Luminescent cell for rapidly detecting drug allergy and / or anaphylactoid reaction as well as construction method and application thereof

Abstract

The invention discloses a luminescent cell for rapidly detecting drug allergy and / or anaphylactoid reaction as well as a construction method and application of the luminescent cell, and relates to the technical field of biology. The construction method comprises the following steps: transforming myeloid related cells by using a recombinant vector containing a marker gene and an HHEXA gene promoter to obtain recombinant cells; the recombinant cell is the luminescent cell. According to the invention, the HHEXA gene promoter and the marker gene are recombined and then transferred into myeloid related cells, and the occurrence of the allergy or anaphylactoid reaction can be intuitively reflected through a marker signal by utilizing the specific activation characteristic of the HHEXA gene in the allergy / anaphylactoid reaction. The luminescent cell has good stability, is suitable for multiple scenes such as drug allergy, anaphylactoid risk assessment, environmental sample analysis and the like, provides an efficient, sensitive and convenient technical tool for clinical rapid diagnosis, new drug research and development and scientific research and exploration, and can significantly reduce the detection cost and the operation threshold.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of biotechnology, in particular to a luminescent cell for rapid detection of drug allergy and / or anaphylactoid reaction, and a construction method and application thereof. BACKGROUND

[0002] Allergy and anaphylactoid reaction are common and harmful health problems in clinical practice. In vitro detection technology plays a crucial role in prevention and diagnosis. In the aspect of prevention, by accurately detecting allergens, patients can take targeted measures to avoid contact, thereby effectively reducing the risk of allergic reactions. In the aspect of diagnosis, in vitro detection technology provides objective and accurate diagnostic basis for clinicians, which helps to quickly and accurately judge the condition and develop individualized treatment plans. This not only improves treatment effect, but also avoids disease delay caused by misdiagnosis and missed diagnosis, reduces unnecessary medical expenses and patient suffering. Therefore, developing more efficient and accurate in vitro detection technology has always been a research hotspot and urgent need in the medical field.

[0003] In the field of in vitro detection of allergy and anaphylactoid reaction, there are mainly the following technical routes: 1. Cell morphological observation method The principle of cell morphological observation method is based on the fact that certain cells, such as mast cells and basophils, will undergo significant morphological changes when they are stimulated by specific stimuli. When mast cells and basophils are stimulated by non-specific stimuli or combined with specific mediators, degranulation phenomenon occurs, i.e. granules in cytoplasm are released to the outside of the cell, resulting in a decrease in intracellular granules. Researchers can directly observe the morphological changes of these cells with a microscope, and then determine whether an allergic or anaphylactoid reaction has occurred.

[0004] In actual operation, human or animal (such as mouse) cell lines (such as LAD2, RBL-2H3 cells) or primary cultured effector cells are usually selected. Microscope as the main observation equipment provides researchers with a means to directly observe cell morphology. This method has the advantages of being intuitive and easy to understand. The operator can directly see the changes in cell morphology without the need for complex instruments and reagents.

[0005] This method also has obvious shortcomings. The entire detection process is relatively time-consuming, and the operator needs to repeatedly observe and evaluate under the microscope, which is a great consumption of time and energy. It requires skilled cell culture and microscopic observation skills, and the operator must have rich experience to accurately judge the subtle changes in cell morphology. Quantitative analysis is also a major problem, as changes in cell morphology are difficult to quantify with specific data, and more rely on the subjective judgment of the operator, which is highly subjective. This method can only reflect part of the cell state and cannot comprehensively and accurately assess allergic and anaphylactoid reactions.

[0006] 2. Biochemical detection method (based on cell release) The principle of biochemical detection is that activated effector cells release various bioactive mediators, such as histamine, leukotrienes, cytokines, enzymes, etc. By accurately detecting the concentration of these release substances, the degree of allergic and anaphylactoid reactions can be effectively evaluated.

[0007] In histamine release assays, commonly used methods include enzyme-linked immunosorbent assay (ELISA) or radioimmunoassay (RIA). Specific antibodies are needed to capture and quantify histamine. Other cytokine / mediator detection can also use ELISA, LumKine or flow cytometry (Flow Cytometry) techniques to detect substances such as IL-4, IL-5, TNF-α, β-hexosaminidase (β-HEX), etc. The detection of β-HEX is a classic marker of effector cell activation, usually quantified by enzyme-linked color reaction. This method has the advantage of good quantification, which can accurately measure the concentration of bioactive mediators and provide quantitative data support for the evaluation of allergic and anaphylactoid reactions. At the same time, it has a standardized detection method, and the operation steps and result judgment have clear specifications, making it easy to compare results between different laboratories. It also has many shortcomings, such as: the detection process takes a long time, from sample collection, processing to reagent incubation, each step takes a certain amount of time, and the entire process takes a lot of time. The operation is complex, involving the use of multiple reagents, the operation of precision instruments, and multiple tedious experimental steps, which require higher technical requirements for the operator. The cost is high, and specific antibodies, enzyme substrates, and detection instruments require a large amount of investment, increasing the detection cost. Its sensitivity is also limited, and for some low-level allergic and anaphylactoid reactions, due to the small amount of bioactive mediator release, it may be difficult to detect, leading to missed diagnosis.

[0008] 3. Gene expression detection method (indirect) The principle of gene expression detection method is that when the allergic and anaphylaxis pathways are activated, the expression of specific genes is up-regulated. Through RT-PCR (reverse transcription-polymerase chain reaction) or Western Blot technology, the mRNA or protein level of these genes can be detected, thereby indirectly judging the occurrence of allergic and anaphylaxis reactions.

[0009] Taking RT-PCR as an example, first, the cells need to be lysed, and the RNA in the cells is extracted. Then, the RNA is reverse transcribed into cDNA by reverse transcriptase. Then, using specific primers, PCR amplification is carried out with cDNA as the template. The amplified product is separated and detected by electrophoresis to determine the mRNA level of the specific gene. Western Blot is to extract the protein in the cell first, then separate the protein by SDS-PAGE electrophoresis according to the molecular weight, then transfer the separated protein to the membrane, then use specific antibodies to bind to the target protein, and then detect the expression level of the target protein by color development or luminescence reaction.

[0010] The advantage of this method is that it can reveal the deeper molecular mechanisms behind allergic and anaphylaxis reactions, and explore the occurrence and development process of the reaction from the gene and protein level. However, its shortcomings cannot be ignored, such as high technical barriers, requiring operators to have professional molecular biology operation knowledge and skills, being familiar with the use of various instruments and equipment and the characteristics of experimental reagents. The detection process is time-consuming and complex, and the entire process from cell lysis to final result detection takes several hours or even several days, which is low in efficiency. The cost is high, and the RNA extraction reagent, PCR reagent, primer, antibody, electrophoresis equipment, etc. are expensive, increasing the experimental cost. This method is not easy to observe in real time, and cannot monitor the dynamic changes of cells in the process of allergic and anaphylaxis reactions in real time, and can only get the results after the experiment is finished, which has limitations for timely understanding of the reaction process.

[0011] In summary, the existing allergic and anaphylaxis reaction in vitro detection technology has many problems in cell morphology observation, biochemical detection and gene expression detection, such as complicated detection process, poor real-time results, insufficient sensitivity, and specific and quantitative needs to be improved. These problems seriously restrict the accurate and rapid diagnosis of allergic and anaphylaxis reactions, and cannot meet the urgent needs of clinical and scientific research for efficient detection technology. In clinical practice, due to the complicated detection process, it often takes a long time from sample collection to finally obtaining the detection results, which may delay the treatment of patients and miss the best treatment opportunity. Insufficient detection sensitivity and high specificity can easily lead to misdiagnosis and missed diagnosis, which poses potential risks to the health of patients. In the field of scientific research, the limitations of these technologies also hinder the in-depth study of the mechanism of allergic and anaphylaxis reactions, and cannot provide strong support for new drug research and development and optimization of treatment plans.

[0012] Therefore, developing a product capable of overcoming the above-mentioned shortcomings, which is rapid, sensitive, specific and capable of real-time monitoring of drug allergy and anaphylaxis, has become a key problem in the medical field that needs to be solved urgently. SUMMARY

[0013] The purpose of the present application is to provide a luminescent cell for rapid detection of drug allergy and / or anaphylaxis and a construction method and application thereof, so as to solve the problems existing in the prior art. The present application can directly reflect the occurrence of allergy and / or anaphylaxis by using the specific activation characteristics of H_HEXA gene in allergy / anaphylaxis by recombining the H_HEXA gene promoter with a marker gene and then transferring it into myeloid-related cells.

[0014] To achieve the above-mentioned purpose, the present application provides the following solutions: The present application provides a construction method of a luminescent cell for rapid detection of drug allergy and / or anaphylaxis, comprising the step of transforming a myeloid-related cell with a recombinant vector containing a marker gene and a H_HEXA gene promoter to obtain a recombinant cell; the recombinant cell is the luminescent cell. The nucleotide sequence of the H_HEXA gene promoter is shown in SEQ ID NO. 1.

[0015] Further, the marker gene is an EGFP gene.

[0016] Further, the myeloid-related cell is basophil leukemia cell.

[0017] Further, the myeloid-related cell is human mast cell.

[0018] Further, the basic vector of the recombinant vector is pGL3-basic vector.

[0019] The present application also provides a luminescent cell for rapid detection of drug allergy and / or anaphylaxis, which is constructed according to the above-mentioned construction method.

[0020] The present application also provides the application of the above-mentioned luminescent cell in preparing a product for rapid detection of drug allergy and / or anaphylaxis.

[0021] Further, the product is a kit.

[0022] The present application also provides a product for rapid detection of drug allergy and / or anaphylaxis, comprising the above-mentioned luminescent cell.

[0023] Further, the product is a kit.

[0024] The present application discloses the following technical effects: The application develops a luminescent cell for rapidly detecting drug allergy and / or allergic reaction, which is characterized in that H_HEXA gene promoter is recombined with a marker gene and then introduced into myeloid-related cells, and the specific activation characteristics of H_HEXA gene in allergic reaction are utilized to directly reflect the reaction occurrence through the marker signal. Compared with the traditional method, the detection cycle of the system is greatly shortened, and the rapid judgment can be realized through the fluorescence intensity change within 0.5-2 hours, and the complex morphological observation or molecular extraction operation is not needed. The marker signal is positively correlated with the reaction intensity, which can not only qualitatively screen unknown allergens / allergens, but also realize semi-quantitative / quantitative evaluation through a standard curve, thereby solving the problems of strong subjectivity and difficult quantification of the traditional method. Meanwhile, the luminescent cell has good stability and is suitable for drug allergy / allergy risk assessment, environmental sample analysis and other scenes, thereby providing an efficient, sensitive and convenient technical tool for clinical rapid diagnosis, new drug research and development and scientific research exploration, and can significantly reduce the detection cost and operation threshold. BRIEF DESCRIPTION OF DRAWINGS

[0025] In order to more clearly illustrate the technical solutions in the embodiments of the application or the prior art, the drawings needed in the embodiments will be briefly introduced below. Obviously, the drawings in the following description only constitute some embodiments of the application, and those skilled in the art can also obtain other drawings according to these drawings without creative labor.

[0026] Figure 1 It is a map of pGL3-basic vector; Figure 2 It is a map of recombinant plasmid pGL3-basic-H_HEXA promoter(-2000 to +42) WT; Figure 3 It is a column chart of fluorescence intensity values of different treatment groups in example 2 at 0.5h; wherein, Control represents a blank control group; DMSO represents a negative control; Vector represents an empty vector group; compared with the blank control group, P <0.001; compared with the empty vector group, ### P <0.001. DETAILED DESCRIPTION

[0027] Now, various exemplary embodiments of the application will be described in detail, which should not be considered as a limitation of the application, but should be understood as a more detailed description of certain aspects, characteristics and embodiments of the application.

[0028] It is to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the present application. Additionally, for a range of values of, for example, a parameter, an intermediate value of the parameter is understood to be specifically disclosed anywhere that either the upper or lower limit of the range is disclosed. Any smaller range of values of the parameter is understood to be specifically disclosed, even if the smaller range is not expressly disclosed. The upper and lower limits of these smaller ranges are independently combinable with one or more other disclosed ranges or specific values to generate other disclosed ranges. The upper and lower limits of these smaller ranges are also independently combinable with one or more other range limits to generate other disclosed ranges.

[0029] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present application, the preferred methods and materials are described. All publications mentioned in this specification are herein incorporated by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. The citation of any reference is not construed as an admission that it is prior art with respect to the present application.

[0030] Many modifications and variations of this application can be made in the light of the above teachings without departing from the spirit and scope thereof. Additional implementations of the application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. The examples in the specification are exemplary only and are not intended to be limiting.

[0031] As used herein, the terms "comprises", "comprising", "includes", "including", "has", "having", "contains", "containing", or variations thereof, are intended to be open-ended terms that mean inclusion, but not limited to, the listed materials and methods.

[0032] The nucleotide sequence of the β-hexosaminidase (H_HEXA) gene promoter (from -2000 bp to +42 bp, WT, i.e. wild type) involved in the following examples is shown in SEQ ID NO. 1; the nucleotide sequence of the EGFP gene is shown in SEQ ID NO. 2.

[0033] The pGL3-basic vector and E. coli stbl3 were purchased from Thermo Fisher Scientific.

[0034] SEQ ID NO. 1:

[0035] SEQ ID NO.2: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa.

[0036] Example 1 1. Construction of pGL3-basic-H_HEXA promoter(-2000 to +42) WT recombinant plasmid (1) Synthesis of H_HEXA gene promoter sequence (SEQ ID NO. 1) and EGFP gene sequence (SEQ ID NO. 2).

[0037] Primer design: PCR amplification primers were designed using primer design software, and homologous recombination sequences were added at the 5' end.

[0038] The designed primer sequence is sent to a primer synthesis company for synthesis.

[0039] The amplification primer sequence of H_HEXA gene promoter is as follows: 115964FW-145240: TCGATAGGTACCGAGCTCTTACGCGTTAAAAATCTGGTTAAGTCTAAAAGAGCTCTTTC (SEQ ID NO. 3); 115964RW-145241: AAGCGGCCGGCCGCCCCGACTCTAGAATTACTTGTACAGCTCGTCCATGC (SEQ ID NO. 4).

[0040] The amplification primer of EGFP gene is as follows: EGFP-F: ATGGTGAGCAAGGGCGAGGA (SEQ ID NO. 5); EGFP-R: TTACTTGTACAGCTCGTCCATGC (SEQ ID NO. 6).

[0041] (2) Using the seamless cloning method, the pGL3-basic vector (schematic diagram as shown in Figure 1 ) is linearized by restriction enzyme, the linearized pGL3-basic vector, the amplified H_HEXA promoter and EGFP gene fragment are mixed together, and a seamless cloning ligation reaction is performed.

[0042] 1) Vector enzyme digestion: Take 1 μg of fresh plasmid and perform double enzyme digestion with the corresponding restriction enzyme. The enzyme digestion system is shown in Table 1: Table 1 Enzyme digestion system

[0043] Incubate at 37°C for about 3 h.

[0044] Perform agarose gel electrophoresis on the enzyme digestion product, and after electrophoresis, perform gel recovery.

[0045] 2) Obtain the target fragment Dilute the synthesized primer to a final concentration of 10 μmol / L stock solution with ultrapure water. Perform PCR amplification using the diluted primer and template. The PCR amplification system is shown in Table 2: Table 2 PCR amplification system

[0046] The above materials are added into a thin-walled tube, mixed, and then placed into a PCR instrument for PCR amplification.

[0047] After the PCR, agarose gel electrophoresis is performed, and the target gene is recovered.

[0048] 3) Connection of the vector and the target fragment The target fragment and the vector are connected using the seamless cloning method. The connection system is shown in Table 3, and the connection is performed at 50°C for 20 min.

[0049] Table 3 Connection system

[0050] (3) The connection product is transferred into the prepared bacterial competent cells. The transformed cells are recovered in an antibiotic-free medium for a period of time, and then cultured in a medium containing the corresponding ampicillin antibiotic, and the colonies containing the plasmid are screened.

[0051] Transformation: The competent cells are placed on ice (4°C) and naturally thawed, and then 10 μL of the connection product is added to the competent cells and placed on ice (4°C) for 30 min.

[0052] 1) Then, heat shock at 42°C for 90 s. Then, quickly place on ice (4°C) for 2-3 min.

[0053] 2) Add 500 μL of SOC medium without antibiotics, and culture at 37°C and 225 rpm for 45 min.

[0054] 3) Centrifuge at 3000 rpm for 2 min, discard 900 μL of the supernatant, blow the bacterial solution at the bottom of the tube to scatter, and add to the culture plate containing the corresponding resistant vector. Use a sterilized spreader to spread evenly (the temperature of the spreader cannot be too high to avoid scalding the bacterial body), and invert in a 37°C constant temperature incubator for overnight culture.

[0055] (4) The single clone colonies are sent to a sequencing company for sequencing: In the clean bench, 400 μL of bacterial solution is taken from the 96-well deep well plate into an EP tube, and 20 μL of sequencing primer is taken into an EP tube. Two single clones with positive verification are selected and sent to a sequencing company for sequencing identification. Chromas is used for comparison, and the correct clone is the successfully constructed recombinant plasmid pGL3-basic-H_HEXA promoter(-2000 to +42) WT (the spectrum is shown in Figure 2 ).

[0056] (5) Extraction: The endotoxin-free plasmid extraction kit is used for extraction. The extracted plasmid is subjected to purity and QC verification.

[0057] 2. Cell transfection The recombinant plasmid pGL3-basic-H_HEXA promoter(-2000 to +42) WT was transfected into RBL-2H3 and LAD2 cells, respectively.

[0058] (1) Culture of RBL-2H3 and LAD2 cells Culture medium: EMEM medium for RBL-2H3 and IMDM medium for LAD2, both supplemented with 10% fetal bovine serum (FBS) and 1% double antibiotic (penicillin-streptomycin).

[0059] Culture conditions: 37°C, 5% CO2, saturated humidity.

[0060] Cell passage: periodically digest (using 0.25% trypsin-EDTA) and pass the cells to new culture vessels to maintain their growth vigor.

[0061] Preparation requirements: ensure that the cells are in the logarithmic growth phase, healthy and vigorous, and free from contamination such as mycoplasma.

[0062] (2) Chemical transfection Preparation of plasmid-liposome mixture: mix plasmid DNA with Lipofectamine 2000 in serum-free Opti-MEM medium, shake gently, incubate at room temperature for 5 minutes to obtain the plasmid-liposome mixture.

[0063] Cell preparation: in a 6-well plate or a 12-well plate, cells were plated at a density of 2x10 5 cells / well, ensuring that the cells were at 80-90% confluence.

[0064] Add transfection solution: add the plasmid-liposome mixture to the culture dish containing the cells.

[0065] Incubation: incubate at 37°C, 5% CO2 for 6 hours.

[0066] Change the medium: remove the medium containing the transfection solution and add complete medium containing 10% FBS.

[0067] Culture: continue to culture for 24 hours. Preliminary evaluation of transfection efficiency was observed by fluorescence, and antibiotic selection was performed to select cells stably integrated with the recombinant plasmid, i.e. RBL-2H3 and LAD2 cells transfected with the recombinant plasmid pGL3-basic-H_HEXA promoter(-2000 to +42) WT, referred to as luminescent cells RBL-2H3 and luminescent cells LAD2.

[0068] Example 2 The luminescent cells RBL-2H3 prepared in Example 1 were used to detect the allergen-like activity of C48 / 80 and Substance P, and the allergic reaction induced by DNP-BSA after IgE sensitization.

[0069] 1. Experimental materials Cell line: luminescent cells RBL-2H3 prepared in Example 1; empty vector transfected cells.

[0070] Positive drugs: C48 / 80 (a commonly used mast cell activator, which induces anaphylaxis); Substance P (a neuropeptide that can activate mast cells and induce anaphylaxis); DNP-IgE (binds to the FcεRI receptor on the surface of mast cells and is cross-linked under antigen stimulation, used for sensitization); DNP-BSA (a multivalent antigen with immunogenicity, used to trigger allergic reactions).

[0071] Solvent control: DMSO.

[0072] Fluorescent microplate reader: with fluorescence detection function, capable of detecting the excitation and emission spectrum of EGFP (excitation wavelength about 488 nm, emission wavelength about 507 nm).

[0073] 2. Experimental method Luminescent cells RBL-2H3 and empty vector transfected cells were plated in a 96-well fluorescent enzyme-labeled culture plate at a concentration of 30,000 cells per well and placed in a 37°C, 5% CO2 incubator for cell adhesion. Among them, the DNP-BSA group was added with 400 ng / mL of DNP-IgE for incubation for 24 h, and the old liquid was discarded. Then C48 / 80, Substance P, DNP- / BSA or blank solvent were added according to Table 1. At the same time, a blank control containing only culture medium was set. Detection was performed at different time points (0.5, 1, 1.5, 2 h) after drug addition. The excitation wavelength (488 nm) and emission wavelength (507 nm) of EGFP were set. The fluorescence intensity value (relative fluorescence unit, RFU) of each well was read.

[0074] The detection results are shown in Table 2 and Figure 3The results showed that the positive drugs (C48 / 80, Substance P and DNP-BSA) could significantly induce the expression of EGFP, resulting in a substantial increase in green fluorescence signal, while the fluorescence intensity of the blank control group and the negative control group was basically unchanged. This indicates that the detection method can distinguish between allergen-like and allergen. At the set concentration, significant fluorescence enhancement was detected, indicating that the model has a certain sensitivity to detect allergen-like and allergen. The substantial increase in fluorescence signal (multiple times the background) is an effective evidence of detection. The fluorescence intensity is positively correlated with the activity of H_HEXA promoter. Semi-quantitative or quantitative evaluation of allergen-like and allergen can be achieved by establishing a standard curve (for example, using a known concentration of stimulant). The fluorescence intensity of different drugs at the same time point can be used to compare their ability to induce allergic or allergic reactions. EGFP is a stable reporter protein, and its fluorescence signal is relatively easy to detect and accumulates in cells, making it suitable for detection over a longer time window.

[0075] Table 1 Experimental grouping

[0076] Table 2 Fluorescence intensity values at different times

[0077] The above-described embodiments are merely preferred modes of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of protection of the present application as defined by the claims.

Claims

1. A method for constructing a luminescent cell for rapid detection of drug allergy and / or anaphylactoid reaction, characterized by, The step of obtaining the recombinant cell, i.e. the luminescent cell, comprises transforming myeloid-related cells with a recombinant vector containing a marker gene and a H_HEXA gene promoter. The nucleotide sequence of the H_HEXA gene promoter is shown as SEQ ID NO.

1.

2. The construction method of claim 1, wherein, The marker gene is an EGFP gene.

3. The construction method of claim 1, wherein, The myeloid-related cells are basophil leukemia cells.

4. The construction method of claim 1, wherein, The myeloid-related cells are human mast cells.

5. The construction method of claim 1, wherein, The basic vector of the recombinant vector is a pGL3-basic vector.

6. A luminescent cell for rapidly detecting drug allergy and / or allergic-like reaction, which is constructed by the construction method according to any one of claims 1-5.

7. Use of the luminescent cell according to claim 6 in the preparation of a product for rapidly detecting drug allergy and / or allergic-like reaction.

8. Use according to claim 7, characterized in that, The product is a kit.

9. A product for the rapid detection of drug allergy and / or pseudoallergic reactions, characterized in that it comprises a composition according to any one of the preceding claims. The product comprises the luminescent cell according to claim 6.

10. The product of claim 9, wherein, The product is a kit.

Images