Use of reagents and kits for detecting tsrna for diagnosis of colon cancer

By detecting tsRNA of tRF-21-S2I7L7P50 in serum exosomes, the lack of biomarkers for early diagnosis of colorectal cancer has been addressed, enabling highly sensitive and specific colorectal cancer screening and personalized treatment, and providing a new direction for diagnosis and treatment.

CN121575112BActive Publication Date: 2026-04-24XIANGYA HOSPITAL CENT SOUTH UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
XIANGYA HOSPITAL CENT SOUTH UNIV
Filing Date
2026-01-28
Publication Date
2026-04-24

AI Technical Summary

Technical Problem

In the current technology, the molecular subtyping and targeted therapy of colorectal cancer have not been fully explored, making it difficult to make breakthroughs in diagnosis and treatment strategies. Furthermore, the lack of effective biomarkers and therapeutic targets limits the progress of early diagnosis and treatment of colorectal cancer.

Method used

Using tsRNA of tRF-21-S2I7L7P50 in serum exosomes as a novel biomarker, detection was performed using specific probes and primers, and analysis was conducted using small RNA expression microarrays and PCR microarrays. A kit was developed for the early diagnosis of colorectal cancer.

Benefits of technology

tRF-21-S2I7L7P50 was expressed significantly higher in colorectal cancer patients than in healthy individuals, and it was correlated with T stage, lymph node metastasis, and TNM stage. The AUC value of the ROC curve was 0.870, the sensitivity was 0.826, and the specificity was 0.756, indicating its potential as a screening and personalized treatment for colorectal cancer.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121575112B_ABST
    Figure CN121575112B_ABST
Patent Text Reader

Abstract

The application belongs to the field of biomedicine and relates to application of reagents and kits for detecting tsRNA for colon cancer diagnosis. The application relates to application of reagents for detecting tsRNA for colon cancer diagnosis in preparation of products for detecting or predicting colon cancer, wherein the sequence of the tsRNA for colon cancer diagnosis is GTAGAATTCTCGCCTGCCACG. The application separates a tsRNA through a large number of experiments, and through verification, the expression level of the tsRNA in colon cancer patients is obviously higher than that in healthy people, and a higher level of exosome tRF-21-S2I7L7P50 is significantly related to patient T stage, lymph node metastasis and TNM stage characteristics, the AUC value of the ROC curve of serum tRF-21-S2I7L7P50 in colon cancer diagnosis is 0.870, and the tRF-21-S2I7L7P50 is expected to become a new type of biological marker for colon cancer screening and individualized treatment, and provides a new direction for colon cancer treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the biomedical field and relates to the application of reagents and kits for detecting tsRNA for the diagnosis of colon cancer. Background Technology

[0002] Colorectal cancer has become a major global public health problem, with an increasing trend towards younger onset, seriously threatening people's lives and health. Although molecular subtyping and targeted therapy have improved the prognosis of colorectal cancer patients to some extent, the understanding of its pathogenesis and development mechanisms remains insufficient, hindering further breakthroughs in diagnosis and treatment strategies. Therefore, in-depth research into the molecular mechanisms of colorectal cancer development and development, and the search for effective biomarkers and therapeutic targets, are of great significance for improving the early diagnosis rate of colorectal cancer and improving patient survival outcomes.

[0003] In recent years, liquid biopsy technology has become an important research direction for breaking through the bottleneck of early diagnosis of colorectal cancer due to its non-invasiveness and high sensitivity. Compared with traditional tissue biopsy, liquid biopsy has the following advantages: (1) Minimally invasive: Only a small amount of peripheral blood needs to be collected to complete the test, avoiding the risk of complications such as bleeding and infection of traditional biopsy; (2) Dynamic: Real-time monitoring of treatment response can be achieved; (3) Early detection: Tumor traces can be detected 3-6 months earlier than imaging examinations; (4) Comprehensive: By simultaneously detecting circulating tumor nucleic acids, circulating tumor cells and exosomes, tumor heterogeneity can be overcome. Among them, circulating nucleic acids have shown important value in the early diagnosis of colorectal cancer due to their long half-life in blood circulation and strong resistance to nuclease degradation. Exosomes, as the natural carriers of these circulating nucleic acids, not only provide a physical protective barrier for nucleic acids through their special double membrane structure, but also completely preserve the molecular characteristic information of donor cells, which can significantly improve the sensitivity and specificity of circulating nucleic acids as diagnostic markers.

[0004] In the post-genomic era, research on non-coding RNA has made groundbreaking progress. Among them, tRNA-derived small RNAs (tsRNAs) have attracted attention as a novel class of regulatory molecules. tsRNAs are functional small RNAs produced by the cleavage of precursor or mature tRNAs by specific nucleases. Based on differences in cleavage sites, tsRNAs can be divided into two main subclasses: tRNA-derived stress-induced RNA (tiRNA) and tRNA-derived fragments (tRF). Studies have shown that tsRNAs play an important role in tumorigenesis and development through mechanisms such as regulating epigenetic modifications, transcription factor activity, and translation. For example, studies have found that 5'-tRF-Gly-GCC is significantly highly expressed in the plasma of colorectal cancer patients and is closely related to colorectal cancer progression and metastasis, making it a potential diagnostic biomarker for colorectal cancer. Notably, tsRNAs can be selectively encapsulated by exosomes and stably exist in various body fluids, playing an important role in cell communication. Currently, the specific mechanisms of action of tsRNAs in colorectal cancer are not yet fully elucidated. There are few reports on the role of serum exosomal tsRNA in the development of colorectal cancer. Summary of the Invention

[0005] The purpose of this invention is to provide the application of reagents and kits for detecting tsRNA for the diagnosis of colorectal cancer.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] The use of a reagent for detecting tsRNA for colorectal cancer diagnosis in the preparation of products for detecting or predicting colorectal cancer, wherein the sequence of the tsRNA for colorectal cancer diagnosis is GTAGAATTCTCGCCTGCCACG (SEQ ID NO.1).

[0008] The tsRNA is named tRF-21-S2I7L7P50 in this invention. The particle size of the tsRNA is 30-150 nm; the markers of the tsRNA are CD9, CD81, and TSG101, and it does not express calnexin.

[0009] This study selected 82 colorectal cancer patients and 69 healthy controls as research subjects. It was found that serum exosomes in the colorectal cancer group stably expressed tRF-21-S2I7L7P50, with significantly higher expression levels than the healthy control group. Further research revealed that higher levels of serum tRF-21-S2I7L7P50 were significantly correlated with T stage, lymph node metastasis, and TNM stage characteristics in colorectal cancer patients. In conclusion, serum tRF-21-S2I7L7P50 has significant advantages in the diagnosis of colorectal cancer and holds promise as a novel biomarker for colorectal cancer screening.

[0010] According to embodiments of the present invention, the present invention can be further optimized, and the optimized technical solution is as follows:

[0011] In one preferred embodiment, the tsRNA for colorectal cancer diagnosis is derived from serum.

[0012] Compared to detecting tRF-21-S2I7L7P50 levels in tissues, detecting the expression level of tRF-21-S2I7L7P50 in patient serum exosomes is less invasive. Therefore, exploring the level of tRF-21-S2I7L7P50 in serum exosomes has the potential to become a biomarker for colorectal cancer screening.

[0013] Based on the same inventive concept, this invention also claims protection for the use of reagents for detecting the above-mentioned tsRNA in the preparation of products for early diagnosis of colorectal cancer.

[0014] In one preferred embodiment, the expression level of the above-mentioned tsRNA in colorectal cancer patients differed by a factor of 3.765 compared to healthy controls.

[0015] In one preferred embodiment, the product includes a kit and reagents.

[0016] In one preferred embodiment, the reagents for detecting the tsRNA include specific probes, primers, chips, or nucleases.

[0017] In one preferred embodiment, the chip is either a small RNA expression chip or a PCR chip.

[0018] In one preferred embodiment, the small RNA expression chip is the Arraystar Small RNA expression chip.

[0019] In one preferred embodiment, the primers include: upstream PCR primer F: GCGCGTTGGTCTAGGGGTAT (SEQ ID NO.2); downstream PCR primer R: AGTGCAGGGTCCGAGGTATT (SEQ ID NO.3); and stem-loop reverse transcription primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAATC (SEQ ID NO.4).

[0020] Based on the same inventive concept, the present invention also claims the use of a kit in the preparation of products for detecting or predicting colorectal cancer, said kit comprising the above-mentioned tsRNA or reagents for detecting the above-mentioned tsRNA.

[0021] In one preferred embodiment, the kit further includes PCR buffer, DNA polymerase, and deionized water.

[0022] Compared with the prior art, the beneficial effects of the present invention are:

[0023] This invention isolated a tsRNA, tRF-21-S2I7L7P50, through extensive experiments. Verification showed that its expression level in colorectal cancer patients was significantly higher than in healthy individuals, and higher levels of exosomal tRF-21-S2I7L7P50 were significantly correlated with T stage, lymph node metastasis, and TNM stage characteristics in patients. The AUC value of serum tRF-21-S2I7L7P50 in colorectal cancer diagnosis was 0.870. The sensitivity of the median expression level of tRF-21-S2I7L7P50 as a threshold was 0.826, and the specificity was 0.756. It holds promise as a novel biomarker for colorectal cancer screening and personalized treatment, providing a new direction for colorectal cancer treatment. Attached Figure Description

[0024] Figure 1 Volcano plot for differentially expressed tsRNA.

[0025] Figure 2 Electron transmission microscope image showing the characteristic morphology of exosomes.

[0026] Figure 3 This is a particle size distribution diagram of exosomes.

[0027] Figure 4 This is a Western blotting image of exosomal proteins.

[0028] Figure 5 Dot plot of serum exosome expression levels of tRF-21-S2I7L7P50 in colorectal cancer patients and healthy controls, obtained by qRT-PCR.

[0029] Figure 6 Dot plot of serum exosome expression levels of tRF-21-S2I7L7P50 in colorectal cancer patients with T1-T2 or T3-T4 disease.

[0030] Figure 7 Dot plot of serum exosome tRF-21-S2I7L7P50 expression levels in colorectal cancer patients with or without lymph node metastasis.

[0031] Figure 8 Dot plot of serum exosomal tRF-21-S2I7L7P50 expression levels in patients with stage I-II and III-IV colorectal cancer.

[0032] Figure 9 ROC curve of serum tRF-21-S2I7L7P50 as a biomarker for colorectal cancer screening. Detailed Implementation

[0033] This invention is not limited to the specific embodiments listed below. Those skilled in the art can implement this invention using various other specific embodiments based on the content disclosed herein. Any modifications or alterations made to the design structure and concept of this invention fall within the protection scope of this invention. It should be noted that, unless otherwise specified, the embodiments and features described in this invention can be combined with each other.

[0034] This invention uses SPSS 23.0 and GraphPad Prism 9.5 for statistical analysis of the data. Statistical differences between groups were determined using the Mann-Whitney U test or the t-test of means; for categorical data, the chi-square test was used to compare the two groups. In all tests, P < 0.05 was considered statistically significant.

[0035] Example 1

[0036] Isolation of tRF-21-S2I7L7P50 from serum exosomes

[0037] I. Experimental Methods

[0038] 1. All peripheral blood clinical samples were obtained from Xiangya Hospital, Central South University. Informed consent was obtained from all sample sources, and other clinical information was collected from the samples. The experiment was approved by the Ethics Committee of Xiangya Hospital, Central South University.

[0039] The inclusion criteria for clinical peripheral blood samples are as follows:

[0040] (1) Histopathological diagnosis confirmed colon cancer;

[0041] (2) The patient had not received radiotherapy, chemotherapy, or hormone therapy before admission;

[0042] (3) The clinical data and relevant laboratory test results are complete;

[0043] (4) Healthy controls were individuals recruited from health check-up centers who had no history of serious illness or chronic diseases;

[0044] (5) All patients included signed informed consent forms.

[0045] The exclusion criteria for clinical peripheral blood samples are as follows:

[0046] (1) Other malignant tumors are present at the same time;

[0047] (2) There is severe dysfunction of vital organs such as the heart and lungs;

[0048] (3) Pregnant or lactating women.

[0049] 2. Extraction of peripheral blood exosomes

[0050] Peripheral blood collection: Serum samples from 82 colon cancer patients and 69 healthy controls were collected at the Department of Laboratory Medicine, Xiangya Hospital, Central South University for testing. Venous blood samples were processed within 2 hours of collection. A standardized two-step centrifugation method was used: first, centrifugation at 2000×g for 10 minutes to obtain cell-free serum; then, centrifugation at 10,000×g for 30 minutes at 4°C to remove cell debris and platelets. The clarified supernatant was then collected, aliquoted, and stored at -80°C for experimental analysis.

[0051] Exosome extraction: Serum was separated using exosome separation reagent (Yeasen, China) according to the manufacturer's instructions, as follows: 1 ml of serum sample was centrifuged at 3000 × g for 10 minutes at 4°C, and the supernatant was transferred to a new centrifuge tube. The new centrifuge tube was centrifuged at 10,000 × g for 20 minutes at 4°C, and the precipitate was discarded. The supernatant was then transferred to a clean tube containing 4 volumes of PBS and 1 volume of exosome separation reagent, and mixed thoroughly to obtain a mixture. The mixture was allowed to stand at 4°C for 2 hours, then centrifuged at 10,000 × g for 60 minutes, and the supernatant was discarded. PBS solution was added to the precipitate, and the mixture was resuspended. The resuspended mixture was centrifuged at 12,000 × g for 2 minutes at 4°C to obtain an exosome-rich supernatant for subsequent studies.

[0052] 3. Exosome identification

[0053] 3.1 Transmission electron microscopy (Hitachi, Japan) examination of exosomes

[0054] Take an appropriate amount of exosome sample and drop it onto a copper mesh support. After standing for 3 minutes, use a dry filter paper strip to absorb the excess liquid from the edge of the copper mesh. Then, drop 3% phosphotungstic acid staining solution (pH 7.0) onto the copper mesh, and again stand for 3 minutes. Then, use a dry filter paper to absorb the excess staining solution. Finally, drop double-distilled water (ddH2O) to wash the sample, absorb the water, and dry it at room temperature. The morphology and size of the exosomes can then be observed under a transmission electron microscope.

[0055] 3.2. Exosome particle size detection

[0056] The size distribution of serum exosomes was analyzed using nanoscale flow cytometry (Reference: Welsh JA, Goberdhan DCI, O'Driscoll L, et al. Minimal information for studies of extracellular vesicles (MISEV2023):From basic to advanced approaches. J Extracell Vesicles. 2024;13(2):e12404.). After instrument calibration and performance verification using standardized nanoparticles, 10 μL samples were analyzed using an N30E nanoparticle analyzer (NanoFCM Inc., China).

[0057] 3.3 Western blotting

[0058] Protein sample concentration was quantified using the BCA method, followed by the addition of 5×SDS-PAGE loading buffer at a 1:5 ratio. The sample was heated in a 100°C dry bath for 5 minutes, and then stored at -80°C for later use. Separating and stacking gels of appropriate concentrations were prepared. The denatured protein sample was added to the loading wells, and SDS-PAGE was performed at a constant voltage of 100V for approximately 90 minutes. Before transfer, the PVDF membrane was activated with methanol for 30 seconds and placed in transfer buffer. The sponge, filter paper, gel, PVDF membrane, filter paper, and sponge were placed sequentially in the transfer clamp, ensuring electrode orientation (black to black, white to red). Transfer was completed at a constant current of 200mA. After transfer, the membrane was placed face up in 5% skim milk blocking buffer and blocked on a shaker at room temperature for 1 hour. After blocking, the membrane was washed with PBST, and the target band was cut and placed in an antibody incubation box. The appropriate primary antibody dilution solution (1:1000 dilution) was added, and the membrane was incubated overnight on a shaker at 4°C. The primary antibodies used are as follows: CD9 (Boster, BM4212), TSG101 (Abcam, ab125011), CD81 (SAB, 41779), and calnexin (SAB, 12186). The membrane was then washed three times with PBST for 5 minutes each time, followed by incubation with the corresponding secondary antibody (Invitrogen, 31460) on a shaker at room temperature for 1 hour. The membrane was then washed three more times with PBST for 5 minutes each time. A chemiluminescence developing solution was prepared at a 1:1 ratio, and after aspirating any residual liquid from the membrane surface, the developing solution was added evenly. Development and image acquisition were performed using a chemiluminescence imaging system.

[0059] Results observed by transmission electron microscopy as follows Figure 2 As shown, the results indicate that the extracted exosomes have a cup-shaped structure with a diameter between 30 and 150 nanometers, which is consistent with the size characteristics of exosomes.

[0060] Nanoflow cytometry results Figure 3 As shown in the figure, the results indicate that the exosome particles are monodisperse with a peak diameter of approximately 80 nanometers.

[0061] Western blot results as follows Figure 4 As shown, the results indicated the presence of specific marker proteins (CD9, CD81, and TSG101) in exosomes, while the non-exosomal protein calnexin was not detected. Figure 4 The above results indicate that exosome extraction was successful.

[0062] 4. Isolation and sequencing of tsRNA

[0063] Total exosomal RNA was extracted from the serum of colon cancer patients and healthy controls using Trizol reagent, following the manufacturer's instructions. RNA purity and concentration were assessed using agarose gel electrophoresis and a NanoDrop ND-1000 (Thermo Fisher Scientific, Wilmington, USA) at Aksomics (Shanghai, China). Quantification was performed using an Agilent Bioanalyzer 2100, and a volcano plot of differentially expressed tsRNAs was constructed using screening criteria (|log2FC|≥2, FDR<0.05). The results are shown below. Figure 1 As shown in the figure, the number of upregulated (red) tsRNAs is 3118, the number of non-differentially expressed (gray) tsRNAs is 5631, and the number of downregulated (green) tsRNAs is 293. The top six differentially expressed tsRNAs were then validated by subsequent PCR using an Illumina sequencer. Validation, sequencing, and screening were all performed by the same company. The top six serum exosomal tsRNAs with the highest expression levels are shown in Table 1.

[0064] P refers to whether there is a statistically significant difference in the expression level when each group is counted three times, i.e., P < 0.05.

[0065] The sequence of tRF5c-1-29-chrM.tRNA4-IleGAT is: AGAAATATGTCTGATAAAAGAGTTACTTT (SEQ ID NO.20).

[0066] The sequence of itRF-8-29-Glu-TTC-1 is: TGGTCTAGCGGTTAGGATTCCT (SEQ ID NO.21).

[0067] The sequence of tRF3b-56-75-Trp-CCA-4 is: GAATCACGTCGGGGTCACCA (SEQ ID NO.22).

[0068] The sequence of tRF-21-S2I7L7P50 is: GTAGAATTCTCGCCTGCCACG (SEQ ID NO.1).

[0069] The sequence of Other-1-35-chrM.tRNA4-IleGAT is: AGAAATATGTCTGATAAAAGAGTTACTTTGATAGA (SEQ ID NO.23).

[0070] The sequence of itRF-7-27-Pro-AGG-1 is: TTGGTCTAGGGGTATGATTCT (SEQ ID NO.24).

[0071] The results showed that the fold change values ​​of all tsRNAs were greater than 10 and were upregulated; the P values ​​were all less than 0.05, indicating that the expression differences of these tsRNAs were statistically significant and may serve as candidates for molecular markers related to colorectal cancer.

[0072] Example 2

[0073] Verification of the relationship between the top 6 serum exosomal tsRNAs with the highest expression levels and colorectal cancer

[0074] Specific primers were used for reverse transcription and PCR amplification. The PCR amplification instrument was a Thermo Fisher QuantStudio 5. The specific procedure is as follows:

[0075] tsRNA reverse transcription (stem-loop method) was performed using a kit (Aikerui cDNA First-Strand Synthesis Kit), as follows:

[0076] (1) Take 1 μg tsRNA and mix it with 0.25 µM stem-loop reverse transcription primer, reverse transcriptase and buffer to form a 20 µL system. Gently mix and run in a PCR instrument under the following conditions: 25 °C for 5 minutes; reverse transcription at 42 °C for 15 minutes; heat at 85 °C for 5 seconds to terminate the reaction and obtain the template. Store the template at -20 °C for subsequent tsRNA qRT-PCR analysis.

[0077] (2) Perform tsRNA qRT-PCR analysis according to the instructions of the kit (Aikerui), and the corresponding primers are shown in Table 2.

[0078] The qPCR system contained 2×SYBR Green Pro Taq HS Premix I, ROX Reference Dye (4µM), and specific primers (0.2µM each of upstream PCR primer F and downstream PCR primer R). 1µL of reverse transcription product was added to each well, and enzyme-free water was added to a final volume of 20µL. Reaction conditions: 95℃ pre-denaturation for 30 seconds, 40 cycles (95℃ for 5 seconds, 60℃ for 30 seconds). The reaction was carried out using a 2-ΔΔ... CT Calculate the expression level. Where ΔΔ CT =(Ct target gene - Ct internal reference gene) 实验组 -(Ct target gene-Ct internal reference gene) 对照组 .

[0079] The results of tRF-21-S2I7L7P50 qRT-PCR are as follows: Figure 5 As shown, the results indicated that the expression level of tRF-21-S2I7L7P50 in colorectal cancer patients was significantly higher than that in healthy controls. Figure 5 ).

[0080] The results of qRT-PCR for the top 6 serum exosomal tsRNAs with the highest expression levels during sequencing are summarized in Table 3.

[0081] All six tsRNAs showed an upregulation trend in colorectal cancer patients, but tRF-21-S27L7P50 showed the largest upregulation (4.5315-fold). The expression differences of tRF3b-56-75-Trp-CCA-4, tRF-21-S27L7P50, Other-1-35-chrM.tRNA4-IleGAT, and iiRF-7-27-Pro-AGG-1 were statistically significant (P < 0.05). Although tRF5c-1-29-chrM.tRNA4-IleGAT and iiRF-8-29-Glu-TTC-1 showed the largest expression differences in previous studies, their P values ​​were greater than 0.05, indicating weaker statistical significance. tRF-21-S27L7P50 exhibits both "large upregulation magnitude and smallest P-value," suggesting it could be a potential molecular marker for serum exosomal tsRNA in colorectal cancer.

[0082] Furthermore, this invention performed a correlation analysis between the expression level of tRF-21-S2I7L7P50 and clinicopathological parameters of colorectal cancer patients, and the results are shown in Tables 4 and 5.

[0083] Based on the median expression of tRF-21-S2I7L7P50 (fold change of 3.765), 82 patients with colorectal cancer were divided into a high-expression group and a low-expression group. The results showed that the expression level of tRF-21-S2I7L7P50 was significantly correlated with T stage, lymph node metastasis, and TNM stage characteristics (P<0.05); however, it was not correlated with gender, age, tumor size, metastasis, or CEA and CA199 expression levels (P>0.05).

[0084] Example 3

[0085] Serum exosomes tRF-21-S2I7L7P50 from colorectal cancer patients can serve as a biomarker for colorectal cancer screening.

[0086] Further subgrouping of 82 colorectal cancer patients into smaller groups and sequentially examining the expression differences of tRF-21-S2I7L7P50 between each group of colorectal cancer patients and controls, the results showed that the expression level of serum exosomal tRF-21-S2I7L7P50 in the T3-T4 group of colorectal cancer patients was significantly higher than that in the T1-T2 group. Figure 6 The expression level of serum exosome tRF-21-S2I7L7P50 in colorectal cancer patients with lymph node metastasis was significantly higher than that in the non-metastatic group. Figure 7 The expression level of serum exosomal tRF-21-S2I7L7P50 in stage III-IV colorectal cancer patients was significantly higher than that in stage I-II. Figure 8 This suggests that serum exosome-derived tRF-21-S2I7L7P50 could serve as a biomarker for screening colorectal cancer and aid in the early diagnosis of colorectal cancer patients.

[0087] Example 4

[0088] Validating the feasibility of serum tRF-21-S2I7L7P50 as a biomarker for colorectal cancer screening

[0089] Serum samples from 80 colorectal cancer patients and healthy controls at the Department of Laboratory Medicine, Xiangya Hospital, Central South University, were collected again for blind testing. The inclusion criteria for cases were: (1) histopathological diagnosis of colorectal cancer; (2) no prior radiotherapy, chemotherapy or hormone therapy before admission; (3) complete clinical data and relevant laboratory test results; (4) healthy controls were individuals recruited from health check-up centers without a history of major diseases or chronic diseases; and (5) all included patients signed informed consent forms.

[0090] The exclusion criteria for cases are: (1) the presence of other malignant tumors; (2) the presence of severe dysfunction of vital organs such as the heart and lungs; and (3) pregnant or lactating women.

[0091] tRF-21-S2I7L7P50 was isolated according to the method in Example 1, and then reverse transcribed and amplified by PCR. Using the expression level of tRF-21-S2I7L7P50 as a predictive factor, the sensitivity and specificity at different disease thresholds were calculated, and ROC curves were plotted. The results are as follows: Figure 9 As shown.

[0092] The results showed that the AUC of the ROC curve was 0.870. Using the median expression of tRF-21-S2I7L7P50 (fold change of 3.765) as the cutoff value, samples with tRF-21-S2I7L7P50 levels above the median were predicted as colorectal cancer samples, while samples below the median were predicted as healthy samples. The sensitivity was 0.826, and the specificity was 0.756. This indicates that serum exosome tRF-21-S2I7L7P50 has good feasibility as a biomarker for colorectal cancer screening.

[0093] tRF3b-56-75-Trp-CCA-4, Other-1-35-chrM.tRNA4-IleGAT, and iiRF-7-27-Pro-AGG-1 were isolated using the same method and subjected to reverse transcription and PCR amplification. The expression levels of tRF3b-56-75-Trp-CCA-4, Other-1-35-chrM.tRNA4-IleGAT, and iiRF-7-27-Pro-AGG-1 were used as predictive factors. Sensitivity and specificity were calculated at different disease thresholds, and ROC curves were plotted. The results showed that the AUC of tRF3b-56-75-Trp-CCA-4, Other-1-35-chrM.tRNA4-IleGAT, and iiRF-7-27-Pro-AGG-1 were all below 0.7, and therefore could not be used independently as biomarkers for colorectal cancer screening.

[0094] It should be noted that the above embodiments are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. Those skilled in the art can make other variations or modifications based on the above description. It is impossible to exhaustively list all possible implementations here. All obvious variations or modifications derived from the technical solutions of this invention are still within the scope of protection of this invention.

Claims

1. The application of a reagent for detecting tsRNA expression levels used in the diagnosis of colorectal cancer in the preparation of products for detecting or predicting colorectal cancer, characterized in that, The sequence of tsRNA used for colorectal cancer diagnosis is GTAGAATTCTCGCCTGCCACG; the tsRNA is derived from serum exosomes.

2. The application according to claim 1, characterized in that, The products include reagent kits and reagents.

3. The application according to claim 1, characterized in that, Reagents for detecting tsRNA expression levels used in colorectal cancer diagnosis include specific probes, primers, or microarrays.

4. The application according to claim 3, characterized in that, Primers include: upstream PCR primer F: GCGCGTTGGTCTAGGGGTAT; downstream PCR primer R: AGTGCAGGGTCCGAGGTATT; stem-loop reverse transcription primer: GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAATC.

5. The application of a reagent kit in the preparation of products for detecting or predicting colorectal cancer, characterized in that, The kit includes reagents for detecting the expression level of tsRNA for colorectal cancer diagnosis; the sequence of the tsRNA for colorectal cancer diagnosis is GTAGAATTCTCGCCTGCCACG; the tsRNA is derived from serum exosomes.

6. The application according to claim 5, characterized in that, The kit also includes PCR buffer, DNA polymerase, and deionized water.

7. The application according to claim 5, characterized in that, Reagents for detecting tsRNA expression levels used in colorectal cancer diagnosis include specific probes, primers, or microarrays.

Citation Information

Patent Citations

  • Transfer RNA fragments and application thereof

    CN106978415A

  • Kit for screening and diagnosing colorectal cancer

    CN119685480A