Clostridium butyricum engineering strain for treating colorectal cancer and application of clostridium butyricum engineering strain
By constructing an engineered strain of Clostridium butyricum and utilizing CRISPR-Cas9 gene editing and plasmid expression vectors, the problem of decreased CLMP protein expression in colorectal cancer was solved, achieving tumor-targeted localization and efficient expression, and significantly inhibiting colorectal cancer growth.
Patent Information
- Application Number
- CN202511747336.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-25
- Publication Date
- 2026-02-27
- Estimated Expiration
- 2045-11-25
AI Technical Summary
How to achieve efficient expression and targeted localization of CLMP protein in colorectal cancer, solve the problem of decreased expression in colorectal cancer treatment, and improve the enrichment of Clostridium butyricum in tumors and the efficiency of protein drug expression.
By constructing an engineered strain of Clostridium butyricum, and using CRISPR-Cas9 gene editing technology to knock out the purine synthesis-related gene purM and the protease gene lon, combined with the plasmid pMTL82151 expression vector and a specific promoter, the efficient expression and tumor-targeting localization of CLMP protein were achieved.
It significantly increased the expression level of CLMP protein in tumor cells, improved the therapeutic effect on colorectal cancer, and achieved precise enrichment and inhibition of Clostridium butyricum at the tumor site.
Smart Images

Figure CN121574891A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of molecular biology and microbiology, relates to the field of genetic engineering and biological medicine, and particularly relates to a Clostridium butyricum engineered strain for treating colon cancer and application thereof. BACKGROUND
[0002] Bacterial therapy is a strategy for treating cancer by using bacteria or their derivatives, and is also a relatively advanced method in tumor immunotherapy. This is based on the unique biological characteristics of bacteria: (1) natural tumor targeting and enrichment: bacteria can selectively colonize in the tumor core and preferentially grow in the hypoxic and necrotic tumor microenvironment (TMEs); (2) direct killing of tumor cells: by direct contact, secretion of toxins or enzymes to lyse tumor cells; (3) strong activation of the immune system: after bacteria enter the tumor, they are recognized by the immune system, triggering an inflammatory response, so that the bacteria are cleared by the immune system, and the tumor antigens released by the bacteria can specifically recognize and attack tumor cells, producing immunity; (4) as a targeted delivery carrier: by genetically engineering bacteria to carry and specifically express therapeutic drugs in tumors. Based on this, oncolytic bacteria are recognized as relatively ideal therapeutic drug carriers (especially strict anaerobic clostridia); they can enter tumor cells to directly destroy tumor cells, or act as delivery carriers to carry drugs or immune stimulating molecules to exert anti-tumor effects. Therefore, synthetic biology tools are used to modify bacteria to be used as new tumor-specific delivery systems.
[0003] Clostridium butyricum is a strict anaerobic gram-positive clostridium with the ability to withstand harsh environments such as strong acid, high temperature, and high salt. As a probiotic, Clostridium butyricum exerts its probiotic effects through various pathways: (1) regulating intestinal flora balance, inhibiting the growth of harmful bacteria, and enhancing the host's immunity; (2) enhancing immune regulation function, inhibiting excessive inflammatory response, and maintaining immune balance; preventing tumor occurrence; (3) producing short-chain fatty acids such as butyric acid to provide energy for the regeneration and repair of intestinal epithelial cells; (4) consuming oxygen in the local environment through metabolic activity to maintain an anaerobic environment. Furthermore, research has found that the cell wall components of Clostridium butyricum and the extracellular polysaccharides it produces can inhibit the growth of tumor cells. In summary, Clostridium butyricum has application prospects in tumor treatment. However, how to use Clostridium butyricum to achieve efficient expression of protein drugs remains a technical problem to be solved. Currently, there is no related report on using Clostridium butyricum as a protein drug expression vector.
[0004] CLMP protein (CXADR-like membrane protein) is a kind of membrane protein related to the regulation of human intestinal epithelial cell proliferation and tumor growth. Studies have found that the expression of CLMP protein decreases in colorectal cancer, and the deletion of CLMP can accelerate the tumorigenesis, growth and resistance to all-trans retinoic acid of colorectal cancer. Therefore, the increase of CLMP expression is expected to have a positive effect on the treatment of colorectal cancer. However, during the occurrence and development of colorectal cancer, the expression of CLMP in the colorectal cancer tissue of the body often shows a significant downward trend, which will directly aggravate the malignant progression of the tumor. Therefore, how to increase the expression of CLMP in tumor cells is a technical problem to be solved. SUMMARY
[0005] To solve the technical problem of efficient expression of CLMP protein in tumors in the prior art, the application innovatively provides a Clostridium butyricum engineering strain. The engineering strain expresses effector protein CLMP through pMTL82151 plasmid, realizes efficient expression of effector protein and precise positioning of tumor targeting, and produces unexpected technical effects. Moreover, the engineering strain can significantly inhibit the growth of tumors in a mouse model, providing a new idea for the treatment of colorectal cancer and having important practical application value.
[0006] The technical scheme of the application is a Clostridium butyricum engineering strain, which takes ATCC19398 Clostridium butyricum as a chassis strain and contains a recombinant expression vector expressing CLMP protein. The amino acid sequence encoding the CLMP protein is shown as SEQ ID NO: 1. The inventors have unexpectedly found that the Clostridium butyricum as a chassis strain can realize the expression of CLMP in tumor cells, which fundamentally solves the technical problem of decreased expression of CLMP protein in colorectal cancer and has important significance for the treatment of colorectal cancer.
[0007] The recombinant expression vector is selected from an expression vector containing a nucleotide sequence encoding CLMP protein, a promoter and a terminator. The expression vector is selected from plasmid pMTL82151. The promoter is Pta with a nucleotide sequence as shown in SEQ ID NO: 5, Ptb with a nucleotide sequence as shown in SEQ ID NO: 6, PrstA with a nucleotide sequence as shown in SEQ ID NO: 7 or abrBP with a nucleotide sequence as shown in SEQ ID NO: 8.
[0008] Preferably, the nucleotide sequence encoding the CLMP protein is shown as SEQ ID NO: 4.
[0009] Preferably, the Clostridium butyricum has a purin synthesis related gene purM with a nucleotide sequence as shown in SEQ ID NO: 2 knocked out. By knocking out the aforementioned gene purM, enrichment of Clostridium butyricum in tumors is achieved, thereby realizing precise positioning of the strain against tumors.
[0010] Preferably, the Clostridium butyricum has a protease gene lon with a nucleotide sequence as shown in SEQ ID NO: 3 knocked out. By knocking out the protease gene lon, the expression amount of the CLMP protein is significantly increased.
[0011] More preferably, the Clostridium butyricum has a purin synthesis related gene purM with a nucleotide sequence as shown in SEQ ID NO: 2 knocked out, and a protease gene lon with a nucleotide sequence as shown in SEQ ID NO: 3 knocked out. On the basis of knocking out the aforementioned gene purM, by knocking out the protease gene lon, the expression amount of the CLMP protein is significantly increased, thereby further improving the inhibition effect on tumors.
[0012] A pharmaceutical composition comprises the Clostridium butyricum engineering strain as described above and a pharmaceutically acceptable carrier. The administration mode of the pharmaceutical product is tail vein injection or oral administration.
[0013] Use of the Clostridium butyricum engineering strain or the pharmaceutical composition as described above in the preparation of a medicament for treating or preventing colorectal cancer.
[0014] Advantages of the present application:
[0015] (1) The present application provides a Clostridium butyricum engineering strain, which initiatively realizes the expression of CLMP in tumor cells, and fundamentally solves the technical problem of decreased expression of CLMP protein in colorectal cancer, which has important significance for the treatment of colorectal cancer.
[0016] (2) On the basis of the aforementioned Clostridium butyricum engineering strain, the present application realizes enrichment of Clostridium butyricum in tumors by knocking out the purin synthesis related gene purM, thereby realizing precise positioning of the strain against tumors.
[0017] (3) On the basis of the aforementioned Clostridium butyricum engineering strain, the present application realizes not only precise positioning of the strain against tumors, but also significantly increases the expression amount of the CLMP protein by the purin synthesis related gene purM and the protease gene lon, which has good application prospect and social significance in treating colorectal cancer. BRIEF DESCRIPTION OF DRAWINGS
[0018] ATTACHMENT Figure 1The diagram shows the purM gene information and protein domain structure in Example 1, as well as the construction diagram of the CRISPR-Cas9 knockout plasmid. Among them, (A) is the purM gene information and its structure diagram, (BC) is the construction diagram of the purM gene knockout plasmid pJZ23, (D) is the two-step diagram of constructing the ∆purM chassis strain using pLS2, and (E) is the assembly of the gene-targeting effector.
[0019] Appendix Figure 2 The image shows the verification diagram of the ∆purM strain in Example 1. Among them, (A) is the gel electrophoresis analysis result of the ∆purM knockout mutant, (B) sequence alignment and sequencing peak diagram of WT and ∆purM mutant, (C) RT-qPCR detection of purM gene expression, and (D) plasmid loss of ∆purM mutant by photocopy plate method.
[0020] Appendix Figure 3 The diagram shows the lon gene information and protein domain structure in Example 1, as well as the construction diagram of the CRISPR-Cas9 knockout plasmid. Among them, (A) is the lon gene information and its structure diagram, (BC) is the construction diagram of the lon gene knockout plasmid pJZ23, (D) is the two-step diagram of constructing the Δlon chassis strain using pLS4, and (E) is the assembly of the gene-targeting effector.
[0021] Appendix Figure 4 The images show the verification diagrams of the ∆lon strain and the ∆purM∆lon strain in Example 1; (A) gel electrophoresis analysis of the ∆lon knockout mutant, (B) sequence alignment and sequencing peak diagram of the WT and ∆lon mutant, (C) RT-qPCR detection of purM gene expression, and (D) gel electrophoresis analysis of the ∆purM∆lon double mutant.
[0022] Appendix Figure 5 This section describes the determination of the growth rate and motility of the ΔpurM strain in Example 1. Specifically, (A) the growth curve of the strain was determined; (B) the motility of the WT, ΔpurM, and ::purM strains was determined; and (C) the motility of the WT, ΔpurM, and ::purM strains was statistically analyzed. ∗ indicates P < 0.05, ∗∗ indicates P < 0.01, *** indicates P < 0.001, and **** indicates P < 0.0001.
[0023] Appendix Figure 6 The screening of constitutive strong promoters in Example 1 includes: (A) plasmid construction for expressing gusA protein with different promoters, (B) GUS staining images of different promoter groups, and (CD) GUS enzyme activity detection images.
[0024] Appendix Figure 7This is an example of the expression of effector proteins in the engineered strain in Example 2; wherein, (A) is a schematic diagram of the constructed Clostridium butyricum engineered strain, and (B) is a Western Blot analysis of the expression of CLMP protein in the engineered strain.
[0025] Appendix Figure 8 The effect of the fragmented contents of the engineered strain in Example 3 on the apoptosis ability of CT26 cells; (A) a representative flow cytometry plot of the effect of the fragmented contents of the engineered strain on the apoptosis of CT26 cells; (B) analysis of the total apoptosis rate of CT26 cells under different interventions; *P<0.05, **P<0.01.
[0026] Appendix Figure 9 The effect of the fragmented contents of engineered strains on the migration ability of CT26 cells.
[0027] Appendix Figure 10 Example 4 shows the detection of bacterial colonization inside a small animal tumor using imaging tracking. Among them, (A) is a schematic diagram of the construction and administration method of the mouse subcutaneous tumor model, (B) is an image of the mouse 72 hours after the third tail vein injection of the strain, and (C) is a statistical graph of the fluorescence intensity of the mouse images at different times after the third tail vein injection of the strain.
[0028] Appendix Figure 11 The study aimed to investigate the inhibitory effect of engineered bacterial strains on tumor growth in tumor-bearing mice. (A) Tumor images of tumor-bearing mice in different intervention groups, and (B) Body weight analysis of tumor-bearing mice in different intervention groups.
[0029] Appendix Figure 12 The study investigated the effects of engineered bacterial strain intervention on cytokines in tumor-bearing mice. Note: (A) Changes in Caspase-3 content in tumor tissue homogenate from tumor-bearing mice; (B) Changes in TGF-β content in tumor tissue homogenate from tumor-bearing mice; (C) Changes in TNF-α content in tumor tissue homogenate from tumor-bearing mice; (D) Changes in IL-10 content in tumor tissue homogenate from tumor-bearing mice. One-way ANOVA was used for comparisons between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0030] Appendix Figure 13 The effect of engineered bacterial strain intervention on splenic lymphocytes in tumor-bearing mice; (A) flow cytometry diagram of splenic cells in tumor-bearing mice, (B) CD8+ cells in the spleen of CT26 tumor-bearing mice in different intervention groups. + Representative flow cytometry images of T lymphocytes, (C) CD4 cells in the spleen of CT26 tumor-bearing mice in different intervention groups. +Quantitative analysis of lymphocytes; one-way ANOVA was used for intergroup comparisons, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0031] Appendix Figure 14 The study investigated the effect of engineered bacterial strain intervention on the proliferation of tumor cells in tumor-bearing mice. (A) Representative immunohistochemical images of Ki67 in tumor tissues of CT26 tumor-bearing mice from different intervention groups; (B) Quantitative analysis of Ki67 in tumor tissues of CT26 tumor-bearing mice from different intervention groups. One-way ANOVA was used for comparisons between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.
[0032] Appendix Figure 15 To investigate the effects of engineered bacterial strains on the pathological changes of major organs in tumor-bearing mice, HE staining analysis was performed on the major organs (heart, liver, spleen, lung, and kidney) of CT26 tumor-bearing mice after different interventions.
[0033] Appendix Figure 16 The effect of engineered strains on bacterial content in different tissues of tumor-bearing mice is shown; (A) bacterial distribution in tissues of tumor-bearing mice after treatment with engineered strains, and (BE) bacterial PCR identification of tumor tissues treated with engineered strains.
[0034] Appendix Figure 17 For biochemical analysis; (A) Mean corpuscular hemoglobin (MCH) content in peripheral blood of tumor-bearing mice in the engineered strain intervention group. (B) White blood cell (WBC) content in peripheral blood of tumor-bearing mice in the engineered strain intervention group. Detailed Implementation
[0035] The present invention will be further described below with reference to the embodiments.
[0036] Example 1: Construction of effector protein expression chassis cells
[0037] (1) Construction of chassis cells
[0038] CRISPR-Cas9 is a bacterial immune system based on nucleases. A schematic diagram of its gene-editing principle is attached. Figure 1 . Figure 1 A represents the purM gene information and its structural diagram; as shown below. Figure 1 As shown in Figure A, the purM gene is flanked by the purF and purN genes; the numbers in the upper diagram represent the gene length in bp, and the numbers in the lower diagram represent the amino acid positions. Figure 1 B-1C is a schematic diagram illustrating the construction of the purM gene knockout plasmid pJZ23. (For example...) Figure 1As shown in B-1C, PsRNA-pre-crRNA, the upstream homologous arm (Up-arm), and the downstream homologous arm (Down-arm) were assembled and ligated to the BtgZI site of pLS1 in a single step using a one-step cloning method. Figure 1 D is a schematic diagram of the two steps in constructing the ∆purM chassis strain using pLS2. Figure 1 E represents the assembly of gene-targeting effectors. For example... Figure 1 As shown in E, the Cas9 nuclease processes pre-crRNA into mature crRNA and assembles it into a gene-targeting effector. In this embodiment, CRISPR-Cas9 gene editing technology was used to knock out the *Clostridium butyricum* purM gene, constructing the ∆purM mutant strain (see details). Figure 2 ).
[0039] Figure 2 A represents the gel electrophoresis analysis of the ∆purM mutant strain for PCR identification of the colonies. Lane M represents the DNA molecular weight standard, lane 1 is for wild-type Clostridium butyricum (WT) detection (ATCC19398), and lanes 2-7 are for the ∆purM mutant strain detection group. Figure 2 As shown in Figure A, the molecular size of the ∆purM mutant strain is 849 bp, and all selected colonies show mutations. Figure 2 B shows the sequence alignment and sequencing peak diagram of the WT and ∆purM mutant strains. Figure 2 As shown in B, the sequencing verification results indicate that 511 bp was successfully deleted, confirming the knockout of the purM gene in Clostridium butyricum. Figure 2 C represents the purM gene expression detected by RT-qPCR. The green bars represent the purM gene expression level in WT, and the purple bars represent the purM gene expression level in the ::purM strain. ∗ This indicates that P < 0.05; ∗∗ This indicates that P < 0.01; *** This indicates that P < 0.001. **** Let n represent P < 0.0001, and n represent P > 0.05. (From...) Figure 2 C indicates that the purM gene is not expressed in the ∆purM mutant strain. Figure 2 D represents plasmid loss plate copying, by Figure 2 As shown in D, the ∆purM mutant strain was successfully constructed by performing plasmid loss on the ∆purM mutant strain.
[0040] Similarly, in this embodiment, CRISPR-Cas9 gene editing technology was used to knock out the lon gene in Clostridium butyricum, constructing the ∆lon mutant and the ∆purM∆lon mutant; a schematic diagram of the gene editing principle is shown in the appendix. Figure 3 ,and Figure 1 Consistent.Figure 3 A represents the Lon gene information and its structural diagram; as shown below. Figure 3 As shown in Figure A, the lon gene is flanked by the yihA and lonB genes; the numbers in the upper diagram represent the gene length in bp, and the numbers in the lower diagram represent the amino acid positions. Figure 3 B-3C is a schematic diagram of the construction of the Lon gene knockout plasmid pJZ23; PsRNA-pre-crRNA, upstream homologous arm (Up-arm), and downstream homologous arm (Down-arm) are assembled and ligated to the BtgZI site of pLS3 in one step using a one-step cloning method. Figure 3 D is a schematic diagram of the two steps in constructing the ∆lon chassis strain using pLS4. Figure 3 E represents the assembly of gene-targeting effectors.
[0041] in Figure 4 Lane A represents the gel electrophoresis analysis of the ∆lon mutant strain, used for PCR identification of colonies of the ∆lon and ∆purM∆lon mutant strains. Lane M represents the DNA molecular weight standard, lane 1 is for Clostridium butyricum detection, and lanes 2-9 are for the ∆lon mutant strain detection group. Figure 4 As shown in Figure A, the ∆lon mutant has a molecular size of 500 bp, and all selected colonies show mutations. Figure 4 B shows the sequence alignment and sequencing peak diagram of the WT and ∆lon mutant strains; from Figure 4 As shown in B, the sequencing verification results indicate that 2340 bp was successfully deleted, confirming the knockout of the LON gene in Clostridium butyricum. Figure 4 C represents the purM gene expression detected by RT-qPCR. The green bars represent the lon gene expression level in WT, and the purple bars represent the lon gene expression level in the ::lon strain. ∗ This indicates that P < 0.05; ∗∗ This indicates that P < 0.01; *** This indicates that P < 0.001. **** Let n represent P < 0.0001, and n represent P > 0.05. (This is from...) Figure 4 C indicates that the lon gene is not expressed in the ∆lon mutant strain. Figure 4 D represents the gel electrophoresis analysis of the ∆purM∆lon mutant strain. Lane M is the DNA molecular weight standard, lane 1 is for Clostridium butyricum detection, and lanes 2-17 are for simultaneous detection of the purM and lon genes in the same colony. All selected colonies showed mutations, indicating that the ∆purM∆lon mutant strain was successfully constructed.
[0042] The purM gene was amplified from *Clostridium butyricum* using primer pairs HW2015 / HW2016. The pMTL82151 vector was linearized with BamHI and ligated to the purM gene. This ligation was then used to transform competent cells, and purM gene complementation plasmids were screened. The complementation plasmids were then combined with the aforementioned transformation method to transform *ΔpurM* strains, resulting in the *::purM* complementation strain. Similarly, the *::lon* complementation strain was constructed using primer pairs HW2501 / HW2502. The relevant primer sequences are shown below.
[0043] HW2015: gaattcgagctcggtacccggatctccttctcaggaaataaga
[0044] HW2016: Cgcgtgacgtcgactctagactattttaaacaaacaccttcacc
[0045] HW2501: gagctcggtacccggggatccCTTTTCATTGCCTTATATATCTTTTAATCTA
[0046] HW2502: gacgtcgactctagaggatccATGAAAAAGTTATATACAATTCCGCTAAT
[0047] Based on the successful construction of the aforementioned mutant and complemented strains, this embodiment performed basic phenotypic determination on the mutant strain. The results are detailed in [link to documentation]. Figure 5 .in, Figure 5 A represents the growth curve determination of the strain; the horizontal axis represents the measurement time, and the vertical axis represents the OD (Organization Rate). 600 .like Figure 5As shown in A, based on the growth curves of the strains WT (wild-type Clostridium butyricum ATCC19398), ΔpurM mutant, ::purM complemented strain, Δlon mutant, ::lon complemented strain, and ΔpurMΔlon mutant, it can be seen that: (1) WT grows faster than ΔpurM mutant strain before 6 h, but after 6 h, when WT's OD reaches 2.00, it stops growing and does not show autolysis; (2) ::purM strain grows at a rate close to ΔpurM mutant strain; (3) Δlon mutant strain grows faster than WT before 9 h and reaches its maximum growth rate first, while ::lon strain grows at a rate close to Δlon mutant strain; (4) ΔpurMΔlon grows slower than WT, ΔpurMΔlon grows faster than ΔpurM, and ΔpurMΔlon grows slower than Δlon. Therefore, it can be seen that when the purM gene is missing, the purine synthesis pathway of the strain is blocked, and the growth rate is slower than that of WT; when the lon gene is missing, it degrades the protease channels of several "positive growth regulators", and the growth rate is faster than that of WT. Figure 5 B5-C is used to determine the motility of bacterial strains; among them... Figure 5 B represents the growth height of WT, ∆purM, and ::purM on a semi-solid culture medium, indicating the motility of the strain. Figure 5 C represents the statistical value of the strain's motility. ∗ This indicates that P < 0.05. ∗∗ This indicates that P < 0.01. *** This indicates that P < 0.001. **** Let n represent P < 0.0001, and n represent P > 0.05. (This is from...) Figure 5 According to B-5C, in semi-solid culture medium, the motility of ∆purM was significantly reduced compared to WT (P < 0.05), while the motility of ::purM was restored. This indicates that the deletion of the purM gene leads to a decrease in the motility of the strain.
[0048] (2) Screening of constitutive strong promoters
[0049] The promoter is a key DNA sequence that initiates gene transcription and is the first and most crucial regulatory step in the protein expression process. This example screened for constitutive strong promoters; the results are detailed below. Figure 6 .in, Figure 6A consists of plasmids constructed to express the gusA protein using different promoters. The purpose is to screen for effector expression promoters using gusA as a reporter gene. Screening targets include a control group, Pta (pyruvate, phosphokinase promoter) as shown in SEQ ID NO: 5, Ptb (phosphotransporter promoter) as shown in SEQ ID NO: 6, PrstA (peptide transport system A promoter) as shown in SEQ ID NO: 7, and abrBP (pseudoprotein-binding chaperone promoter) as shown in SEQ ID NO: 8. Figure 6 As shown in A, different promoters have different activation strengths for genes, from strongest to weakest: Pta>Ptb>PrstA>abrBP.
[0050] Figure 6 B shows GUS staining images of different promoter groups, i.e., the fluorescence values after reacting with the reaction substrate 4-MUG and gusA as the reporter gene; specifically, the fluorescence values of the mixed reaction mixture at an excitation wavelength of 365 nm and an emission wavelength of 455 nm were detected at 0 min, 15 min, and 30 min, respectively. Figure 6 As shown in B, different promoters have different activation strengths for genes, from strongest to weakest: Pta>Ptb>PrstA>abrBP. Figure 6 C is the GUS enzyme activity assay graph, specifically a graph showing the change in fluorescence value in the solution over time from 0 to 30 minutes; Figure 6 As shown in C, the Pta promoter is the constitutive promoter with the highest startup efficiency. Therefore, the Pta promoter is the preferred choice.
[0051] Example 2: Expression of effector protein CLMP in constructed chassis cells
[0052] In this embodiment, the engineered bacterial chassis cells constructed in Example 1 express the CLMP effector protein, as detailed in [link to example]. Figure 7 This embodiment uses pta, ptb, PrstA, and abrBP, which were screened in Example 1, and all of them can initiate the expression of CLMP protein. The following is a detailed explanation using pta as the promoter with the best expression. The specific operation is as follows:
[0053] (1) Constructing the pMTL82151_pta_CLMP basic plasmid:
[0054] Using the genome of *Clostridium beyerrix* strain 8052 as a template, the pta promoter fragment was amplified from *Clostridium beyerrix* using primer pair HW1637 / HW1638. The CLMP protein sequence was synthesized and codon-optimized at GenScript. The relevant primer sequences are as follows:
[0055] HW1637:gagctcggtacccggggatccTATTCAGAACATTAAAAGAATGGTGAAT
[0056] HW1638: catAATCTATTTATCTCCTCTCTATATCCTATCTCTA
[0057] (2) Expression and detection of CLMP protein in the chassis cells of engineered Clostridium butyricum strain:
[0058] First, the pMTL82151_pta_CLMP plasmid constructed in step (1) was transformed into *E. coli* CA434. Transformants were obtained and transferred to LB broth for culture. After the strains grew, they were mixed with *Clostridium butyricum* engineered strain culture and spotted onto RCMS solid plates for conjugation transformation. After 18 hours, the bacterial cells were scraped off and spread on RCMS medium containing D-cyclic serine and thiamphenicol for screening transformants. After expansion culture in RCM broth, the bacterial cells were collected, lysed, and subjected to Western blotting to determine the expression of effector proteins in different chassis strains. Results are detailed in [link to relevant documentation]. Figure 7 B. By Figure 7 B indicates that CLMP protein was successfully expressed in WT, Δlon, and ΔpurMΔlon strains, with a protein size of approximately 40 kDa. Figure 7 A is a schematic diagram of the engineered Clostridium butyricum strain constructed in this embodiment. Figure 7 As shown in Figure A, the purM and lon genes were knocked out in the engineered strain of Clostridium butyricum (ΔpurMΔlon mutant), and the effector protein CLMP was successfully expressed using an exogenous plasmid.
[0059] Example 3: In vitro cell experiments to verify the effect of engineered strains on CT26 cells
[0060] (1) Tumor cell apoptosis analysis
[0061] After removing the cryopreserved CT26 cells from the -80℃ freezer, quickly place them in a preheated 37℃ water bath. Shake the cryovials continuously until thawed. Add 2 mL of complete culture medium, centrifuge at 1000 rpm for 3 min, and discard the supernatant. Gently resuspend the cells in 5 mL of complete culture medium, transfer to a cell culture flask, and gently shake to disperse the cells. Label the flask and incubate at 37℃ with 5% CO2. Change the medium the next day and observe cell morphology. Once the cells have reached confluence, passage them. Culture the engineered strain. When the OD600 reaches 0.8, collect the cells, wash three times with PBS, resuspend, and lyse. Centrifuge and collect the supernatant. Co-culture the lysed contents with CT26 cells for 16 h. Collect the cells, stain with antibodies, and analyze the results. See details below. Figure 8 .
[0062] Appendix Figure 8 The effect of the fragmented contents of engineered bacterial strains on the apoptosis ability of CT26 cells; among which, Figure 8 A is a representative flow cytometry plot showing the effect of engineered strain fragmentation on CT26 cell apoptosis. (See diagram for example.) Figure 8 As shown in Figure A, the total apoptosis rate of cells in the blank control group was 4.90% ± 0.50%, the total apoptosis rate of cells in the WT group was 10.17% ± 0.12%, the total apoptosis rate of cells in the WT::CLMP group (WT expressing CLMP protein) was 22.24% ± 4.67%, the total apoptosis rate of cells in the Δlon::CLMP group (Δlon mutant expressing CLMP protein) was 34.24% ± 4.44%, and the total apoptosis rate of cells in the ΔpurMΔlon::CLMP group (ΔpurMΔlon mutant expressing CLMP protein) was 21.31% ± 2.42%. Figure 8 B represents the quantitative analysis of early apoptosis in CT26 cells under different interventions. Figure 8 It can be seen that (1) compared with the control group, the apoptosis of cells in the WT group and the engineered strain intervention group increased. This indicates that the engineered strain after expressing the exogenous protein is the same as the wild-type strain WT, and both have the function of inhibiting tumor cell growth and promoting tumor cell apoptosis. In addition, it is worth noting that the apoptosis rate of the Δlon::CLMP group was the highest, reaching (34.24%±4.44%), and there was a statistically significant difference compared with the WT group (P<0.01). This is because the CLMP protein is overexpressed in Clostridium butyricum. The CLMP protein can directly bind to the β-catenin protein, reduce the entry of free β-catenin into the cell nucleus, thereby weakening the Wnt / β-catenin transcriptional activity, inhibiting the expression of the downstream gene CYP26A1, and thus promoting tumor cell apoptosis.
[0063] (2) Cell scratch assay to verify the effect of the fragmented contents of the engineered strain on the migration ability of CT26 cells.
[0064] After removing the cryopreserved CT26 cells from the -80℃ freezer, quickly place them in a preheated 37℃ water bath. Shake the cryovials continuously until thawed. Add 2 mL of complete culture medium, centrifuge at 1000 rpm for 3 min, and discard the supernatant. Gently resuspend the cells in 5 mL of complete culture medium, transfer to a cell culture flask, and gently shake to disperse the cells. Label the flask and incubate in a 37℃ incubator containing 5% CO2. Change the medium the next day and observe cell morphology. Once the cells have reached confluence, perform a scratch test. After scratching, remove excess cells from the scratch path with PBS to ensure a clean scratch. Culture the engineered bacterial strain. When the OD600 of the strain reaches 0.8, collect the cells, wash three times with PBS, resuspend the cells, and lyse. Centrifuge and collect the supernatant. Co-culture the lysate with CT26 cells and photograph them using a fluorescence microscope at 0 h, 24 h, and 48 h. See details for the results. Figure 9 .
[0065] like Figure 9 As shown, (1) cells in the control group (PBS) had a stronger ability to migrate from the edge of the scratch to the center, and the scratch area shrank significantly over time, almost completely healing after 48 h; (2) cells in the experimental groups (WT, WT::CLMP, Δlon::CLMP, ΔpurMΔlon::CLMP) migrated slowly, cell proliferation and migration activity at the scratch edge decreased, and the residual scratch area was significantly larger than that in the control group. It can be seen that the cell migration rate was significantly slowed down after intervention by engineered strains; this indicates that both Clostridium butyricum strains and the aforementioned engineered strains can inhibit cell migration ability.
[0066] Example 4: In vivo animal experiments to verify the use of engineered strains expressing effector proteins for the treatment of colorectal cancer.
[0067] (1) Culture of colorectal cancer cells
[0068] After removing the cryopreserved CT26 cells from the -80℃ freezer, quickly place them in a preheated 37℃ water bath. Shake the cryovials continuously until thawed. Add 2 mL of complete culture medium, centrifuge at 1000 rpm for 3 minutes, and discard the supernatant. Gently resuspend the cells in 5 mL of complete culture medium, transfer to a cell culture flask, and gently shake the flask to disperse the cells. Label the cells and incubate in a 37℃ incubator containing 5% CO2. Change the medium the next day and observe cell morphology.
[0069] (2) Constructing a mouse model of colorectal cancer
[0070] Female Balb / C mice aged 6-8 weeks, weighing 18-20 g, were purchased from Beijing Sibeifu Biotechnology Co., Ltd. Before the experiment, the mice were acclimatized for one week. They were housed in a specific pathogen-free environment with equal day and night lengths, at a room temperature of 23℃ ± 2℃, with 5 mice per ventilated cage, and free access to food and water. CT26 cells in good logarithmic growth phase (cell density reaching 80%-90%) were changed in medium one day in advance. The following day, a CT26 cell suspension was prepared using PBS, and its concentration was adjusted to 5×10⁻⁶. 5 / mL. Hair was removed from the middle and back of the right axilla of the mice with depilatory cream, and the skin at the injection site was wiped with 75% alcohol. 200 μL of cell suspension was injected subcutaneously into each mouse to construct a CT26 colorectal cancer-bearing mouse model. (3) Engineered strains expressing CLMP protein were used to treat colorectal cancer.
[0071] Mice that had been acclimatized for one week were randomly divided into 6 groups of 5 mice each: PBS control group (blank control), WT group (wild-type strain), ∆purM, WT::CLMP, ∆lon::CLMP, and ∆purM∆lon::CLMP intervention group (engineered strain). When the mouse tumor volume reached 100 mm... 3 After lateral retraction, inject 100 μL of 5×10 solution into the tail vein using a 30 G needle. 8 CFU-corresponding wild-type or engineered strains (bacterial cells suspended in 100 μL PBS). Three tail vein injections were administered throughout the experiment to ensure successful administration. Mice were euthanized when the tumor diameter exceeded 2 cm. During treatment, the activity level of mice in each group was observed daily, and the survival time was recorded to generate survival curves. Mouse weight and tumor volume were recorded every three days. The tumor volume was calculated using the formula: Tumor volume (mm³) = 0.5 × length × width. 2 .
[0072] Appendix Figure 10 This document describes the process of implementing the aforementioned engineered bacteria treatment for colorectal cancer and uses small animal imaging to track bacterial accumulation in mice. Among other things, Figure 10 A is a schematic diagram illustrating the process of treating tumors in tumor-bearing mice with engineered bacteria, including the construction of the mouse subcutaneous tumor model and the administration method. Figure 10 B is a fluorescence imaging image of a small animal taken 72 hours after the third tail vein injection of the engineered strain. Figure 10 C represents the statistical results of fluorescence imaging in small animals after the third tail vein injection of the engineered strain. For example... Figure 10As shown in Figure B, different engineered bacterial strains were injected via the tail vein, resulting in fluorescence signals of varying intensities in the tumor region, indicating that the strains could grow in the tumor area. The fluorescence intensity was strongest in the ∆purM group and the ∆purM∆lon::CLMP group. This indicates that the bacteria in these groups showed increased enrichment in mouse tumors, suggesting that knocking out the purM gene led to increased bacterial enrichment in mouse tumors. The increased enrichment of Clostridium butyricum in tumors and the engineered strains expressing effector proteins demonstrated the ability to inhibit tumor growth, and physiological and biochemical indicators in mice were also analyzed.
[0073] Appendix Figure 11 This study investigated the inhibitory effect of engineered bacterial strains on tumor growth in tumor-bearing mice. Among these... Figure 11 A shows the tumor structures in tumor-bearing mice from different intervention groups. Figure 11 A shows that: (1) compared with the PBS control group, the tumor volume in the WT group showed a slight decreasing trend; (2) after expressing the effector protein CLMP in Clostridium butyricum, the tumor volume of tumor-bearing mice was further significantly reduced on the basis of the wild-type strain group. This indicates that Clostridium butyricum itself also has a tumor-suppressing effect, and by expressing the effector protein CLMP, its tumor-suppressing effect is more obvious. Figure 11 B is a bar chart showing the changes in body weight of mice in different treatment groups. In summary: (1) Compared with the control group, tail vein injection of Clostridium butyricum reduced the tumor volume of mice, indicating that Clostridium butyricum itself can inhibit tumor growth; (2) When Clostridium butyricum knocked out the purM gene, the accumulation of Clostridium butyricum in the tumor increased, and the tumor size of the ∆purM group decreased compared with the WT group; (3) When Clostridium butyricum overexpressed CLMP, the tumor size decreased compared with the WT group; (4) After the CLMP protein in the ∆lon::CLMP group increased, the tumor size decreased compared with the WT::CLMP group; (5) Compared with the ∆lon::CLMP group, the ∆lon∆purM::CLMP group showed the most significant effect in inhibiting tumor growth. Therefore, the expression of the anti-tumor protein CLMP by Clostridium butyricum can achieve good anti-tumor effects, and knocking out the purM gene / knocking out the lon gene / knocking out the purM gene + lon gene will further enhance the anti-tumor effect.
[0074] (4) Cytokine detection
[0075] At the treatment endpoint, a portion of tumor tissue was excised from mice, accurately weighed, and placed in RIPA protein lysis buffer. The tissue was then homogenized using a low-temperature homogenizer at 70 Hz for 60 seconds, followed by a 20-second pause, repeated 5 times. The homogenate was then placed on ice for 30 minutes. After lysis, the homogenate was centrifuged at 12,000 rpm at 4°C for 10 minutes. The supernatant was transferred to a clean Eppendorf tube, and protein concentration was determined using the BCA method. The concentrations of Caspase-3, TGF-β, TNF-α, and IL-10 in the mouse tissue homogenate were detected using an ELISA kit. See attached results. Figure 12 The detection method, taking Caspase-3 as an example, involves the following steps:
[0076] ① Sample and standard preparation: Take 50 μL of the sample to be tested (diluted 1:1 with sample diluent) and the standard and add them to the reaction wells in sequence.
[0077] ② Add biotin-labeled antibody: Immediately add 50 μL of biotin-labeled antibody, which will bind to the target molecule in the sample or standard.
[0078] ③Incubation: Incubate at 37°C for 1 hour to promote antigen-antibody reaction.
[0079] ④ Washing: Fill each well with washing buffer, shake for 30 seconds, shake off the washing buffer, and pat dry with absorbent paper. Repeat this process 3 times to remove unbound antibodies and other impurities.
[0080] ⑤ Add avidin-HRP: Add 80 μL of avidin-HRP to each well and incubate at 37°C for 30 min.
[0081] ⑥ Re-incubate and wash: further promote the reaction and remove unbound reagents.
[0082] ⑦ Add substrates: Add 50 μL of substrate A and 50 μL of substrate B to each well, and incubate at 37°C for 10 min. Avoid light exposure.
[0083] ⑧ Terminate the reaction and measure: Add 50 μL of stop solution. The results should be measured immediately after adding the stop solution. Measure the OD value of each well at a wavelength of 450 nm.
[0084] Appendix Figure 12 The effects of engineered bacterial strain intervention on cytokines (Caspase-3, TGF-β, TNF-α, and IL-10) in tumor-bearing mice were investigated. Figure 12A) Changes in Caspase-3 content in tumor tissue homogenate of tumor-bearing mice; (B) Changes in TGF-β content in tumor tissue homogenate of tumor-bearing mice; (C) Changes in TNF-α content in tumor tissue homogenate of tumor-bearing mice; (D) Changes in IL-10 content in tumor tissue homogenate of tumor-bearing mice. One-way ANOVA was used for comparisons between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Figure 12 As shown, at the end of treatment in mice, the levels of apoptosis factor Caspase-3, tumor necrosis factor TNF-α, and interleukin-10 in tumor tissue homogenate all increased, while the level of transforming growth factor TGF-β decreased; this indicates that the aforementioned engineered strains all have an inhibitory effect on tumors in tumor-bearing mice, consistent with the changes in the tumor itself in mice.
[0085] (5) Flow cytometry analysis of mouse spleen lymphocytes
[0086] ① Extraction of mouse spleen cells
[0087] At the treatment endpoint in each group of mice, fresh spleens were collected and washed twice with pre-chilled PBS. The spleens were gently and repeatedly ground using the black rubber end of a syringe, and spleen cells were filtered through a sterile 200-mesh nylon sieve. The sieve and syringe end were then rinsed with pre-chilled PBS to collect as many cells as possible, forming a cell suspension. This suspension was collected in centrifuge tubes and centrifuged at 1500 rpm for 5 min, discarding the supernatant. 3 mL of 1× RBC lysis buffer was added for resuspending, vortexed, and lysed at room temperature for 5 min. The suspension was then neutralized with an equal volume of pre-chilled PBS, centrifuged at 1500 rpm for 5 min, and the supernatant was discarded. The cells were washed once more with PBS, then resuspended in PBS for cell counting. Cells were counted at a ratio of 1x102. 6 The cells were aliquoted into different centrifuge tubes, and the volume was brought up to 1 mL with pre-cooled PBS. The mixture was then vortexed to obtain a single-cell suspension.
[0088] ② Mouse T lymphocyte detection
[0089] Flow cytometry was used to detect changes in mouse spleen T lymphocytes. Single-cell suspensions were stained with antibodies, incubated at 4°C in the dark for 30 min, then washed with 1 mL of Stain Buffer and centrifuged twice, discarding the supernatant. Finally, the cells were resuspended in 350 μL of Stain Buffer, placed on ice, and samples were collected using a BD flow cytometer with BD FACSDiva software (BD Biosciences). Data were analyzed using FlowJo software. See below for results. Figure 13 .
[0090] Appendix Figure 13 The effect of engineered bacterial strain intervention on spleen lymphocytes in tumor-bearing mice. Among them, [the following is a partial sentence fragment]. Figure 13 A is a flowchart of the process for detecting T lymphocytes in tumor-bearing mice; Figure 13 B represents the CD8+ cells of the spleen of CT26 tumor-bearing mice in different intervention groups. + Representative flow cytometry images of T lymphocytes. (Source: [Insert image here]) Figure 13 As shown in Figure B, compared with the control group, the proportion of CD8+ T cells in the WT group, ∆purM group, WT::CLMP group, ∆lon::CLMP group, and ∆lon∆purM group were all significantly increased, indicating that the intervention of engineered strains activated the immune response and increased anti-tumor activity. Based on the significant tumor-suppressive effect of engineered Clostridium butyricum on CT26 tumor-bearing mice, this study further examined its effect on splenic lymphocytes in tumor-bearing mice. Figure 13 C represents the CD4 count in the spleen of CT26 tumor-bearing mice from different intervention groups. + Quantitative analysis of lymphocytes. One-way ANOVA was used for comparisons between groups. *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001. Figure 13 As shown in Figure C, compared with the engineered strain group, the proportion of CD3+CD8+ T cells in the control group increased (P<0.0001). This indicates that the intervention of the engineered strain caused changes in the immune response in the spleen of tumor-bearing mice, significantly enhanced the anti-tumor activity of the body, and thus inhibited the occurrence and development of tumors.
[0091] (6) Immunohistochemical staining analysis of tumor tissue proliferation
[0092] Mouse tumor tissue was dissected, and a portion of the tissue was fixed in 4% paraformaldehyde solution. The tissue was then dehydrated and cleared using a gradient of ethanol and xylene concentrations. After clearing, the tissue was embedded in paraffin wax, sectioned, and baked at 60°C for 2 hours. The sections were then dewaxed sequentially in different concentrations of xylene and anhydrous ethanol. Cell proliferation in the mouse tumor tissue was analyzed using a polyclonal Ki67 antibody (1:500 dilution). After dewaxing and hydration of the tissue sections, antigen retrieval was performed for 15 minutes using a boiling water bath and 0.01 mmol / L citrate buffer at pH 6. Subsequently, endogenous peroxidase was blocked with 3% hydrogen peroxide at room temperature for 15 minutes, followed by overnight incubation at 4°C with primary antibody at 1:200 or 1:500 dilutions. The tissue sections were then washed three times with PBS for 3 minutes each time. HRP-labeled goat anti-rabbit / mouse secondary antibody was added to a glass slide and incubated at 37°C for 30 min. After rinsing with PBS, DAB chromogenic solution was added. Under a microscope, positive signals appeared as brownish-yellow or brownish-red, and cell nuclei appeared blue. See details for results.Figure 14 .
[0093] Appendix Figure 14 The effect of engineered bacterial strain intervention on tumor cell proliferation in tumor-bearing mice. Figure 14 A shows representative immunohistochemical images of Ki67 tumor tissue from CT26 tumor-bearing mice in different intervention groups; such as... Figure 14 As shown in Figure A, both the control group and different intervention groups showed positive signals of brownish-yellow or brownish-red color, indicating that they all expressed Ki67. Figure 14 B represents the quantitative analysis of Ki67 in tumor tissues of CT26 tumor-bearing mice from different intervention groups. (For example...) Figure 14 As shown in Figure B, compared to the control group, the number of Ki67-positive cells in different intervention groups showed a decreasing trend, indicating a reduction in tumor cell proliferation after intervention. This is consistent with the changes in mouse tumor structure and cytokine detection results, both demonstrating the inhibitory effect of Clostridium butyricum engineered strains on colorectal cancer tumors.
[0094] Example 5: Safety evaluation of engineered strains expressing effector proteins for the treatment of colorectal cancer
[0095] (1) Tumor tissue pathological analysis
[0096] HE staining analysis of major organs in CT26 tumor-bearing mice from different intervention groups. Specifically, tumor tissue was dissected from mice, and a portion of the tissue was fixed in 4% paraformaldehyde solution. The tissue was then dehydrated and cleared using gradient concentrations of alcohol and xylene. After clearing, the tissue was embedded in paraffin wax, sectioned, and baked in a 60℃ oven for 2 hours. The sections were then dewaxed sequentially in different concentrations of xylene and anhydrous ethanol. Next, the sections were stained with hematoxylin for 5 minutes, rinsed with tap water, and then blued again. Finally, the sections were stained with 1% water-soluble eosin for 5 minutes and rinsed with tap water. Finally, the sections were dehydrated and mounted with neutral resin. Under a microscope, the tissue morphology and structure were observed; cell nuclei appeared blue, while cytoplasm, erythrocytes, and myofibrils appeared red to varying degrees. For detailed results, see [link to results]. Figure 15 Appendix Figure 15 This study investigated the effects of engineered bacterial strains on the pathological changes of major organs in tumor-bearing mice. Structural changes in the heart, liver, spleen, lung, and kidney tissues of mice were examined using hematoxylin and eosin staining, respectively. Figure 15 As shown, the myocardial fiber structure of mice in each group was intact, the hepatocytes had abundant cytoplasm, large and round nuclei with a small number of lipid droplets, and no obvious pathological structural changes were observed in the lungs and kidneys. This indicates that no obvious pathological tissue damage was observed in other organs of the mice in each group, and the engineered strain has good safety.
[0097] (2) Detection of bacterial content in different tissues of tumor-bearing mice after intervention with engineered strains
[0098] To verify whether the engineered bacterial strain would widely distribute in tumor-bearing mice after injection and have adverse effects on their organs and overall health, bacterial strains were isolated from mouse heart, liver, spleen, kidney, and tumor tissue after modeling was completed, and their distribution was observed. See details for the results. Figure 16 Appendix Figure 16 The effect of engineered bacterial strains on bacterial content in different tissues of tumor-bearing mice; among them, Figure 16 A shows the bacterial distribution in the tissues of tumor-bearing mice after treatment with engineered bacterial strains. Figure 16 As can be seen from A, after the engineered strains entered the mouse body, they were mainly concentrated in the mouse tumor tissue, with a very small amount affecting other organs. Figure 16 B-16E was identified by PCR of engineered strains used to treat tumor tissue; Figure 16 According to B-16E, the bacteria distributed in mouse tumor tissue were detected as Clostridium butyricum, which further confirmed that the engineered strain was enriched in tumor tissue, which is also an important factor in ensuring its safety.
[0099] (3) Biochemical analysis
[0100] At the end of treatment in mice, peripheral blood was collected for routine blood biochemical analysis. See details below. Figure 17 . Figure 17 A represents the mean corpuscular hemoglobin (MCH) content in the peripheral blood of tumor-bearing mice in the engineered strain intervention group. MCH is the average amount of hemoglobin per red blood cell, usually expressed in picograms. Figure 17 As can be seen from A, the statistical results show no statistical difference between the PBS group and the experimental group, indicating that the engineered strain described in this application did not cause infection or inflammatory response in mice. Figure 17 B represents the peripheral blood leukocyte (WBC) count in tumor-bearing mice in the engineered strain intervention group. WBC is a leukocyte-related indicator that reflects the presence of infection and inflammation in the body. Figure 17 As shown in B, the statistical results indicate no significant difference between the PBS group and the experimental group, suggesting that the engineered strain described in this application did not cause infection or inflammatory response in mice. This fully demonstrates that the engineered strain described in this application has good safety and can be applied to the treatment of colorectal cancer.
[0101] In summary, this application provides an engineered strain of Clostridium butyricum that innovatively achieves CLMP expression in tumor cells, fundamentally solving the technical problem of decreased CLMP protein expression in colorectal cancer, which is of great significance for the treatment of colorectal cancer. Building on this foundation, this application achieves the enrichment of Clostridium butyricum in tumors by knocking out the purine synthesis-related gene purM, thereby enabling precise tumor targeting by the strain. Furthermore, by knocking out the protease gene lon, not only is precise tumor targeting achieved, but the expression level of CLMP protein is also significantly increased. In addition, the engineered strain described in this application exhibits good safety, further confirming its application prospects and social significance in the treatment of colorectal cancer.
Claims
1. An engineered strain of Clostridium butyricum, characterized in that: The engineered strain uses ATCC19398 Clostridium butyricum as the chassis strain and contains a recombinant expression vector expressing the CLMP protein.
2. The engineered strain of Clostridium butyricum according to claim 1, characterized in that: The amino acid sequence of the CLMP protein is shown in SEQ ID NO:
1.
3. The engineered strain of Clostridium butyricum according to claim 2, characterized in that: The purine synthesis-related gene purM, whose nucleotide sequence is shown in SEQ ID NO: 2, was knocked out in the Clostridium butyricum.
4. The engineered strain of Clostridium butyricum according to claim 2, characterized in that: The protease gene lon in the Clostridium butyricum with the nucleotide sequence shown in SEQ ID NO: 3 was knocked out.
5. The engineered strain of Clostridium butyricum according to claim 2, characterized in that: The butyric acid clostridium species described herein include the purine synthesis-related gene purM (nucleotide sequence as shown in SEQ ID NO: 2) and the protease gene lon (nucleotide sequence as shown in SEQ ID NO: 3).
6. The engineered strain of Clostridium butyricum according to any one of claims 1-5, characterized in that: The recombinant expression vector is selected from expression vectors containing a nucleotide sequence encoding the CLMP protein, a promoter, and a terminator.
7. The engineered strain of Clostridium butyricum according to claim 6, characterized in that: The nucleotide sequence encoding the CLMP protein is shown in SEQ ID NO:
4.
8. The engineered strain of Clostridium butyricum according to claim 6, characterized in that: The expression vector is selected from plasmid pMTL82151, and the promoter is Pta as shown in SEQ ID NO: 5, Ptb as shown in SEQ ID NO: 6, PrstA as shown in SEQ ID NO: 7, or abrBP as shown in SEQ ID NO:
8.
9. A pharmaceutical composition, characterized in that: It comprises the engineered strain of Clostridium butyricum as described in any one of claims 1-8 and a pharmaceutically acceptable vector.
10. Use of the engineered strain of Clostridium butyricum as described in any one of claims 1-8 or the pharmaceutical composition as described in claim 9 in the preparation of a medicament for the treatment or prevention of colorectal cancer.
Citation Information
Patent Citations
Compositions and uses thereof for treating inflammatory diseases and probiotic compositions
CN110049760A
Application of clostridium butyricum in adjuvant therapy of colorectal cancer
CN115671142A
Compositions and methods
CN117202927A
Engineered clostridium butyricum for producing L-tryptophan and application of engineered clostridium butyricum in preparation of tumor treatment drugs
CN118792231A
Clostridium difficile-based cell wall protein display system and construction and application thereof
CN120025411A