of rheumatoid arthritis, psoriasis, and systemic lupus erythematosus.

[0026] This invention provides a nanobody targeting NKG2A or its antigen-binding fragment, nucleic acid, recombinant vector, host cell, preparation method, and uses thereof. The anti-NKG2A nanobody of this invention has a molecular weight of approximately 12 kDa and exhibits high affinity for the NKG2A protein. To assess its functional differences from monalizumab, this nanobody was "conjugated" with the same modified IgG4 structure. Studies have found that the nanobody of this invention has high affinity for the NKG2A protein, higher than that of monalizumab, exhibits stronger HLA-E binding blocking, effectively enhances the tumor-killing effect of NK cells, and possesses the advantages of small molecular weight and low immunogenicity. It has broad application prospects in oncology drugs.

[0027] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions, or alterations can be made without departing from the basic technical concept of the present invention.

[0028] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0029] Figure 1 This is an SDS-PAGE image of nanobody 2A18.

[0030] Figure 2 The image shows the detection results of nanobody 2A18 and NKG2A using kinetic biomembrane interferometry.

[0031] Figure 3 The image shows the ELISA affinity assay results for the binding of Monarisizumab, IgG4 isotype control antibody, nanobody 2A18, and NKG2A.

[0032] Figure 4 The graph shows the flow cytometry results of different antibodies blocking HLA-E binding; among them, Figure 4 A shows the flow cytometry results of HLA-E binding blocked by the IgG4 isotype control antibody. Figure 4 B shows the flow cytometry results of monazolizumab blocking HLA-E binding. Figure 4 C is the flow cytometry result of nanobody 2A18 blocking HLA-E binding.

[0033] Figure 5 The IC50 inhibitors of monazine, IgG4 isotype control antibody, and nanobody 2A18 for blocking HLA-E binding 50 Display the results in the image.

[0034] Figure 6 Flow cytometry results showing the enhancement of NK cell killing effects by different antibodies; among them, Figure 6 A shows the flow cytometry results of NK cell killing effect without the addition of antibodies. Figure 6 B is the flow cytometry result showing that monazitezumab enhances the killing effect of NK cells. Figure 6 Figure C shows the flow cytometry results of the nanobody 2A18 enhancing the killing effect of NK cells. Detailed Implementation

[0035] Unless otherwise specified, all reagents and materials used in the following examples and experimental cases are commercially available.

[0036] Example 1: An anti-NKG2A nanobody and its preparation method

[0037] I. Experimental Methods

[0038] The anti-NKG2A nanobody in this embodiment was prepared by the following method:

[0039] 1. Constructing an expression carrier

[0040] (1) Restriction vector digestion: The tool vector pcDNA3.1-x-IgG1 was digested with BamHI / EcoRI enzymes (purchased from Yisheng Biotechnology). After double digestion at 37℃ for 5 h, the product was recovered by PCR (recovery kit: Cycle-Pure Kit PCR product purification kit, OMEGA, D6492-01). The BamHI / EcoRI double digestion plasmid system is shown in Table 1.

[0041] Table 1. BamH I / EcoR I double enzyme digestion plasmid system

[0042]

[0043] (2) Homologous recombination: The nucleotide fragments used for recombinant expression were diluted 20-fold with ddH2O. 1 μL of the diluted sample was then used for homologous recombination with the digested and recovered vector (recombinase, NovoRec Plus one-step PCRCloning Kit, nearshore protein catalog number: NR005-01B). The homologous recombination reaction system is shown in Table 2. This system was placed on a PCR instrument (50℃, 30 min). 100 μL of TOP10 transforming competent cells were added to each tube of homologous recombination product for transformation (placed on ice for 20 min, heat-shocked at 42°C for 90 s, immediately placed on ice for 2 min, 800 μL of LB medium was added, and cultured at 37°C, 220 rpm for 25-45 min. Subsequently, it was cultured overnight on Amp resistant plates.

[0044] Table 2 Homologous recombination reaction system

[0045]

[0046] The sequence of the nucleotide fragment used for recombinant expression was the following: CAGGTGCAGCTGGTGGAAAGCGGTGGTGCGAGCGTGCAGCCGGGTGGTAGCCTGCGTCTGAGCTGCGCGACCAGCGGTTTTGCGTTTAGCAACGTTGATATGAATTGGGTTCGCCGTGCACCAGGCAAAGGTTTGGAGTGGGTTGCCCGTATCGGCTCCG GCGGCAACACGTTATATGGCGATTCTGTAAAGGGTCGTTTTACGATCAGCCGCGACAATGCGAAAAACACCTTGTATCTCGAGATGAATTCACTTAAACCTGAGGACACTGCCGTCTACTACTGTGCAATCGTTGGCGGTCGCCGCGGTCAGGGTACTCAGGTCACCGTATCTTCA (SEQ ID NO:9).

[0047] (3) PCR identification of Escherichia coli: single colonies of Escherichia coli were picked from the plate in (2) and placed in 200 μL of LB medium. The culture was carried out at 37°C and 220 rpm for 3 h. 1 μL of the bacterial culture was used as a template for PCR identification. The positive clones identified were then sent for sequencing. The PCR products were recovered (Gel Extraction Kit, OMEGA, catalog number D2500-01). Homologous recombination was performed again. After PCR identification of the bacterial culture, positive clones were selected for sequencing.

[0048] 2. Expression and purification of Hek293F nanobody in cells

[0049] (1) Antibody expression

[0050] The above-mentioned bacterial strain was inoculated into 20 mL of LB medium containing ampicillin and incubated overnight at 37°C. Plasmids were extracted using a plasmid extraction kit (Plasmid Miniprep Kit II, BevoMed Cat: BW-PD1213). Transfection was performed when the cells maintained good growth and viability was greater than 95%. The Hek293 cell density was adjusted to 2.5 × 10⁻⁶ cells / year at transfection. 6 cells / mL. Take 50 μg of expression plasmid and add it to 1 mL of OPM medium and mix well. Take 150 μg of PEI and add it to 1 mL of OPM medium and mix well. After standing at room temperature for 30 min, add it to 50 mL of Hek293 cells and culture on a CO2 shaker. On the second day, add 5% final volume of OPM medium and continue culturing until day 7. After centrifugation at 10000 rpm for 20 min, harvest the cell culture supernatant for protein purification.

[0051] (2) Antibody purification

[0052] Antibody protein purification was performed using a Protein A column (5 mL column volume). The Protein A column (Chutian Microsphere Biotechnology (Changsha) Co., Ltd., TH-protein A, Y5001) was removed from the refrigerator and washed sequentially with one column volume of ultrapure water, one column volume of 0.1 M NaOH, and three column volumes of PBS buffer.

[0053] All the cell supernatant after centrifugation was loaded onto the column. After washing with PBS buffer for 3 column volumes, 800 μL of 0.1 M Gly-HCl was added for elution. The elution was repeated twice. The target protein (named 2A18) was collected. The protein concentration was detected by measuring A280 using a micro spectrophotometer. The protein purity was determined to be no less than 95%.

[0054] The amino acid sequence of the target protein 2A18 is shown in SEQ ID NO: 8. It consists of complementarity-determining regions CDR1, CDR2, and CDR3 and four frame regions FR1, FR2, FR3, and FR4 (see Table 3). The complementarity-determining regions are separated by the four frame regions.

[0055] Table 3. Amino acid sequence of the target protein

[0056]

[0057] 3. Identification of nanobody 2A18 by polyacrylamide gel electrophoresis (SDS-PAGE)

[0058] (1) Preparation of polyacrylamide gel: Using a 12% acrylamide rapid gelation kit, the formulation of each gel is as follows: Separating gel: 2.5 mL of separating gel A solution, 2.5 mL of separating gel B solution, 25 μL of 10% ammonium persulfate, and 2.5 μL of TEMED; Stacking gel: 1 mL of stacking gel A solution, 1 mL of stacking gel B solution, 10 μL of 10% ammonium persulfate, and 2 μL of TEMED.

[0059] (2) Sample preparation: Add a fixed amount (5 μg) of protein solution to a 1.5 mL centrifuge tube, add 5 × Loading buffer (reduced or non-reduced) according to the ratio, mix the sample, and heat in a 100℃ metal bath for 5 min.

[0060] (3) Sample loading: 120V constant voltage electrophoresis for 1 h.

[0061] (4) Staining: Remove the gel, add CBB staining solution, place on a shaker, and stain for 10 min.

[0062] (5) Decolorization: Discard the dyeing solution, add the decolorizing solution and put it back on the shaker for decolorization until the background color is transparent.

[0063] (6) Imaging: Imaging was performed using the Bio-Rad gel imaging system.

[0064] II. Experimental Results

[0065] The SDS-PAGE results of the Fc-structured nanobody 2A18 are as follows: Figure 1 As shown: Under non-reducing conditions, the molecular weight of 2A18 is approximately 75 kD, while under reducing conditions, the molecular weight is approximately 37 kD.

[0066] The technical solution of the present invention will be further explained through experiments below. The nanobody NKG2A detected in the following experimental examples was obtained by the method of Example 1.

[0067] Experimental Example 1: Biomembrane Interferometry Detection of NKG2A Kinetics by 2A18 Nanobody

[0068] I. Experimental Methods

[0069] Experiments were performed using a 96-well plate. The probe equilibration time was set to 300 s. The antibody was diluted to 300 nM with equilibration buffer and added to the 96-well plate at a volume of 200 μL / well. The probe loading time was set to 90 s. Subsequently, the antibody was diluted at a 1 / 3 ratio, i.e., the antigen was diluted to five concentrations (300 nM, 100 nM, 33 nM, 11 nM, 3.66 nM) with equilibration buffer, and a 0 nM concentration was set. Affinity was then detected using a Biacore T200 molecular interaction analysis system.

[0070] II. Experimental Results

[0071] Affinity was determined using the Biacore T200 molecular interaction analysis system. The affinity data for the 2A18 nanobody are as follows: Figure 2 As shown, the 2A18 nanobody of the present invention has a high affinity for NKG2A protein, with an equilibrium dissociation constant of 1.797E-9.

[0072] Experimental Example 2: Affinity Detection of 2A18 Nanobody with NKG2A

[0073] I. Experimental Methods

[0074] This experiment used the ELISA method to determine the affinity between 2A18 and NKG2A proteins, as follows:

[0075] After coating the ELISA plate with NKG2A protein (5 μg / ml), the coating solution was discarded, and the plate was washed twice with PBS and blocked at 37°C for 2 h. Nanobody 2A18, diluted 3-fold, was added and incubated at 37°C for 1 h. The plate was washed five times with 0.1% PBST (incubated for approximately 2-3 min each time), and horseradish peroxidase-labeled Fc secondary antibody (i.e., Goat Anti-Human IgG-Fc Secondary Antibody (HRP) Cat: SSA001) was added and incubated at 37°C for 45 min. Monoclonal antibody Monalizumab (MCE, HY-P99032) and IgG4 isotype control (MCE, HY-P99003) were used as control antibodies.

[0076] II. Experimental Results

[0077] The affinity ELISA results are shown in Table 4. The affinity of the 2A18 nanobody of this invention for NKG2A is superior to that of the control antibody, Monalizumab. Figure 3 The 2A18 nanobody of this invention has a half-maximal effective concentration (EC50) against NKG2A. 50 The EC50 value was 0.1836, while that of the control antibody, monolithiasis, was 0.1836. 50 The value was 0.5619. This indicates that the binding activity of the 2A18 nanobody of the present invention to NKG2A is superior to that of the control antibody, Monalizumab.

[0078] Table 4. ECG efficacy of 2A18 nanobody and monoclonal antibody against NKG2A 50

[0079]

[0080] Experimental Example 3: 2A18 nanobody blocks HLA-E binding

[0081] I. Experimental Methods

[0082] After centrifugation, 293T cells overexpressing NKG2A were discarded and resuspended in 2% FBS-PBS at a density of 5E5 cells / sample. 25 μg of PE-Labeled Human HLA-E 01:03&B2M&CMV UL40 (VMAPRTVLL) Tetramer Protein (Acro, HLU-HP2H5) was dissolved in 250 μL of ddH2O to a concentration of 100 μg / mL, and then diluted 10-20 times before use. Different concentrations of antibody and HLU-HP2H5 were added to the cell samples simultaneously, and a single HLU-HP2H5 staining group was also set up. After mixing, the cells were incubated at 4°C for 2 h. 1 mL of PBS was added, and the cells were centrifuged at 1200 rpm for 5 min. After washing the cells twice, they were resuspended and then analyzed by flow cytometry.

[0083] II. Experimental Results

[0084] At the same concentration, the flow cytometry results of IgG4 isotype control antibody, monocerizumab, and nanobody 2A18 blocking HLA-E binding are shown in the figures below. Figure 4 A, Figure 4 B. Figure 4 C. In addition, different concentrations of monalizumab, IgG4 isotype control antibody, and nanobody 2A18 blocked HLA-E binding IC. 50 See Figure 5 The statistical values ​​are shown in Table 5.

[0085] Table 5. IC50 of 2A18 nanobody and monoclonal antibody blocking NKG2A-HLA-E binding 50

[0086]

[0087] Based on the experimental results of antibody blocking HLA-E binding, both the nanobody 2A18 and the monoclonal antibody in this invention can effectively block the binding of HLA-E and NKG2A, and the blocking effect of nanobody 2A18 is better.

[0088] Based on the above affinity experiments and HLA-E binding blocking experiments, the nanobody 2A18 of this invention is expected to be used to treat a variety of cancers or autoimmune diseases, such as recurrent or metastatic head and neck squamous cell carcinoma, non-small cell lung cancer, colorectal cancer, advanced solid malignant tumors, chronic lymphocytic leukemia, acute myeloid leukemia, rheumatoid arthritis, psoriasis, systemic lupus erythematosus, etc.

[0089] Experimental Example 4: 2A18 nanobodies can enhance NK cell killing activity.

[0090] I. Experimental Methods

[0091] Calcein-AM (BioLegend, 425201) was used to treat human acute promyelocytic leukemia cell lines (3 × 10⁻⁶). 5 After staining with HL-60 cells, 10 nM of antibody (monarizumab or nanobody 2A18) was added, and the cells were incubated in an incubator for 30 min. Then, 3 × 10⁶ NK cells derived from PBMC culture were added. 5 After co-incubation for 4 hours, cells were collected and stained for apoptosis using the APC Annexin V Apoptosis Detection Kit with 7-AAD (BioLegend, 640930). Early apoptotic cells (7-AAD-Annexin V+) and late apoptotic cells (7-AAD+Annexin V+) were counted.

[0092] II. Experimental Results

[0093] At the same concentration, compared with the group with NK cells alone ( Figure 6 A), both monazine and nanobody 2A18 can enhance the killing effect of NK cells on HL-60 cells. Figure 6 B, Figure 6 C). Statistical values ​​are shown in Table 6.

[0094] Table 6. Monarizumab and 2A18 nanobody enhance NK cell killing of tumor cells.

[0095]

[0096] Note: "3E5 tumor" indicates 3 × 10 5 3 × 10 tumor cells; "3E5NK" indicates 3 × 10 5 One NK cell.

[0097] As shown in Table 6, both the nanobody 2A18 and the monoclonal antibody in this invention can effectively enhance the killing effect of NK cells on tumor cells.

[0098] As can be seen from the above embodiments and experimental examples, the present invention provides a nanobody, a nucleotide molecule, an expression plasmid, a host cell, and its preparation method and uses. The nanobody of the present invention has a high affinity for the NKG2A protein, higher than that of monazolizumab, and a stronger effect in blocking HLA-E binding. Both effectively enhance the tumor-killing effect of NK cells and possess the advantages of small molecular weight and low immunogenicity. It has broad application prospects in the preparation of drugs for the prevention and / or treatment of advanced tumors.

Claims

1. A nanobody targeting NKG2A or its antigen-binding fragment, characterized in that: It includes complementary determination regions; the complementary determination regions include CDR1, CDR2 and CDR3; The amino acid sequence of CDR1 is shown in SEQ ID NO:1; The amino acid sequence of CDR2 is shown in SEQ ID NO:2; The amino acid sequence of CDR3 is shown in SEQ ID NO:

3.

2. The nanobody targeting NKG2A or its antigen-binding fragment according to claim 1, characterized in that: The nanobody targeting NKG2A also includes a framework region, wherein, The complementary determination region is separated by frame regions, which include FR1, FR2, FR3 and FR4; The amino acid sequence of FR1 is shown in SEQ ID NO:4; The amino acid sequence of FR2 is shown in SEQ ID NO:5; The amino acid sequence of FR3 is shown in SEQ ID NO:6; The amino acid sequence of FR4 is shown in SEQ ID NO:

7.

3. The nanobody targeting NKG2A or its antigen-binding fragment according to any one of claims 1 or 2, characterized in that: Its amino acid sequence is shown in SEQ ID NO:

8.

4. A nucleic acid, characterized in that, It encodes a nanobody or antigen-binding fragment thereof targeting NKG2A as described in any one of claims 1-3.

5. The nucleic acid according to claim 4, characterized in that: Its nucleotide sequence is shown in SEQ ID NO:

9.

6. A recombinant vector, characterized in that: It contains the nucleic acid as described in claim 4 or 5.

7. A host cell, characterized in that, It comprises the recombinant vector as described in claim 6.

8. The method for preparing the nanobody targeting NKG2A or its antigen-binding fragment according to any one of claims 1-3, characterized in that, It includes: The nucleic acid encoding the nanobody targeting NKG2A or its antigen-binding fragment is inserted into a recombinant vector, then transformed into host cells for expression, and finally isolated and purified.

9. The use of the nanobody targeting NKG2A according to any one of claims 1-3 or its antigen-binding fragment, the nucleic acid according to claim 4 or 5, the recombinant vector according to claim 6, or the host cell according to claim 7 in the preparation of a medicament for treating cancer or autoimmune diseases, characterized in that: The cancer is at least one of recurrent or metastatic head and neck squamous cell carcinoma, non-small cell lung cancer, and colorectal cancer; the autoimmune disease is at least one of rheumatoid arthritis, psoriasis, and systemic lupus erythematosus.