Engineering bacterium for producing L-piperidine acid and application of engineering bacterium in preparation of antidepressant drugs

Abstract

The invention discloses an engineering bacterium for producing L-piperidine acid and application of the engineering bacterium in preparation of antidepressant drugs, and belongs to the technical field of biological medicines. According to the engineering bacteria, a promoter J23105, a lat gene optimized through prokaryotic expression and a proC gene are sequentially inserted into multiple cloning sites of a kanamycin-resistant pRSF-Duet-1 plasmid, and synthetic operons arranged in the same direction are formed; the operon is spliced with a linearized pRSF-Duet-1 plasmid vector in a homologous recombination or Gibson assembly mode, the spliced operon and the linearized pRSF-Duet-1 plasmid vector are transformed into escherichia coli for amplification, after it is confirmed through sequencing that the sequence and the direction of an insertion fragment are correct, the insertion fragment is transferred into a chassis bacterium, and the operon is obtained. Researches prove that colonization of the engineering bacteria can improve anxiety and depression behaviors of mice and improve social scores of the mice, so that the engineering bacteria can be used for preventing and treating depression. Therefore, the engineering bacterium disclosed by the invention can be used for preparing anti-depression drugs, such as production of viable bacteria preparations.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of biological medicine, and particularly relates to an engineered bacterium for producing L-piperidinic acid and application thereof in preparation of an antidepressant. BACKGROUND

[0002] With the development of society and the change of lifestyle, depression has become the most common mental and psychological disease. About 390 million people worldwide suffer from depression, and the incidence rate accounts for 37.3% of all mental diseases. The pathogenesis of depression is complex, and is affected by multiple factors such as genetics, environment, diet, and psychology. Depression is usually treated by psychological intervention, drugs, or both. However, so far, the monoamine drugs for treating depression still have the shortcomings of unsatisfactory effect, delayed efficacy, multiple side effects, and drug resistance. Therefore, it is of great research significance to explore the pathogenesis of depression in depth and develop new therapeutic targets and drugs for different pathogenesis.

[0003] More and more research results indicate that the cause of depression is closely related to the disorder of intestinal flora. The intestinal flora is easily changed by external stress and other stimuli, and the disorder of the flora can further cause depressive behavior and its course development. Recent research has found that the Microbiota-gut-brain axis is a potential new target for regulating depression, and the related targeted regulation strategy needs to be developed.

[0004] The engineered bacterium can be used to synthesize neuroactive substances or regulate the gut-brain axis by precisely regulating the metabolic pathway, thereby providing a new bionic treatment strategy for depression and other neuropsychiatric diseases. The programmability and targeting of the engineered bacterium make it have broad application prospects in individualization, long-term, and safe intervention.

[0005] The development of sequencing technology promotes the understanding of the composition of intestinal microorganisms, but the role of specific strains in the neural regulation of biological individuals still remains blank. In addition, the current research on the key microbial metabolites for regulating the signal transmission of the gut-brain axis is still limited, which limits the research on the corresponding living engineered bacterium.

[0006] At present, the research on anti-depression engineered bacteria at home and abroad is gradually increasing. However, there is no related report about the anti-depression activity of microbial metabolite L-piperidinic acid (L-PipA) and the engineered bacterium for producing L-piperidinic acid. SUMMARY

[0007] The purpose of the present application is to provide an engineered bacterium for producing L-piperidinic acid and application thereof in preparation of an antidepressant.

[0008] This invention provides an engineered strain (L-PipA) that produces L-piperidine acid (L-PipA). + EcN This invention demonstrates the application of L-PipA colonization in improving depressive-like behavior in mice. Related studies have confirmed its effectiveness in this area. + EcN Engineered bacteria can improve anxiety- and depression-like behaviors in mice and increase their social scores, thus potentially making them useful for the prevention and treatment of depression. This invention relates to L-PipA... + EcN It can be used to prepare antidepressant drugs, such as the production of live bacteria preparations.

[0009] Technical solution: The objective of this invention is achieved through the following technical solution: This invention provides an engineered bacterium that produces L-piperidine acid, wherein the engineered bacterium is a kanamycin-resistant bacterium. pRSF-Duet-1 The multiple cloning site of the plasmid is sequentially inserted into promoter J23105, followed by prokaryotic expression optimization. lat Genes and proC Genes, forming synthetic operons aligned in the same direction; the operons are then combined with linearized... pRSF-Duet-1 The plasmid vector is assembled by homologous recombination or Gibson assembly, transformed into E. coli for amplification, and sequenced to confirm the correct sequence and orientation of the inserted fragment before being transformed into a substrate culture.

[0010] Preferably, the sequence of promoter J23105 is shown in SEQ ID NO.1; optimized for prokaryotic expression. lat The gene sequence is shown in SEQ ID NO.2; optimized for prokaryotic expression. proC The gene sequence is shown in SEQ ID NO.3.

[0011] Preferably, the substrate bacteria of the engineered bacteria are... Escherichia coli Nissle1917 ( EcN ) engineered strains.

[0012] In a preferred embodiment of the present invention, the engineered bacteria are constructed according to the following steps: (1) In kanamycin-resistant pRSF-Duet-1 The multiple cloning site of the plasmid is sequentially inserted into the constitutive promoter J23105, followed by prokaryotic expression optimization. lat Genes and proC Genes form synthetic operons arranged in the same direction; (2) pRSF-Duet-1 After linearization with a compatible restriction endonuclease, the plasmid was compared with the PCR-amplified J23105- plasmid containing homologous ends. lat Fragments and J23105- proCThe fragments were assembled using Gibson to obtain recombinant plasmids. pRSF-J23105- lat- J23105- proC (3) The recombinant plasmid obtained in step (2) is first transformed into Escherichia coli. Escherichia coli Nissle1917 After amplification and sequencing confirm the correct sequence and orientation of the inserted fragment, electroporation is then used for transfection. EcN The first generation of engineered strains was obtained from the substrate bacteria and named L-PipA. + EcN ; The kanamycin-resistant pRSF-Duet-1 The sequence of the plasmid is shown in SEQ ID NO.4; The recombinant plasmid pRSF-J23105-lat- J23105- proC The sequence is shown in SEQ ID NO.5.

[0013] Preferably, the culture method of the engineered bacteria is as follows: the constructed engineered bacteria are inoculated into sterile LB liquid medium and cultured in a 37°C incubator for 24 hours. When the bacterial solution becomes turbid, it can be passaged.

[0014] More preferably, the sterile LB liquid culture medium contains 50 μg / ml kanamycin, 10 μg / ml pyridoxal phosphate, 0.5 mM ferrous ammonium sulfate, and pH=7.0.

[0015] The present invention also provides the application of the above-mentioned engineered bacteria in the production of L-piperidine acid.

[0016] In the aforementioned engineered strains, the intracellular L-lysine synthesized by the chassis strain... lat Under catalysis, α-ketoglutarate serves as the amino acceptor, generating α-aminohexanoic acid hemialdehyde. This intermediate spontaneously cyclizes intracellularly to a 1-piperidine-6-carboxylic acid lactone, subsequently... proC Under the action of [a specific enzyme / organism], it is reduced to the target product L-piperidinic acid. Compared with the redox-dependent pathway centered on L-lysine 6-dehydrogenase, this pathway is less dependent on intracellular pH and NAD(H) levels, therefore [the process is more efficient]. EcN It offers better compatibility and selectivity.

[0017] The present invention also provides the application of the above-mentioned engineered bacteria in the preparation of antidepressant drugs.

[0018] The L-PipA constructed in this invention + EcN The bacterial strain was colonized in mice to study L-PipA. + EcNEffects of L-PipA supplementation on depressive-like behaviors in mice.

[0019] L-PipA + EcN Strain colonization: L-PipA was taken out from the incubator after 24 hours of culture + EcN The bacteria were centrifuged at 4000 rpm for 20 minutes at room temperature. After centrifugation, the supernatant was discarded and the bacteria were resuspended in an appropriate amount of sterile normal saline to prepare a bacterial solution of 1x10 9 CFU / mL for mouse gavage. During gavage, each mouse was given 0.2 mL of bacterial solution.

[0020] The present application found that L-PipA + EcN supplementation has obvious improvement effect on preventing and relieving depressive-like behaviors in mice. Compared with the control group of the chassis bacteria EcN , the mice colonized with L-PipA + EcN have a significantly increased social score in social experiments, indicating that L-PipA + EcN supplementation can improve depressive-like behaviors in mice. The above results show that L-PipA + EcN bacteria have certain antidepressant effect and have potential medicinal value in preventing and treating depression.

[0021] Preferably, the medicine is a live bacteria preparation.

[0022] Further preferably, the concentration of the live bacteria preparation is 1x10 9 CFU / mL. Beneficial effects

[0023] The present application provides an engineered bacteria producing L-piperide acid and verifies its use in preventing and treating depressive-like behaviors in mice. Through relevant research, the present application proves that after L-PipA + EcN colonization, the depressive-like behaviors of animals are improved and the social score of mice is increased. Therefore, the L-PipA + EcN of the present application can be used for preparing an antidepressant drug. The engineered bacteria L-PipA + EcN of the present application has certain medical prospects and economic value. BRIEF DESCRIPTION OF DRAWINGS

[0024] Figure 1 L-PipA + EcN colonization process in mice and in vivo L-PipA synthesis verification; wherein,Figure 1 A is an L-piperidinic acid-producing engineered bacterium (L-PipA + EcN A flowchart of colonization of a recipient mouse by L-PipA Figure 1 B is stable isotope tracing to verify L-PipA + EcN Synthesis of N 15 LC-MS chromatogram of L-PipA Figure 1 C is L-PipA + In vivo colonization level of EcN.

[0025] Figure 2 Engineered L-PipA + EcN Effect of colonization on depression-related behaviors of mice and L-PipA levels in vivo; wherein, Figure 2 A is L-PipA + EcN Total movement distance, center area residence time, and center area movement distance of recipient mice in the open field test (OFT); Figure 2 B is a representative trajectory plot of an engineered bacterium-colonized mouse; Figure 2 C is the immobility time of recipient mice in the tail suspension test (TST); Figure 2 D is the marble burying behavior of recipient mice; Figure 2 E is the social score of mice in the social avoidance test; Figure 2 F is L-PipA + Effect of EcN colonization on L-PipA levels in serum of mice; Figure 2 G is L-PipA + Effect of EcN colonization on L-PipA levels in the hypothalamus of mice. DETAILED DESCRIPTION

[0026] The technical solutions of the present application will be described in detail below through specific examples, but the scope of protection of the present application is not limited to the examples.

[0027] Example 1: An engineered bacterium L-PipA producing L-piperidinic acid + EcN Construction of L-PipA The engineered bacterium L-PipA + EcNThe construction method is referenced in the literature (Sarah Pauli et al. Systemsmetabolic engineering upgrades Corynebacterium glutamicum for selective high-level production of the chiral drug precursor and cell-protective extremolyte L-pipecolic acid. Metab Eng. 2023. DOI: 10.1016 / j.ymben.2023.03.006).

[0028] ① Selection of starting strain Select Escherichia coli Nissle1917 ( EcN The engineered strain (BNCC361741, BeiNa Biotechnology) was used as the chassis bacteria.

[0029] ② Obtaining the target gene (1) L-lysine 6-aminotransferase ( lat Genes originate from Flavobacterium lutescens IFO 3084, its nucleotide sequence is available from publicly available databases. (To adapt...) EcN The expression of the gene can be optimized according to the host's codon preferences and synthesized by a commercial company; alternatively, it can be directly amplified using the genomic DNA of the strain as a template.

[0030] In this embodiment, the expression optimized by prokaryotic expression lat The gene sequence is shown in SEQ ID NO.2 and was synthesized by Genewiz. In SEQ ID NO.2, the 5' nucleotide sequence GGATCC is the BamHI restriction endonuclease recognition site, TTTACGGCTAGCTCAGTCCTAGGTACTATGC (SEQ ID NO.1) is the J23105 promoter, AAAGAGGAGAAA is the ribosome binding site, and the 3' nucleotide sequence AAGCTT is the HindIII restriction endonuclease recognition site.

[0031] SEQ ID NO.2:

[0032] (2) A1-pyrroline-5-carboxylate reductase gene (pyc) derived from the proC EcN

[0033] In this embodiment, the sequence of the gene optimized for prokaryotic expression is shown in SEQ ID NO. 3, which was synthesized by the company Goldengene. Among them, AGATCT is the recognition site of BglII restriction enzyme, TTTACGGCTAGCTCAGTCCTAGGTACTATGC is the J23105 promoter, AAAGAGGAGAAA is the ribosome binding site, and CTCGAG is the XhoI restriction enzyme site. proC

[0034] SEQ ID NO. 3: ​​​AGATCTTTTACGGCTAGCTCAGTCCTAGGTACTATGCTAGCTACTAGAGAAAGAGGAGAAATACTAGATGGAAAAGAAGATAGGGTTTATAGGATGCGGAAACATGGGAAAAGCAATACTAGGAGGATTAATAGCAAGCGGACAAGTACTACCAGGACAGATTTGGGTTTATACGCCATCACCGGACAAAGTTGCGGCGCTGCATGATCAATTTGGCATCAACGCCGCTGAGTCGGCGCAAGAAGTAGCACAGATTGCTGATATTATTTTTGCCGCCGTCAAACCAGGTATCATGATCAAGGTATTGTCCGAAATCACCAGCTCTCTGAATAAAGACTCGCTGGTGGTGAGTATCGCAGCAGGTATTACCTTGGACCAGCTGGCTCGTGCCCTGGGTCACGATCGCAAAATTATCCGGGCGATGCCAAATACGCCGGCGTTAGTGAACGCAGGCATGACTTCAGTAACACCGAACGCGCTGGTTACTCCTGAAGACACCGCAGATGTTCTGAACATTTTTCGCTGCTTCGGTGAAGCGGAAGTTATTGCAGAACCGATGATTCACCCGGTCGTGGGCGTTTCTGGCAGCAGCCCGGCCTACGTCTTCATGTTCATCGAGGCCATGGCAGACGCTGCGGTACTCGGCGGTATGCCGCGTGCGCAGGCTTATAAATTTGCCGCGCAGGCGGTCATGGGGTCCGCCAAGATGGTGCTAGAGACCGGGGAACATCCTGGCGCGCTTAAAGATATGGTTTGTAGCCCCGGAGGCACGACCATCGAAGCGGTGAGAGTATTAGAGGAGAAGGGGTTTAGAGCAGCAGTAATCGAGGCAATGACAAAATGTATGGAAAAATCAGAAAAATTAAGCAAAAGTTAACTCGAG.

[0035] ③ Construction of expression vector (1) Using a plasmid vector capable of stable replication in EcN E. coli, one skilled in the art can select other plasmids having the same replication origin and selection marker as needed.

[0036] In this embodiment, a plasmid containing kanamycin resistance pRSF-Duet-1 was used as a backbone, and the sequence of the plasmid containing kanamycin resistance pRSF-Duet-1 is shown in SEQ ID NO. 4, which was purchased from Genewiz.

[0037] SEQ ID NO. 4:

[0038] (2) The promoter J23105 (the sequence of which is shown as SEQ ID NO. 1), the prokaryotic expression optimized lat gene and proC gene are sequentially inserted into the multiple cloning site of the above-mentioned vector to form a synthetic operon arranged in the same direction. The promoter is the constitutive promoter J23105 in EcN , obtaining J23105-lat- J23105 -proC expression cassette. Among them, J23105- lat the 5' end of the J23105 -proC is a BamHI site, and the 3' end is a HindIII site; the 5' end of the J23105 is a BglII site, and the 3' end is an XhoI site.

[0039] pRSF-Duet-1 (3) The kanamycin-resistant lat is linearized with compatible restriction enzymes, and then Gibson assembly is performed with the J23105- proC fragment and the J23105- pRSF-J23105-lat- fragment amplified by PCR and having homologous ends to obtain the recombinant plasmid proC J23105- , the sequence of which is shown as SEQ ID NO. 5. The recombinant plasmid is entrusted to the company for synthesis.

[0040] SEQ ID NO. 5:

[0041] (4) The obtained plasmid is first transformed into E. coli Escherichia coli Nissle1917 EcN ) After amplification, sequencing and confirmation of the sequence and direction of the inserted fragment in the engineering strain (BNCC361741, Bei Na Biological), the electroporation method is used to transform into EcN the chassis strain to obtain the initial L-piperidine acid-producing engineering strain, denoted as L-PipA + EcN .

[0042] Example 2: Engineering bacteria L-PipA + EcN Application in the preparation of antidepressants Figure 1 A is the L-piperidine acid-producing engineering bacteria (L-PipA + EcN ) The process diagram of colonization in recipient mice. After one week of adaptation, the mice were given antibiotic cocktails (ABX) for one week, once every other day; then the engineering bacteria were colonized continuously for two weeks, once a day, and the feces were collected for verification after two weeks of colonization; then the RSD model was established for 6 days, and the behavior test was carried out after the modeling was completed.

[0043] The specific steps are as follows: Experimental animals: C57BL / 6J mice (male, 6 weeks old, body weight 20g, purchased from Vintone Lifescience).

[0044] Establishment of pseudo-sterile mouse model: SPF grade C57BL / 6J mice were randomly divided according to body weight, n=15 per group, 3 mice per cage for feeding. After one week of adaptation, the mice were given antibiotic cocktails (Antibiotics cocktail, ABX) by gavage, once every other day, for a total of 4 times, for a period of one week. The antibiotic cocktail formula is: ampicillin 6.7mg / ml, neomycin sulfate 6.7mg / ml, vancomycin hydrochloride 3.35mg / ml, metronidazole 6.7mg / ml.

[0045] (3) L-PipA + EcN Culture L-PipA + EcN constructed in Example 1 was inoculated into sterile LB liquid medium (pH=7.0, 50μg / ml kanamycin, 10μg / ml pyridoxal phosphate, 0.5mM ferrous ammonium sulfate) and cultured in a 37℃ incubator for 24 hours. The turbid bacterial solution was then subcultured.

[0046] Control chassis bacteria EcN ​(DSM 6601) Specific culture steps: the chassis bacteria EcN Inoculate sterile LB medium (pH = 7.0) in a 37°C incubator for 24 hours, and the turbid bacterial solution can be subcultured.

[0047] (4) L-PipA under isotope-labeled substrate + EcN LC-MS verification experiment of L-piperidine acid synthesis The specific steps are as follows: The constructed L-PipA + EcN and chassis bacteria EcN Cultured to the logarithmic growth phase, centrifuged at 4000 rpm and room temperature for 20 min, discarded the supernatant, resuspended and washed the bacterial body once with M9 buffer (Sigma, M6030), and then centrifuged again to discard the supernatant; then resuspend the bacterial body with M9 buffer and adjust to OD 600 = 1. The total volume of the incubation system is 200 μL, containing 180 μL of bacterial solution (or M9 solvent), 20 μL of N-Lysine (concentration of mother liquor is 5 mM) or sterile saline. Set up three groups: ① L-PipA 15 N-Lysine; ② L-PipA + EcN + 15 N-Lysine; ② L-PipA + EcN + sterile saline (negative control); ③ M9 + 15 N-Lysine (blank matrix control). After incubation at 37°C for 4 h, add pre-cooled precipitant 800 μL (4-chlorophenylalanine as internal standard, concentration is 200 ng / mL), shake for 10 min, then centrifuge at 18000 rpm at 4°C for 10 min, collect the supernatant and dry it at -80°C for later use for LC-MS analysis. Before injection, dissolve with 200 μl of ice methanol, shake for 15 min. 4°C, 18000 rpm centrifuge for 10 min, take 150 μl of supernatant to a new 1.5 ml EP tube. 4°C, 18000 rpm centrifuge for 5 min, take 100 μl of supernatant for injection.

[0048] LC-MS (Agilent 6546 LC / Q-TOF) was used to detect the incubated samples. The chromatographic and mass spectrometric conditions are as follows: Chromatographic conditions: The chromatographic column type was Waters XBridger RAmide 3.5 μm. The mobile phase A was 5 mM ammonium acetate (containing 500 μL / L formic acid), the mobile phase B was acetonitrile, the flow rate was 0.4 mL / min, the injection volume was 5 μL, and the column temperature was 40 °C. The elution program was as follows: 0-3 min, 85%B; 3-6 min, 85-30%B; 6-15 min, 30-2%B; 15-18 min, 2%B; 18-19 min, 2-85%B; 19-26 min, 85%B.

[0049] Mass spectrometric conditions: The ionization mode was ESI, the positive mode, the scanning range was 50-750 m / z, the gas temperature was set to 350 °C; the drying gas was 9 L / min; the atomizing gas was 45 psi; the protective gas temperature was 325 °C; the protective gas flow was 11 L / min; the ion spray voltage was set to +4000 V (ESI+), and the reference liquid mass m / z was 112.9855 and 1033.9881.

[0050] Data acquisition and processing were performed using Agilent MassHunter software, and isotope peaks were analyzed by extracting ion current (EIC) according to the theoretical m / z.

[0051] Figure 1 B is stable isotope tracing verification L-PipA + EcN Synthesis of N 15 -L-PipA. The results show that L-PipA + EcN N 15 -Lysine as a substrate to synthesize N 15 -L-PipA, while the control chassis EcN cannot, indicating that the engineered L-PipA + EcN was successfully constructed.

[0052] (5) L-PipA + EcN Strain colonization The L-PipA + EcN bacteria cultured for 24 hours were taken out of the incubator and centrifuged at 4000 rpm for 20 minutes at room temperature. After centrifugation, the supernatant was discarded, and the bacterial cells were resuspended in an appropriate amount of sterile normal saline to prepare a bacterial solution of 1×10 9 CFU / mL, which was used for gavage of mice. When gavaging, each mouse was given 0.2 mL of the bacterial solution.

[0053] Chassis bacteria EcN Colonization of the incubator: Remove from the incubator and incubate for 24 hours. EcN The bacterial culture was centrifuged at 4000 rpm for 20 minutes at room temperature. After centrifugation, the culture was placed in a clean bench, the supernatant was discarded, and the bacterial cells were resuspended in an appropriate amount of sterile physiological saline to prepare 1×10⁻⁶ cells / mL. 9 The bacterial solution at CFU / mL was administered to mice via gavage, with each mouse receiving 0.2 mL of the bacterial solution.

[0054] (6) Collection of mouse feces The engineered bacteria were continuously colonized for 2 weeks, once daily. Sampling was performed between 9:00 AM and 11:00 AM on the 2nd week after colonization. Mouse cages were disinfected with 75% ethanol and then wiped clean with paper towels. Mice were placed in individual cages, one mouse per cage. Fresh feces were collected using tweezers disinfected with 75% ethanol and temporarily stored in 1.5 mL ep puncture tubes placed on crushed ice. After the experiment, the tubes were immediately placed in a -80°C freezer for long-term storage.

[0055] (7) Extraction of mouse fecal DNA The fecal genomic DNA extraction kit (Tiangen, DP328) was used. 50 mg of fecal sample was weighed into a 1.5 ml centrifuge tube, and the tube was placed on ice. 500 μl of buffer SA, 100 μl of buffer SC, 15 μl of Proteinase K, and 0.25 g of grinding beads were added to the sample, and the tube was intermittently shaken for 1 min until the sample was well mixed. Incubation at 70°C for 15 min, shaking 2-3 times during incubation. Vortex for 15 sec, centrifuge at 12000 rpm for 3 min, transfer the supernatant to a new centrifuge tube, add 10 μl of RNase A, shake well and stand at room temperature for 5 min. Add 200 μl of buffer SH, shake well, and place on ice for 5 min. Centrifuge at 12000 rpm for 3 min. Transfer the supernatant obtained in the previous step to a new 1.5 ml centrifuge tube, and add an equal volume of buffer GFA. Add the solution obtained in the previous step to a CR2 adsorption column (the adsorption column is placed in a collection tube), centrifuge at 12000 rpm for 30 sec, discard the waste, and place the CR2 adsorption column in the collection tube. Add 500 μl of buffer GD to the CR2 adsorption column, centrifuge at 12000 rpm for 30 sec, discard the waste, and place the CR2 adsorption column in the collection tube. Add 700 μl of rinse solution PW to the CR2 adsorption column, centrifuge at 12000 rpm for 30 sec, discard the waste, and place the CR2 adsorption column in the collection tube. Place the CR2 adsorption column back in the collection tube, centrifuge at 12000 rpm for 2 min, and discard the waste. Place the CR2 adsorption column in a clean centrifuge tube, and add 50 μl of elution buffer TB to the middle of the adsorption membrane, stand at room temperature for 5 min, centrifuge at 12000 rpm for 2 min, and collect the solution in the centrifuge tube.

[0056] (8) L-PipA + EcN Verification of single bacterial colonization results The single bacterial colonization results were verified using qPCR.

[0057] The reaction system is shown in Table 1: Table 1 qPCR reaction system

[0058] Primer sequences: F: 5'-AAATACTAGATGGCAGCCGT-3' R: 5'-GCCGCAAGCTTTTAGGTAAC-3' The above forward and reverse primers were synthesized by Shanghai Sangon Biological Engineering Co., Ltd.

[0059] Reaction conditions: Stage 1: pre-denaturation at 95°C for 90 sec.

[0060] Stage 2: PCR reaction (95°C for 30 sec, annealing temperature 60°C for 30 sec, 72°C for 30 sec), 40 cycles in total.

[0061] Stage 3: melting curve analysis from 65°C to 95°C at a temperature increasing rate of 0.5°C / 5 sec.

[0062] Data processing: The relative quantification was performed with the reference gene as the standard, i.e. 2 -ΔΔCT -ΔΔCT method. The CT value of the target gene of the experimental sample was CT(TARGET, TEST), and the CT value of the reference gene was CT(REF, TEST). Similarly, the CT value of the target gene of the calibration sample was CT(TARGET, CAL), and the CT value of the reference gene was CT(REF, CAL). The calculation steps were as follows: for all the experimental samples and the calibration sample, the CT value of the target gene was normalized with the CT value of the reference gene: ΔCT(TEST) = CT(TARGET, TEST) - CT(REF, TEST), ΔCT(CAL) = CT(TARGET, CAL) - CT(REF, CAL); then the ΔCT value of the experimental sample was normalized with the ΔCT value of the calibration sample: ΔΔCT = ΔCT(TEST) - ΔCT(CAL), to calculate the expression level ratio of the target gene between the experimental sample and the calibration sample, i.e. 2 -ΔΔCT .

[0063] Figure 1 C is L-PipA + EcN In vivo colonization level verification results in the recipient mice. The qPCR experimental results demonstrated L-PipA + EcN In vivo colonization effect in mice ， is shown as L-PipA + EcN Significant increase in the colonization fold, L-PipA + EcN Colonization is successful.

[0064] (9) Selection of CD-1 mice for challenge SPF grade CD-1 mice (male, 4-6 months old) were purchased from Zhejiang Vivotecno Charles River (Beijing) Experimental Animal Co., Ltd. and were raised in a general animal room and were raised in single cages. After adaptation, the aggressive screening was started 4 days before modeling. C57BL / 6J waste rats (male, black rats) were put into the cage where the CD-1 mice were raised, and the time was counted for 3 min. Within 3 min, if the latency of the white rat attacking the black rat was less than 60 s, the white rat was considered to be aggressive. The CD-1 mice were selected as the attacking rats for modeling if they were continuously screened for 3 days and were qualified for 2 days. If the CD-1 white rat had the behavior of licking the fur of the C57BL / 6J black rat during modeling, the CD-1 rat would be excluded.

[0065] (10) Establishment of repeated social defeat stress (RSD) model The pseudo-sterile mice constructed in step (2) were raised in a cage of 3 mice each, and the mice were subjected to repeated social defeat stress (RSD) modeling. The selected CD-1 mice were put into the cage of 3 C57BL / 6J mice per cage, and the modeling lasted for 2 h. During the modeling, the behavior of the CD-1 white rat was observed, and if there was no attacking behavior within 10 min, the attacking rat needed to be replaced. The attacking CD-1 rats were used alternately every day during the modeling period, so that the C57BL / 6J mice in each cage were exposed to different CD-1 white rats every day. After RSD modeling, if the C57BL / 6J mice had large wounds on their bodies and their mobility was severely impaired, they needed to be excluded. The behavioral test was carried out 24 h after the end of modeling.

[0066] (11) Open field test A customized open field box (40 cm x 40 cm x 40 cm) was used in the open field test to evaluate the spontaneous activity and anxiety behavior of the mice. An external camera (Logitech, Switzerland) was used to record the experimental process. The camera was adjusted in advance to be perpendicular to the ground and the field of view covered the edge of the open field box. The light in each open field box was uniform without obvious light-dark corners. The recorded video was analyzed and processed by the behavior analysis software Anymaze (Stoelting, USA). The 40 cm x 40 cm open field was artificially divided into a central area and a peripheral area. Before the experiment, the bottom of the open field box was wiped with 75% ethanol, and the C57BL / 6J mice were placed along the middle of one side of the open field box, with their faces facing the central area. The mice were allowed to move spontaneously for 8 min, and then the mice were removed. The open field box was cleaned with 75% ethanol to maintain cleanliness.

[0067] Figure 2 A is L-PipA + EcNThe total movement distance, the time in center and the distance in center of the recipient mice in the open field test (OFT); Figure 2 B is a representative trajectory map of the recipient mice.

[0068] The total movement distance of the mice represents the spontaneous activity of the mice, while the distance in center, the number of entries in center and the time in center are used to evaluate the anxiety level of the mice. The longer the distance in center, the more the number of entries in center and the longer the time in center, the lower the anxiety level of the mice.

[0069] (12) Tail suspension test The tail suspension test tests the behavior of the mice in a desperate situation by suspending the mice at a distance of 20-25 cm from the ground. In the experiment, the experimenter fixes the tail of the mouse on the hook of the tail suspension box (Shanghai Xinsoft Information Technology Co., Ltd., China) with tape, so that the distance between the nose of the mouse and the bottom of the tail suspension box is about 20-25 cm, and a high-definition external camera is used to continuously shoot for 6 min. The mice that climb up the hook along the tape will be excluded. After the experiment, the tape is gently removed from the tail to reduce the pain caused to the animals by the experiment. The immobility time of the mice in 2-6 min is recorded, and the immobility time of the mice is counted in a double-blind manner. The mice with longer immobility time are considered to have stronger depression.

[0070] Figure 2 C is the immobility time of the recipient mice in the tail suspension test (TST). As shown in the figure, L-PipA + EcN The immobility time of the recipient mice in the tail suspension test did not change significantly.

[0071] (13) Marble burying test Standard mouse cages and matching cage covers are selected, fresh corn cob bedding is put in, the bedding is evenly spread on the bottom of the mouse cage, the height of the bedding is 5 cm, 16 glass beads with a diameter of d=16 mm are selected and gently and evenly (4x4) placed on the bedding. Ensure consistent light intensity and quiet test space during testing. Put a single mouse to be tested into the prepared cage, and test for 30 min. After the test, count the number of buried marbles, and more than 75% of the glass beads are considered as one buried marble.

[0072] Figure 2 D is the marble burying behavior of the recipient mice.

[0073] In the marble burying test shown in the figure, L-PipA+ EcN The number of beads implanted in the recipient mice was significantly reduced, indicating that it can alleviate the stereotyped behavior and anxiety-like behavior of mice.

[0074] (14) Social avoidance test The social avoidance test tests the social behavior of mice to the CD-1 attacking mouse, and reflects the social score and depression level of the mice. The social avoidance test uses a custom open field box (40 cm x 40 cm x 40 cm), a custom cylindrical wire cage (diameter 10 cm, height 15 cm), and a non-aggressive CD-1 white mouse. The bottom surface (40 cm x 40 cm) of the open field box is divided into a social area (Interaction Area, 14 cm x 24 cm) and other areas, and the custom cylindrical wire cage is placed in the middle of the social area. The experiment is divided into two stages (Stage), each for 150 s, with a 30 s interval. The experiment process is recorded using an external camera (Logitech, Switzerland), and the camera is adjusted in advance to be perpendicular to the ground and to have a field of view covering the edge of the open field box. The light in each open field box is uniform, with no obvious light-dark angle. The recorded video is analyzed and processed by the behavior analysis software Anymaze (Stoelting, USA). Stage 1 is the no mouse stage, i.e. No target stage. In this stage, there is no CD-1 in the custom wire cage, and the test mouse is placed in the middle of the rear area facing the wire cage, and the camera records for 150 s, and then the mouse is removed. Stage 2 is the mouse stage, and a non-aggressive CD-1 mouse is placed in the wire cage, and the test mouse is placed in the same way as in Stage 1, and the camera records for 150 s.

[0075] Mouse social score = T2 (time spent by mouse in social area in Stage 2) / T1 (time spent by mouse in social area in Stage 1).

[0076] Figure 2 E is the social score of the mouse in the social avoidance test.

[0077] The social avoidance test showed that L-PipA + EcN The recipient mice obtained more social scores, indicating that L-PipA + EcN may have a promoting effect on improving the social ability of mice.

[0078] (15) L-PipA + EcN L-PipA can adjust the levels of related indicators in the serum and hypothalamus of mice The specific steps are as follows: Serum pretreatment method: accurately pipette 100 μL L-PipA+ EcN The serum of the mice after colonization was accurately taken into an 800 μL EP tube containing an internal standard 4-chlorophenylalanine (200 ng / mL) ice methanol. Shake for 10 min. After low-temperature centrifugation at 18000 rpm, 700 μL of supernatant was taken into a new 1.5 mL EP tube, and the sample was dried by a vacuum evaporator. The sample was stored in a -80°C refrigerator. Before sampling, it was reconstituted with 200 μL ice methanol, shaken for 15 min, and centrifuged at 4°C and 18000 rpm for 10 min. 150 μL of supernatant was taken into a new 1.5 mL EP tube. Centrifugation was performed again at 4°C and 18000 rpm for 5 min, and 100 μL of supernatant was taken for sampling.

[0079] Hypothalamic pretreatment method: L-PipA was weighed + EcN The brain tissue of 15 mg of the mice after colonization was taken into an 1.5 mL EP tube, 1 homogenization bead was added, 200 μL ultrapure water was homogenized, and low-temperature homogenization was performed for 1 min (60 Hz, 1 min). 800 μL of a precipitant containing an internal standard 4-chlorophenylalanine (200 ng / mL) was added, shaken for 10 min, and centrifuged at 4°C and 18000 rpm for 10 min. 700 μL of supernatant was taken and dried, and stored in a -80°C refrigerator. Before sampling, it was reconstituted with 200 μL ice methanol, and after adding an equal proportion of reconstitution solvent to the actual weight, it was shaken for 15 min. Centrifugation was performed at 4°C and 18000 rpm for 10 min, 150 μL of supernatant was taken into a new 1.5 mL EP tube. Centrifugation was performed again at 4°C and 18000 rpm for 5 min, and 100 μL of supernatant was taken for sampling.

[0080] The sample detection was performed using a Q-TRAP® 5500 LC-MS / MS (AB SCIEX, USA; liquid phase was Shimadzu 20AD).

[0081] Chromatographic conditions: The chromatographic column type was Waters XBridgerRAmide 3.5 μm. The mobile phase A was 5 mM ammonium acetate (containing 500 μL / L formic acid), the mobile phase B was acetonitrile, the flow rate was 0.4 mL / min, the injection volume was 5 μL, and the column temperature was 40°C. The elution program was as follows: 0-3 min, 85%B; 3-6 min, 85-30%B; 6-15 min, 30-2%B; 15-18 min, 2%B; 18-19 min, 2-85%B; 19-26 min, 85%B.

[0082] Mass spectrometry conditions: ESI (electrospray ionization) ion source as ionization method, multiple reaction ion monitoring (MRM) as scanning method, positive ion mode detection; ion source temperature: 500℃; sheath gas N2flow rate: 65Arb; auxiliary gas N2: 70Arb; collision gas Ar pressure: 10Pa. IonSpray Voltage is set to +5500V; gas1, gas2 and curtain gas are set to 50, 50 and 30 psi respectively under two ionization modes. The specific mass spectrometry parameters of L-piperidinic acid are shown in Table 2.

[0083] Table 2 Mass spectrometry parameters of L-piperidinic acid

[0084] (16) Data analysis The experimental results were analyzed and processed by GraphPad Prism 8.1.0 (GraphPad Software Inc., Canada) software, and Student's t test was used for significance analysis. The data results are shown as the mean ± standard error (SEM, i.e. the standard deviation of the sample mean) of each group. The differences between groups are represented as * p<0.05, ** p<0.01, *** p<0.001, respectively. * indicates that the data difference has statistical significance, and n.s. indicates that there is no significant difference between groups, p>0.05.

[0085] Figure 2 F is -PipA + Effect of EcN colonization on the level of L-PipA in mouse serum Figure 2 G is L-PipA + Effect of EcN colonization on the level of L-PipA in mouse hypothalamus. Compared with the control group (the control group used the same experimental operation as described above), the L-PipA + EcN in the treatment group was significantly increased in serum ( P<0.01 ), and also significantly increased in the hypothalamus ( P<0.05 ), suggesting that the colonization of L-PipA + EcN can significantly increase the content of L-PipA in the tissues of the recipient mice.

[0086] As described above, although the present application has been shown and described with reference to specific preferred embodiments, it is not to be construed as a limitation on the present application itself. Various changes in form and detail can be made thereto without departing from the spirit and scope of the application as defined by the appended claims.

Claims

1. An engineered bacterium that produces L-piperidinic acid, characterized in that, The engineered bacteria are kanamycin-resistant. pRSF- Duet-1 The multiple cloning site of the plasmid is sequentially inserted into promoter J23105, followed by prokaryotic expression optimization. lat Genes and proC Genes, forming synthetic operons aligned in the same direction; the operons are then combined with linearized... pRSF-Duet-1 The plasmid vector is assembled by homologous recombination or Gibson assembly, transformed into E. coli for amplification, and sequenced to confirm the correct sequence and orientation of the inserted fragment before being transformed into a substrate culture.

2. The engineered bacteria according to claim 1, characterized in that, The sequence of promoter J23105 is shown in SEQ ID NO.1; optimized for prokaryotic expression. lat The gene sequence is shown in SEQ ID NO.2; Optimized by prokaryotic expression proC The gene sequence is shown in SEQ ID NO.

3.

3. The engineered bacteria according to claim 1, characterized in that, The substrate bacteria of the engineered bacteria are Escherichia coli Nissle 1917 Engineered strains.

4. The engineered bacteria according to claim 1, characterized in that, The engineered bacteria were constructed according to the following steps: (1) In kanamycin-resistant pRSF-Duet-1 The multiple cloning site of the plasmid is sequentially inserted into the constitutive promoter J23105, followed by prokaryotic expression optimization. lat Genes and proC Genes form synthetic operons arranged in the same direction; (2) pRSF-Duet-1 After linearization with a compatible restriction endonuclease, the plasmid was compared with the PCR-amplified J23105- plasmid containing homologous ends. lat Fragments and J23105- proC The fragments were assembled using Gibson to obtain recombinant plasmids. pRSF-J23105-lat- J23105- proC; (3) The recombinant plasmid obtained in step (2) is first transformed into E. coli for amplification and sequencing to confirm that the sequence and orientation of the inserted fragment are correct, and then transformed into E. coli by electroporation. Escherichia coli Nissle 1917 The first generation of engineered strains was obtained from the chassis strains and is designated L-PipA. + EcN ; The kanamycin-resistant pRSF-Duet-1 The sequence of the plasmid is shown in SEQ ID NO.4; The recombinant plasmid pRSF-J23105-lat- J23105- proC The sequence is shown in SEQ ID NO.

5.

5. The engineered bacteria according to claim 1, characterized in that, The culture method of the engineered bacteria is as follows: the engineered bacteria are inoculated into sterile LB liquid medium and cultured in a 37°C incubator for 24 hours. When the bacterial solution becomes turbid, it can be passaged.

6. The engineered bacteria according to claim 5, characterized in that, The sterile LB liquid culture medium contains 50 μg / ml kanamycin, 10 μg / ml pyridoxal phosphate, and 0.5 mM ferrous ammonium sulfate, with a pH of 7.

0.

7. The use of the engineered bacteria according to any one of claims 1-6 in the production of L-piperidine acid.

8. The use of the engineered bacteria according to any one of claims 1-6 in the preparation of antidepressant drugs.

9. The application according to claim 8, characterized in that, The drug is a live bacteria preparation.

10. The application according to claim 9, characterized in that, The concentration of the live bacteria preparation is 1×10⁻⁶. 9 CFU / mL.

Images