Amide hydrolase mutant and application of amide hydrolase mutant in production of nicotinic acid

By mutating amide hydrolase, a highly efficient amide hydrolase mutant was constructed, solving the problems of high energy consumption and low enzyme activity in nicotinic acid production, and realizing efficient, low-cost, and environmentally friendly nicotinic acid synthesis.

CN121574970APending Publication Date: 2026-02-27JIANGXI HAIWEN BIOTECHNOLOGY CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511928597.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Existing methods for producing nicotinic acid are energy-intensive, costly, and polluting. Furthermore, wild-type amide hydrolases have long catalytic times and low enzyme activity, which limits the large-scale industrial production of nicotinic acid.

Method used

By using protein engineering techniques to mutate amide hydrolases, mutants A and B of amide hydrolases were constructed, which improved enzyme activity and shortened catalytic time, enabling the one-step synthesis of nicotinamide into nicotinic acid.

Benefits of technology

The mutant enzyme exhibits enhanced activity, shortens catalytic time, improves nicotinic acid production efficiency and yield, reduces costs, minimizes pollution, and is suitable for large-scale industrial production.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The invention discloses an amide hydrolase mutant and an application in production of nicotinic acid, and provides two novel amide hydrolase mutants, which can significantly improve the production efficiency and yield of nicotinic acid, reduce the operation steps of nicotinic acid synthesis, realize one-step reaction synthesis from nicotinamide to nicotinic acid after cell disruption, break the bottleneck of the prior art, and improve the production efficiency and yield of nicotinic acid. The synthesis time is greatly shortened while the production cost of the nicotinic acid is reduced, and the production of the nicotinic acid is promoted to develop towards a more efficient, more economic and more environment-friendly direction.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to an amide hydrolase mutant and its application in the production of nicotinic acid. Background Technology

[0002] Niacin, chemically known as 3-pyridinecarboxylic acid, also called nicotinic acid or vitamin B3, is one of the 13 essential vitamins for humans. In the human body, it primarily functions as coenzyme I (NAD+). + ) and coenzyme II (NADP) + Nicotinic acid is a precursor in the synthesis of nicotinic acid, playing a role in hydrogen transfer during redox processes. In medicine, nicotinic acid is a crucial participant in redox reactions within biological organisms, primarily acting as a coenzyme I and coenzyme II in dehydrogenases, serving as a hydrogen carrier in biological oxidation. It participates in pyruvate metabolism, glucose glycolysis, pentose biosynthesis, and the metabolism of fats, amino acids, proteins, and purines. Nicotinic acid plays a vital role in improving the utilization of zinc and iron in the human body. It is also an important factor in preventing pellagra in humans. Many acyl compounds of nicotinic acid also have lipid-lowering effects, enhance intercellular metabolism, and inhibit the formation of cholesterol and plasma triglycerides, exhibiting good effects in preventing and treating cardiovascular diseases. Furthermore, nicotinic acid derivatives such as nicotinamide can be used as highly effective drugs for treating thrombosis; nicotinamide hydroxymethylamine can be used as a good hepatoprotective, choleretic, and antibacterial agent; nicotinic acid has positive effects on bone growth, stress resistance, egg production, and hatchability in poultry. It is an important feed additive. In the dye industry, nicotinic acid can be used to synthesize intermediates for various active dyes and azo dyes. Nicotinic acid is also a heat stabilizer and a chain transfer agent in the polymerization of PVC plastics and acrylamide. In summary, with the continuous and in-depth research on the role of nicotinic acid and its derivatives in fine chemicals, the application of nicotinic acid is becoming increasingly widespread, and its importance is gradually being recognized.

[0003] Currently, the main industrial production methods for nicotinic acid include liquid-phase oxidation, ammonia oxidation, gas-phase oxidation, and electrochemical oxidation. The first three methods require high temperatures, resulting in high energy consumption, high costs, and severe environmental pollution. Electrochemical oxidation offers milder conditions, produces fewer byproducts, and causes less pollution, making it a relatively ideal process for nicotinic acid production. However, the process and yield of this method need improvement. Therefore, finding a green, efficient, and economical method for nicotinic acid production is currently a crucial issue.

[0004] Currently, the biosynthesis of nicotinic acid mainly involves chemical synthesis as described above, and primarily utilizes nitrile hydrolases to catalyze the synthesis of nicotinic acid from 3-cyanopyridine. However, besides these enzymes, amide hydrolases are also capable of converting amide compounds into carboxylic acids. This provides a solution for this invention: the mother liquor from the production process of our existing cosmetic-grade nicotinamide product is biocatalyzed by amide hydrolases to synthesize nicotinic acid. This reduces waste of the nicotinamide mother liquor while simultaneously producing nicotinic acid. However, wild-type amide hydrolases have drawbacks such as low enzyme activity and long catalytic time. Summary of the Invention

[0005] The purpose of this invention is to construct a new amide hydrolase mutant. The obtained mutant not only has high enzyme activity, but also shortens the catalytic time, increases the yield of synthesized nicotinic acid, and improves equipment utilization efficiency, making a new generation of nicotinic acid synthesis possible.

[0006] The mechanism of the catalytic reaction by the amide hydrolase mutant described in this invention is as follows:

[0007]

[0008] Specifically, the objective of this invention is achieved through the following technical solutions.

[0009] The first aspect of the present invention provides an amide hydrolase mutant A, the amino acid sequence of which is shown in SEQ ID NO.3.

[0010] The present invention also provides a base sequence encoding the amide hydrolase mutant A, the base sequence of which can be designed according to conventional methods in the art, and in a preferred embodiment, the base sequence is shown in SEQ ID NO.4.

[0011] A second aspect of the present invention provides an amide hydrolase mutant B, the amino acid sequence of which is shown in SEQ ID NO.5.

[0012] The present invention also provides a base sequence encoding the amide hydrolase mutant B, the base sequence of which can be designed according to conventional methods in the art, and in a preferred embodiment, the base sequence is shown in SEQ ID NO.6.

[0013] A third aspect of the present invention provides the application of the amide hydrolase mutant A or amide hydrolase mutant B in the catalytic synthesis of nicotinic acid.

[0014] A third aspect of the present invention provides the application of the amide hydrolase mutant A or amide hydrolase mutant B in the treatment of nicotinamide waste liquid.

[0015] This invention utilizes protein engineering technology to mutate amide hydrolases, and the resulting mutants have the following advantages over existing technologies:

[0016] (1) The mutant obtained by this invention has the advantages of short process flow, low energy consumption and less pollution, and is suitable for large-scale industrial production.

[0017] (2) The mutant obtained by this invention has a high conversion rate, which can significantly improve the production efficiency and yield of nicotinic acid, reduce the operation steps of nicotinic acid synthesis, and realize the one-step reaction synthesis from nicotinamide to nicotinic acid after cell destruction. This breaks through the existing technical bottleneck, reduces the production cost of nicotinic acid, and greatly shortens the synthesis time, thus promoting the development of nicotinic acid production towards a more efficient, economical and environmentally friendly direction.

[0018] (3) The mutant obtained in this invention successfully relieved the product inhibition effect of nicotinic acid without affecting the original enzyme activity, and increased the product concentration of nicotinic acid. Detailed Implementation

[0019] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the experimental materials used in the following examples were purchased from conventional biochemical reagent stores.

[0020] Unless otherwise specified, the HPLC detection method for nicotinic acid used in the following examples is as follows:

[0021] (1) Chromatographic conditions

[0022] Chromatographic column: Supersil AQ C-18 column (4.6 mm × 250 mm, 5 µm);

[0023] Injection volume: 10 μL;

[0024] Mobile phase: Phase A: Mix with 1 g of sodium heptanesulfonate and bring the volume to 1000 mL with ultrapure water. Adjust the pH to 2.1 ± 0.1 with perchloric acid and filter through a 0.45 µm microporous membrane.

[0025] Phase B: Pure methanol (HPLC grade) passed through a membrane and sonicated;

[0026] Phase C: Isopropanol;

[0027] The ratio of phase A: phase B: phase C is 1:7:2;

[0028] Detection wavelength: 261 nm;

[0029] Flow rate: 1.0 ml / min;

[0030] Column temperature: 25℃.

[0031] (2) Standard curve and sample preparation:

[0032] Standard curve: Accurately transfer a certain volume of the nicotinic acid and nicotinamide mixed standard stock solution and dilute it with 80% methanol to prepare gradient concentrations, containing nicotinic acid of 0.002, 0.004, 0.005, 0.010, 0.020, and 0.040 mg / mL, and nicotinamide of 0.006, 0.012, 0.015, 0.030, 0.060, and 0.120 mg / mL, respectively. Take 10 µL of each concentration of the mixed standard solution and analyze it according to the chromatographic conditions.

[0033] Note: The preparation of the mother liquor should be calculated based on the actual content of the substances. (For example, if the sample weight of nicotinic acid is 0.05003g and the effective content of nicotinic acid is 95.026%, the actual content should be 0.05003*0.95026*1000000 / 100=475.42ppm)

[0034] Sample testing: Dilute the sample to the content value within the standard curve, inject the sample according to the chromatographic conditions, and obtain the content result = the content value displayed by the instrument * the dilution factor.

[0035] The vectors, competent cells, and bacterial cells used in the following examples are all commercially available.

[0036] Example 1: Method for constructing an amide hydrolase mutant

[0037] 1. Strain construction

[0038] Amide hydrolase (SEQ ID NO. 1) was amplified using primers ami-F / R, and simultaneously, primers pET-ZT-F / R were designed to amplify the pET42a vector. The amide hydrolase was ligated to the NcoI and XhoI multiple cloning sites of the pET42a vector using a seamless cloning method. After seamless cloning, the cells were transformed into BL21(DE3) chemocompetent cells, and the cells were preserved after successful sequencing.

[0039] ami-F:

[0040] CTCGAGTGCGGCCGCAAGCTTTTACAGTGCCGGGTGCTGT

[0041] ami-R:

[0042] ATTGAGGGACGCGGGTCCATGGATGAATAACCTGCATTATAAGTCTCTGCTGG

[0043] pET-ZT-F:CCATGGACCCGCGTCC

[0044] pET-ZT-R: AAGCTTGGCCGCGCA.

[0045] Step 2: Construction of the amide hydrolase mutant library

[0046] Using the pET-RZ plasmid containing the amide hydrolase encoding gene (nucleotide sequence SEQ ID NO. 2, amino acid sequence SEQ ID NO. 1) from Pantoea as a template, the amide hydrolase encoding gene (SEQ ID NO. 1) from Pantoea was randomly mutated using error-prone PCR.

[0047] PCR reaction system (50 μL): template pET-RZ 0.5–20 ng, 1× Taq Buffer (without Mg) 2+ ), 0.2mM dNTP, 0.3mM MnCl, 2mM MgCl 2 The upstream and downstream primers, T7 F and T7 R, were each 0.2 μM, and Taq DNA polymerase was 5 U.

[0048] PCR conditions: (1) 95℃ pre-denaturation for 5 min; (2) 95℃ denaturation for 15 s; (3) 60℃ annealing for 5 s; (4) 72℃ extension for 30 s, for a total of 30 cycles of steps (2) to (4); (5) final extension at 72℃ for 3 min, and storage at 4℃.

[0049] The PCR products were analyzed by agarose gel electrophoresis and then recovered by gel excision.

[0050] Subsequently, using the recovered gel product as primers, the complete plasmid was amplified.

[0051] PCR system (50 μL): 2× Phanta Max buffer, 0.2 mM dNTPs, 2.5 U Phanta Max high-fidelity polymerase, 50 ng gel recovery product, 20 ng pET-RZ plasmid.

[0052] PCR conditions: (1) 95℃ pre-denaturation for 5 min; (2) 95℃ denaturation for 15 s, 60℃ annealing for 5 s, 72℃ extension for 3.5 min.

[0053] Step (2) consists of 35 cycles; (3) the final extension is at 72°C for 5 minutes, and then stored at 4°C.

[0054] The amplified PCR product was digested with restriction enzyme DpnI at 37℃ for 3 h, inactivated at 65℃ for 10 min, transformed into E. coli BL21(DE3), plated on LB agar plates containing kanamycin (50 μg / mL), and incubated overnight at 37℃.

[0055] Finally, amide hydrolase mutant A was obtained, with the amino acid sequence shown in SEQ ID NO.3 and the base sequence shown in SEQ ID NO.4. Sequencing analysis revealed that SEQ ID NO.3 is an amide hydrolase mutant with three mutation sites: T172D, L289P, and G362K.

[0056] Step 3: Site-directed mutagenesis of amide hydrolases

[0057] Using the mutant pET-28a(+)-Ami plasmid from the previous step as a template, primers were designed for rolling circle amplification, mutating amino acid position 139 of the ami gene. The PCR amplification system was as follows: primers (ami-139-F / R): 1 μL each; plasmid template: 1 μL; FastPfu Fly enzyme: 1 μL; buffer: 25 μL; sterile ultrapure water: 21 μL. After amplification, the plasmid was transformed into BL21(DE3) and plated on LB agar plates containing kanamycin (50 μg / mL), and incubated overnight at 37°C.

[0058] Amide hydrolase mutant B was obtained, with the amino acid sequence shown in SEQ ID NO.5 and the base sequence shown in SEQ ID NO.6. Sequencing analysis revealed that SEQ ID NO.5 is an amide hydrolase mutant with four mutation sites: T172D, L289P, G362K, and R139Q.

[0059] Example 2 Enzyme activity assay of amide hydrolase mutant

[0060] 1. Strain construction

[0061] As in Example 1, the wild-type amidolytic enzyme shown in SEQ ID NO. 1, amidolytic enzyme mutant A and amidolytic enzyme mutant B from Example 1 were amplified using ami-F / R primers. Simultaneously, the pET42a vector was amplified using primers pET-ZT-F / R. The three enzymes were ligated to the NcoI and XhoI multiple cloning sites of the pET42a vector using a seamless cloning method (seamless cloning kit purchased from Beyotime Biotechnology Co., Ltd.). After seamless cloning, the cells were transformed into BL21(DE3) chemocompetent cells (purchased from TransGen Biotech Co., Ltd.), and after successful sequencing, the cells were preserved in glycerol tubes.

[0062] 2. Cell fermentation and protein expression

[0063] Dilute the bacterial culture preserved in the glycerol tube by 10%. -4 The culture was then spread onto Kan-resistant LB agar plates and incubated at 37°C for 16 hours. A single colony was picked and inoculated into a Kan-resistant LB flask with a final Kan concentration of 50 mg / L. The flask was then incubated overnight at 37°C and 200 rpm for 13 hours, and the OD was measured. 600Approximately 3-4 hours later, use this as seed culture to inoculate 5 L or 10 L fermenters to culture the cells. The temperature is controlled at 30℃ to avoid the formation of inclusion bodies. At the same time, add IPTG to the tank at a final concentration of 0.05 mM to induce the expression of amide hydrolase, and add Kan antibiotic at a final concentration of 50 mg / L. After fermentation for 32 h, collect the cells from the tank and centrifuge at 4000 rpm for 1.5 h to collect the cells.

[0064] 3. Obtaining the enzyme solution of amide hydrolase

[0065] The cells collected after fermentation were washed with 1×PBS buffer, and then centrifuged at 4000 rpm for 1.5 h to collect the cells. The cells were then resuspended in 1×PBS buffer to obtain a 5 mg / mL suspension containing the cells, which is the amide hydrolase solution.

[0066] 4. Determination of amide hydrolase activity

[0067] Buffer solution: 800 μL of 50 mM Tris-HCl buffer (pH 8.0). Nicotinamide solution: 100 μL of 60 mM nicotinamide solution. NaCl solution: 50 μL of 20 mM NaCl solution. Enzyme solution: 5 mg / mL amide hydrolase solution from step 3.

[0068] Reaction conditions: Temperature: 30℃; Shaking speed: 50 rpm; Reaction time: 4 hours.

[0069] Sample collection and testing: Sampling: At the start of the reaction, take 1 mL of sample and record the initial nicotinamide concentration. End of reaction: After 4 hours of reaction, take 1 mL of sample and record the residual nicotinamide concentration and the concentration of nicotinic acid generated.

[0070] The amount of nicotinic acid produced in the reaction solution was determined using HPLC. The concentration of nicotinic acid in the reaction solution was calculated based on the standard curve, and then the enzyme activity was calculated.

[0071] Data processing: Enzyme activity calculation formula: Enzyme activity (U / mL) = Δ[nicotinic acid] * V 反应 / Δt / V 酶

[0072] Where Δ[nicotinic acid] is the amount of nicotinic acid produced in the reaction solution (mol / L), Δt is the reaction time (s), and V 反应 V is the total volume of the reaction system (L). 酶 The volume of the enzyme solution is expressed in L.

[0073] The results showed that the wild-type amide hydrolase had an activity of 46 u / mL in shake flasks; the amide hydrolase mutant A had an activity of 151 u / mL, which was 2.28 times higher than the wild-type amide hydrolase mutant B; and the amide hydrolase mutant B had an activity of 138 u / mL, which was slightly lower than the wild-type amide hydrolase mutant B. However, according to the catalytic results in Tables 3 and 2, mutant B relieved the product inhibition of nicotinic acid and increased the upper limit of nicotinic acid synthesis concentration.

[0074] Example 3 Application of Amide Hydrolase Mutant

[0075] 1. Preparation of fungal sludge

[0076] Using the fermentation method in step 2 of Example 2, the bacterial culture in the lower tank of the fermenter was centrifuged at 4°C and 4000 rpm for 1.5 h using a high-speed refrigerated centrifuge to collect the bacterial cells. Then, the bacterial cells were washed with 1×PBS buffer and centrifuged at 4°C and 4000 rpm for 1.5 h. The supernatant was discarded and the collected bacterial cells were used as the catalytic sludge.

[0077] 2. Catalytic reaction

[0078] The nicotinamide used in this embodiment is a finished nicotinamide powder.

[0079] Reaction solution: 3L reaction system (900g nicotinamide + 3L deionized water + 36g bacterial sludge)

[0080] Reaction conditions: pH 7.5, nicotinic acid content was measured at 35℃, the reaction solution was inactivated at high temperature, and the bacterial sludge was 36g.

[0081] The average values ​​of three batches of reaction data were taken for each batch, and the results are shown in Tables 1-3:

[0082] Table 1. Transformation data of wild-type amide hydrolases

[0083]

[0084] Table 2 Transformation data of amide hydrolase mutant A

[0085]

[0086] Table 3 Transformation data of amide hydrolase mutant B

[0087]

[0088] The results showed that, based on the analysis of three catalytic events, the wild-type amide hydrolase had a poor ability to catalyze the synthesis of nicotinic acid, with a yield of about 25 g / L. The amide hydrolase mutant A, selected through random mutation screening, was able to catalyze the synthesis of nicotinic acid at a yield of 210 g / L. This mutant significantly increased the yield of nicotinic acid, but it also exhibited significant product inhibition. After the nicotinic acid yield reached 210 g / L, the enzyme activity was rapidly lost. By using semi-rational design to mutate its 139th position to Gln, the product inhibition was relieved, and the nicotinic acid yield reached over 380 g / L.

Claims

1. An amide hydrolase mutant A, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

3.

2. The base sequence encoding the amide hydrolase mutant A according to claim 1, preferably, the base sequence is shown in SEQ ID NO.

4.

3. Recombinant bacteria comprising the base sequence of claim 2.

4. The application of the amide hydrolase mutant A according to claim 1, the base sequence according to claim 2, or the recombinant bacteria according to claim 3 in the catalytic synthesis of nicotinic acid.

5. The application of the amide hydrolase mutant A according to claim 1, the base sequence according to claim 2, or the recombinant bacteria according to claim 3 in the treatment of nicotinamide waste liquid.

6. An amide hydrolase mutant B, characterized in that, Its amino acid sequence is shown in SEQ ID NO.

5.

7. The base sequence encoding the amide hydrolase mutant B of claim 6, preferably, the base sequence is shown in SEQ ID NO.

6.

8. A recombinant bacterium comprising the base sequence of claim 7.

9. The application of the amide hydrolase mutant B of claim 6, the base sequence of claim 7, or the recombinant bacteria of claim 8 in the catalytic synthesis of nicotinic acid.

10. The application of the amide hydrolase mutant B according to claim 6, the base sequence according to claim 7, or the recombinant bacteria according to claim 8 in the treatment of nicotinamide waste liquid.