Anti-IL-18 antibody therapy for treatment of atopic dermatitis

By administering a low-dose subcutaneous dose of the anti-IL-18 antibody camotetzumab every 4 weeks, the problem of frequent dosing and adverse reactions in existing treatment regimens for IL-18-related diseases is solved, achieving a long-lasting and safe therapeutic effect.

CN121586728APending Publication Date: 2026-02-27阿波罗AP43有限公司
View PDF 5 Cites 0 Cited by

Patent Information

Application Number
CN202480041297.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2023-06-20
Filing Date
2024-06-20
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Existing treatment options are not effective in targeting IL-18-related diseases such as Still's disease, atopic dermatitis, ulcerative colitis, Crohn's disease, and eosinophilic esophagitis, especially because IL-18 levels are too high to be regulated by IL-18-binding proteins, leading to an overdose of free IL-18. Current treatments require frequent administration and may produce adverse reactions.

Method used

The drug is administered subcutaneously at a low dose every 4 weeks. It binds to free IL-18 and blocks its pro-inflammatory signaling to achieve a long-lasting therapeutic effect.

Benefits of technology

This invention enables a low-dose subcutaneous administration regimen of anti-IL-18 antibodies, reducing the frequency of administration, lowering the risk of adverse reactions, and improving the long-term efficacy and safety of treatment. It is applicable to a variety of IL-18-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121586728A_ABST
    Figure CN121586728A_ABST
Patent Text Reader

Abstract

The present invention relates to interleukin 18 (IL-18) antibody therapies, low dose formulations of anti-IL-18 neutralizing antibodies, and the use of such formulations for the treatment of IL-18 related diseases by subcutaneous administration. The invention further relates to the use of said anti-IL-18 neutralizing antibody low-dose formulations in the treatment of e.g., adult pathogenic Stetill Disease (AOSD) or systemic pathogenic juvenile idiopathic arthritis (SoJIA, SoJIA, SoJIB, SoJIA, SoJIB, SoJIA, SoJIA, SoJIA, SoJIA, the present invention relates to the use thereof in Still disease such as Still disease (e.g., juvenile Still disease), atopic eczema or atopic dermatitis (AD), inflammatory bowel disease such as ulcerative colitis (UC) and Crohn's disease (CD), and eosinophilic esophagitis (EoE).
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to interleukin-18 (IL-18) antibody therapy, and more particularly to low-dose formulations of anti-IL-18 neutralizing antibodies, and the use of such formulations for treating IL-18-related diseases via subcutaneous administration. The invention further relates to the use of such low-dose formulations of anti-IL-18 neutralizing antibodies in the treatment of: Still's disease, such as adult-onset Still's disease (AOSD) or a juvenile-onset form known as systemic-onset juvenile idiopathic arthritis (SoJIA); atopic eczema or atopic dermatitis (AD); inflammatory bowel diseases, such as ulcerative colitis (UC) and Crohn's disease (CD); and eosinophilic esophagitis (EoE). Background Technology

[0002] Interleukin-18 (IL-18) is a pro-inflammatory cytokine produced by immune cells that activates the immune system upon detection of pathogens. In healthy individuals, IL-18 levels return to normal once the immune system clears the pathogens. However, in patients with Still's disease (adult-onset Still's disease AOSD and systemic juvenile idiopathic arthritis SoJIA), elevated IL-18 levels are strongly associated with disease activity. In healthy individuals, total serum IL-18 levels are typically between 100 and 400 pg / ml, while in Still's disease patients, this level can rise to over 500,000 pg / ml. Studies by Kudela et al. have shown that IL-18 levels exceeding 1000 pg / ml are associated with disease activity, with an average IL-18 level of 20,000 pg / ml in these patients. A study by Girard et al. of 37 adult Still's disease (AOSD) patients found that 68% of them had higher IL-18 levels than healthy controls. Similarly, a study by Weiss et al. of 29 patients with systemic juvenile idiopathic arthritis (SoJIA) showed that 79% of the patients had IL-18 levels exceeding 1,000 pg / ml. The study suggests that this high level of IL-18 is one of the key factors driving the pathogenesis of the disease.

[0003] Adult-onset Still's disease (AOSD) is an inflammatory disease characterized by daily fever, arthritis, and a transient rash. First described in children by George Still in 1897, similar cases have since been found in adults who present with clinical manifestations similar to those of children with systemic juvenile idiopathic arthritis (SIA) but do not meet the diagnostic criteria for typical rheumatoid arthritis (Bywaters, EG, Ann Rheum Dis. 30(2), 121-133 (1971)). AOSD is a rare disease. A retrospective study in France estimated the annual incidence of AOSD at 0.16 cases per 100,000 people, with a uniform distribution between sexes (Magadur-Joly G, et al., Ann Rheum Dis. 54(7):587 (1995)). It is estimated that there are approximately 3,500 to 7,000 adult-onset Still's disease patients in the United States (Gerfaud-Valentin M, et al., Medicine (Baltimore) 93(2):91 (2014)). The age of onset of the disease exhibits a bimodal distribution, with the first peak occurring between 15 and 25 years of age and the second peak occurring between 36 and 46 years of age (Magadur-Joly G, et al., Ann Rheum Dis. 54(7):587 (1995)). In addition, there have been clinical reports of cases in patients over 70 years of age (Steffe LA & Cooke CL, JAMA 249(15):2062 (1983)).

[0004] Treatment regimens are tailored to disease stage, clinical symptoms, presence of end-organ damage, and the principle of minimizing adverse effects of glucocorticoids. Initial treatment typically involves nonsteroidal anti-inflammatory drugs (NSAIDs) and glucocorticoids. For refractory patients, immunosuppressants, including methotrexate, are used. If the patient does not respond to the above treatments, biologics, including tumor necrosis factor (TNF) antagonists (such as adalimumab), interleukin-1 (IL-1) antagonists (such as anakinin and cananumumab), or interleukin-6 (IL-6) antagonists (such as tocilizumab), may be used empirically. Close monitoring for macrophage activation syndrome (MAS) is essential in clinical practice. Although this treatment strategy provides at least partial efficacy for most patients, some remain refractory or partially refractory (Jamilloux, Y., et al., Therapeutics and Clinical Risk Management (2014)). Therefore, there is an urgent need for new targeted therapies in clinical practice.

[0005] The clinical course of AOSD can be divided into three main patterns: monophasic (or single-cycle), intermittent, and chronic, with each type accounting for approximately one-third of patients (Kontzias, A. & Efthimiou, P., Drugs 68(3):319 (2008); Gerfaud-Valentin M, et al., Medicine (Baltimore) 93(2):91 (2014)). Patients with monophasic or intermittent courses often progress to the chronic arthropathy pattern (Kontzias, A. & Efthimiou, P., Drugs 68(3):319 (2008); Gerfaud-Valentin M, et al., Medicine (Baltimore) 93(2):91 (2014); Fautrel, B., Best Pract. Res. Clin. Rheumatol.22(5):773 (2008)).

[0006] Most patients with active AOSD will experience symptoms such as fever, transient rash, joint pain, and arthritis. The most commonly affected joints include the knee, wrist, ankle, elbow, proximal interphalangeal joints, and shoulder (Elkon, KB, et al., Arthritis Rheum. 25(6):647 (1982)). Many patients also have myalgia (Pouchot, J, et al., Medicine (Baltimore) 70(2):118 (1991)). Many patients also suffer from myalgia (Pouchot, J, et al., Medicine (Baltimore) 70(2):118 (1991)), pharyngitis (Nguyen, KH & Weisman MH, J Rheumatol. 24(3):592 (1997)) and liver disease (Gerfaud-Valentin, M, et al., Autoimmun Rev. Jul;13(7):708-722 (2014)). Fulminant hepatic failure has also been reported in patients with AOSD (Dino, O, et al., J Rheumatol. 23(4):784–785 (1996)). Cardiopulmonary diseases (Gerfaud-Valentin, M, et al., Autoimmun Rev. Jul;13(7):708-722 (2014);Cheema, GS & Quismorio, FP Jr. Curr Opin Pulm Med. 5(5):305 (1999)), lymphadenopathy (Gerfaud-Valentin, M, et al., Autoimmun Rev. Jul;13(7):708-722 (2014)), and splenomegaly (Gerfaud-Valentin, M, et al., Autoimmun Rev. Jul;13(7):708-722 (2014)) may also occur.

[0007] Adult-onset Still's disease can be complicated by macrophage activation syndrome (MAS), also known as hemophagocytic lymphohistiocytosis (HLH), which occurs in 12% to 19% of patients with AOSD (Arlet, JB, et al., Ann RheumDis. 65(12):1596. (2006); Bae, CB, et al., Medicine (Baltimore) 94(4):e451(2015); Hot, A, et al., Medicine (Baltimore) 89(1):37 (2010)). Other hematologic disorders that may be associated with AOSD include microangiopathic hemolytic anemia associated with thrombotic thrombocytopenic purpura hemolytic uremic syndrome (Diamond, JR, G. J Nephrol. 10(5):253 (1997); Perez, MG & Rodwig, FR Jr., South Med J. 96(1):46 (2003); Arlet, JB, et al., Ann RheumDis. 65(12):1596. (2006)). Up to half of AOSD patients may experience abdominal pain (Gerfaud-Valentin, M, et al., Autoimmun Rev. Jul;13(7):708-722 (2014)) as well as symptoms that may be associated with lymphadenitis, aseptic peritonitis or acute pancreatitis (Fautrel, B., Best Pract Res ClinRheumatol. 22(5):773 (2008)).

[0008] A diagnosis of adult-onset Still's disease can be made if a patient meets ≥5 diagnostic criteria, with ≥2 being primary criteria and no exclusion criteria (Jamilloux, Y, et al., Therapeutics and Clinical Risk Management Dec. (2014)). Primary diagnostic criteria include: body temperature >39°C for >2 weeks; arthralgia or arthritis for >2 weeks; typical non-pruritic orange-red rash; white blood cell count >10,000 / mm³; and granulocyte percentage >80% (Jamilloux, Y, et al., Therapeutics and Clinical Risk Management Dec. (2014)). Secondary diagnostic criteria include: sore throat; lymphadenopathy; splenomegaly; abnormal liver function; and negative results for antinuclear camotetzimibe and rheumatoid factor (Jamilloux, Y, et al., Therapeutics and Clinical Risk Management Dec. (2014)). Exclusion criteria include: infectious diseases; malignant tumors; other rheumatic diseases (such as vasculitis) (Jamilloux, Y, et al., Therapeutics and Clinical Risk Management Dec. (2014)).

[0009] Some treatment goals for AOSD include: controlling inflammation-related signs and symptoms (such as fever, rash, morning stiffness, joint pain, and swelling); controlling inflammation-related laboratory indicators; preventing target organ damage, including joint damage and other major organ complications; and minimizing the risk of treatment-related adverse reactions, covering both short-term and long-term adverse reactions of glucocorticoids.

[0010] IL-18 is a pro-inflammatory cytokine that plays a role in both innate and adaptive immune responses. IL-18 levels are significantly elevated in many patients with acute arterial disease (AOSD). Studies have found that IL-18 concentrations in patients with active AOSD can exceed 100,000 pg / ml, and this concentration is correlated with disease severity (Kudela, H, et al., BMC Rheum 3:4 (2019)). Elevated IL-18 levels are more specific to AOSD than in other systemic rheumatic diseases (Kawashima, M, et al., Arthritis Rheum. 44(3):550 (2001); Kudela, H., et al., BMC Rheum 3:4 (2019)). A 12-week study of 23 patients with AOSD showed that about half of the patients achieved moderate efficacy after treatment with tadekinig alfa (an IL-18-binding protein [IL-18 BP]), suggesting that targeting IL-18 may be an effective treatment strategy in AOSD (Gabay, C, et al. Ann Rheum Dis. Jun;77(6):840-847 (2018)).

[0011] Systemic onset juvenile idiopathic arthritis (SoJIA) is similar to AOSD, but differs in its classification criteria (Silva, JR, and Brito, I, Acta Reumatol Port. 45(2):150-151. (2020)). Some argue that SoJIA and AOSD are the same disease, occurring only in different age groups (Silva, JR, and Brito, I, Acta Reumatol Port. 45(2):150-151. (2020)). SoJIA is a subtype of juvenile idiopathic arthritis characterized by more severe extra-articular manifestations (such as fever and rash). See the National Institutes of Health's Center for Genetics and Rare Diseases for information on systemic juvenile idiopathic arthritis (https: / / rarediseases.info.nih.gov / diseases / 10966 / systemic-onset-juvenile-idiopathic-arthritis) (last accessed: December 14, 2021). This subtype accounts for 10-11% of juvenile idiopathic arthritis cases (see above), and the age of onset is usually between 3 and 5 years old (see above).

[0012] Clinical signs include fever, with fluctuating body temperature over 24 hours and a peak exceeding 39°C; fever is often accompanied by a transient rash, manifesting as diffuse erythema or urticaria-like lesions (same source as above). Arthritis is another typical symptom (same source as above). The number of body parts affected by arthritis varies from person to person, but almost always affects both large and small joints symmetrically (same source as above). Some patients may also experience lymphadenopathy and / or hepatosplenomegaly (same source as above). In addition, other symptoms such as pericarditis, pleural effusion, or serous peritonitis with abdominal pain may occur (same source as above). Patients with SoJIA usually have severe inflammatory disease, with significantly elevated serum ferritin levels and decreased percentage of glycosylated ferritin (same source as above). Clinicians often use the "triad" to diagnose this disease: daily fever lasting more than 2 weeks, arthritis, and rash (see Petty, R et al., J. Rheumatol. 31(2) 390-392 (2004). If the patient does not have a rash, the presence of lymphadenopathy, hepatosplenomegaly, or pleural effusion can also be used as a basis for diagnosis.

[0013] Atopic dermatitis (AD) is a chronic inflammatory skin disease. The estimated prevalence of adult atopic dermatitis in North America, Europe, and Japan is approximately 2.1% to 4.9% (Barbarot 2018). The main pathogenesis of atopic dermatitis involves defects in the skin barrier function and abnormal immune regulation, with abnormalities in innate immunity and the Th2 helper T-cell immune response being particularly crucial. Previously, treatment for moderate to severe atopic dermatitis primarily relied on potent corticosteroids and systemic immunosuppressants, which can produce significant adverse side effects (Newsom 2020). Given that moderate to severe atopic dermatitis severely impacts patients' quality of life, the development of targeted and well-tolerated immunomodulators remains of great importance.

[0014] Studies on serum total IL-18 levels in patients with moderate to severe atopic dermatitis (AD) have shown that their levels are significantly higher than those in healthy controls (Trzeciak 2011; Zedan 2015). Using the Scoring for Atopic Dermatitis Severity Scale (SCORAD), researchers found a positive correlation between elevated serum IL-18 levels and disease severity (Trzeciak 2011; Zedan 2015). Notably, IL-18 levels were even more significantly elevated in the diseased skin cells of AD patients, reaching pathogenic levels (Inoue 2011), and these levels were also correlated with disease severity. Furthermore, data from the Mendelian randomization study also confirm that IL-18 plays a pathogenic role in the pathogenesis of atopic dermatitis (McGowan 2019).

[0015] Inflammatory bowel disease (IBD) is a complex and debilitating condition that can be further subdivided into two distinct multifactorial diseases: Crohn's disease (CD) and ulcerative colitis (UC) (Kaser 2010). Although both diseases are characterized by chronic, relapsing pathological inflammation and damage to intestinal epithelial cells, their clinical presentations differ. In Crohn's disease, discontinuous lesions are visible throughout the intestinal tract, and its pathological mechanism is closely related to dysregulation of antimicrobial peptide (AMP) responses (Fellermann 2003). In ulcerative colitis, the core pathological feature is a significant reduction in goblet cells producing mucin and the mucus layer, which is associated with microbiota-induced exacerbation of colonic inflammation and disease progression (McCormick 1990). While several treatment regimens targeting specific pro-inflammatory cytokines have been approved for the treatment of Crohn's disease and ulcerative colitis, a significant proportion of patients remain unresponsive, and clinical needs remain largely unmet.

[0016] In animal models of colitis, studies have shown that IL-18 plays a crucial role in mediating pathological disruption of intestinal barrier integrity (Nowarski 2015). In this model, knocking out the IL-18 gene in intestinal epithelial cells provided mice with protection against colitis and mucosal damage. Conversely, knocking out IL-18-binding protein (IL-18bp), a negative regulator of IL-18, resulted in severe colitis in mice, accompanied by the loss of mature goblet cells, suggesting that unbound IL-18 in its free state has a pathogenic effect.

[0017] In addition to animal model data, researchers have evaluated IL-18 in UC patients (Wiercinska-Drapalo 2005). Studies have shown that serum IL-18 levels are significantly elevated in UC patients, and this level is correlated with disease severity. Furthermore, research has confirmed that mutations in the NLRC4 inflammasome lead to elevated IL-18 levels, thereby increasing the risk of UC (Steiner 2022).

[0018] The role of IL-18 in Crohn's disease has also been studied. Studies have shown that IL-18 expression levels are significantly higher in inflamed intestinal tissue of Crohn's disease patients compared to unaffected intestinal tissue (Pizarro 1999).

[0019] Genetic analysis provides further evidence for the role of IL-18 in IBD. Mendelian randomization is a well-established research method for assessing the role of biomarkers in disease etiology, minimizing confounding factors and excluding reverse causality. Studies using this technique have confirmed that elevated IL-18 levels are associated with increased susceptibility to IBD (Mokry 2019; McGowan 2019).

[0020] Eosinophilic esophagitis (EoE) is a chronic, immune-mediated inflammatory disease of the esophagus, with an annual incidence of approximately 5–10 cases per 100,000 people (Muir and Falk 2021). Clinically, it is characterized by esophageal dysfunction-related symptoms, and histologically by eosinophilic infiltration of the esophageal epithelium. It falls under the category of eosinophilic gastrointestinal diseases, characterized by eosinophilic inflammation of the gastrointestinal tract without secondary etiology (Reed and Dellon 2019).

[0021] Biologically, EoE and atopic dermatitis overlap in their pathogenesis, and IL-18 plays a clearly defined pathogenic role in atopic dermatitis. In fact, atopic constitution is extremely common in EoE patients; studies show that 20% to 80% of adult EoE patients also have any atopic disease (Dellon 2014). The potential role of IL-18 in the pathogenesis of EoE has been further confirmed by several animal experiments. One study showed that inducing IL-18 expression in a mouse model promotes the development of EoE, while mice with the IL-18 gene knocked out are protected from the disease (Dutt 2015). In another independent study, inhibitors of caspase-1 or NLRP3 that prevent the maturation and release of active IL-18 were shown to protect mice from pathogen-induced EoE in a mouse disease model (Yadavalli 2023).

[0022] In EoE patients, studies have shown that IL-18 expression is upregulated in the serum and tissues (Niranjan 2015). Furthermore, research has confirmed that IL-18 is an essential factor for the differentiation, maturation, activation, and transformation of naive eosinophils into pathogenic eosinophils, which are considered driving factors in the pathological progression of the disease (Venkateshaiah 2018).

[0023] The pro-inflammatory effects of IL-18 are regulated by IL-18-binding protein (IL-18BP), which binds to IL-18 with high affinity and inhibits its function. In this way, the pro-inflammatory signaling of IL-18 can be shut down. In the context of Alzheimer's disease (AD), some studies have speculated that excessively high IL-18 levels exceed the regulatory capacity of IL-18BP, leading to an abnormally high concentration of "free IL-18"; and this free IL-18 can initiate pro-inflammatory signaling. Summary of the Invention

[0024] The inventors of this invention have studied an anti-IL-18 antibody called Camoteskimab (formerly known as AVTX-007, CERC-007, AEVI-007, and MEDI2338), which has been described in detail in WO 2012 / 085015. Camoteskimab shares the same binding epitope to IL-18 as IL-18BP, meaning that it targets only the "free IL-18" that mediates disease. The inventors believe that low doses of Camoteskimab can produce a therapeutic effect because the antibody targets only the active pool of "free IL-18".

[0025] Similarly, in Still's disease, excessively high IL-18 levels exceed the regulatory capacity of IL-18BP, leading to the production of large amounts of "free IL-18." This free IL-18 activates pro-inflammatory signaling pathways. Therefore, for a therapeutic drug to be effective, it should target the pathogenic free IL-18, rather than IL-18 bound to IL-18BP or IL-18 bound to its corresponding receptor.

[0026] Most therapeutic antibodies used to treat diseases are typically administered intravenously (IV). However, some therapeutic antibody preparations can also be administered subcutaneously (SC). Compared to conventional intravenous injection, subcutaneous injection offers several advantages, including shorter administration time, reduced patient discomfort, less drug waste, and a potentially lower risk of medication errors due to the fixed dosage. Furthermore, subcutaneous injection is simpler to administer and easier to maintain than intravenous catheterization. A single subcutaneous injection site can be used continuously for 7 days or more, and patients do not experience the burden of an intravenous infusion pump, allowing for greater freedom of movement. More importantly, the risk of systemic infection associated with subcutaneous injection is generally lower than with intravenous injection.

[0027] However, subcutaneous injection is mostly suitable for delivering low-dose drugs (i.e., below 4 mg / kg). Typically, therapeutic antibodies administered subcutaneously are formulated at concentrations of 100-200 mg / ml, with the aim of controlling the total volume of each dose to 1-1.5 ml. These low doses are often associated with reduced antibody efficacy. Therefore, there is an urgent need to develop a low-dose anti-IL-18 antibody formulation for the treatment of IL-18-related diseases, including Still's disease, atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD), and eosinophilic esophagitis (EoE).

[0028] The inventors constructed a population pharmacokinetic model using plasma concentrations of kamotskimab and pharmacokinetic (PK) data from two completed adult clinical studies (NCT01322594 and NCT04671251). In these clinical studies, the half-life data of kamotskimab supported a dosing regimen every 4 weeks (Q4W). Subsequently, the inventors used this pharmacokinetic model to simulate a low-dose dosing regimen under the Q4-week dosing schedule.

[0029] Surprisingly, the results of PK model simulations showed that low-dose (i.e., <4 mg / kg) camotetzib was suitable for subcutaneous administration.

[0030] Furthermore, the PK model has been used to evaluate IL-18 binding levels at low doses and / or long dosing intervals. Currently approved biologic therapies for atopic dermatitis often require shorter dosing intervals, such as once weekly (Q1W) or once every two weeks (Q2W), to achieve optimal clinical efficacy. In contrast, the inventors simulated a low-dose (maximum 4 mg / kg), Q12W (dosing once every 12 weeks) regimen.

[0031] Surprisingly, these simulation results demonstrate that not only low-dose camotetzib, but also longer and more convenient dosing intervals, can achieve IL-18 blockade, thereby translating into significant clinical efficacy.

[0032] Therefore, in a first aspect of the invention, an anti-IL-18 antibody or an antigen-binding fragment thereof is provided for use in treating, preventing or improving adult-onset Still's disease (AOSD), systemic juvenile idiopathic arthritis (SoJIA), atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD) and / or eosinophilic esophagitis (EoE) in subjects, wherein the anti-IL-18 antibody or the antigen-binding fragment thereof is administered subcutaneously at a dose of 0.1-4 mg / kg.

[0033] In a second aspect of the invention, a method is provided for treating, preventing, or improving adult-onset Still's disease (AOSD), systemic juvenile idiopathic arthritis (SoJIA), atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD), and / or eosinophilic esophagitis (EoE), the method comprising subcutaneously administering an anti-IL-18 antibody or an antigen-binding fragment thereof to a subject requiring appropriate treatment at a therapeutically effective dose of 0.1-4 mg / kg.

[0034] The inventors were surprised to find that low doses of anti-IL-18 antibodies or their antigen-binding fragments (typically camotetramatzine) of only 0.1–4 mg / kg were sufficient to bind to free IL-18 in the subject's body (rather than IL-18 bound to its receptor or IL-18BP), and the binding level reached the expected therapeutic potential. For example, Figure 4 One embodiment of an anti-IL-18 antibody or its antigen-binding fragment (e.g., kamotskimab) is shown, illustrating the lowest steady-state plasma concentrations achievable at three exemplary low doses: 0.25 mg / kg, 1 mg / kg, and 2 mg / kg. Experimental results showed that the mean concentrations of the anti-IL-18 antibody or its antigen-binding fragment corresponding to the 0.25 mg / kg, 1 mg / kg, and 2 mg / kg dose groups neutralized 320,000 pg / mL, 1,300,000 pg / mL, and 2,500,000 pg / mL of free IL-18, respectively—a surprising effect. According to literature, levels of free IL-18 in patients with Still's disease (adults or children), atopic dermatitis, ulcerative colitis (UC), Crohn's disease (CD), and eosinophilic esophagitis (EoE) are significantly lower than these neutralizing concentrations. Therefore, these pharmacokinetic simulations suggest that low-dose kamotskimab is surprisingly suitable for subcutaneous administration. This is partly due to the unique binding mechanism of camotetzumab to IL-18, which means that camotetzumab only neutralizes "free IL-18", thereby targeting the active pathogenic pool of IL-18.

[0035] The inventors further estimated IL-18 binding levels at low doses and / or longer dosing intervals using a PK model. The results showed that, using a dosing regimen once every 12 weeks, low doses of 30 mg, 100 mg, and 300 mg of camotetzimiab (equivalent to 0.4 mg / kg, 1.4 mg / kg, and 4 mg / kg, respectively) achieved IL-18 neutralization rates exceeding 90%. In contrast, currently approved biologic therapies for atopic dermatitis often require short dosing intervals, such as once weekly (Q1W) or once every two weeks (Q2W), to achieve optimal clinical efficacy.

[0036] Advantageously, combining low doses of anti-IL-18 antibodies or their antigen-binding fragments at 0.1–4 mg / kg with longer and more convenient dosing intervals can achieve IL-18 blocking effects and translate into tangible clinical efficacy.

[0037] Advantageously, low doses of only 0.1–4 mg / kg can support subcutaneous administration of anti-IL-18 antibodies or their antigen-binding fragments, thereby shortening the administration time, reducing patient discomfort, minimizing drug waste, and reducing the risk of medication errors through fixed-dose administration. Furthermore, subcutaneous administration is simpler to administer and easier to maintain long-term compared to intravenous administration.

[0038] Anti-IL-18 antibodies used for the above-mentioned therapeutic purposes may contain the CDR (complementarity-determining region) sequence or the variable regions of the heavy and light chains of the antibodies disclosed in WO 2012 / 085015. These antibodies include antibody 1, antibody 1_GL, antibody 2, antibody 3, antibody 4, antibody 5, antibody 6, antibody 6_GL, antibody 7, antibody 7_GL, antibody 8_GL, antibody 9, antibody 10, antibody 11, antibody 11_GL, and antibody 12_GL as disclosed in WO 2012 / 085015.

[0039] Advantageously, the anti-IL-18 antibody of the present invention has the same binding epitope to IL-18 as the binding epitope used by the IL-18 binding protein. Therefore, after administration to a patient, the camotetzumab binds only to free IL-18, thereby blocking the sustained transduction of pro-inflammatory signals.

[0040] Therefore, preferably, the anti-IL-18 antibody or its antigen-binding fragment specifically binds to free IL-18, and preferably does not bind to IL-18 that has already bound to its corresponding receptor or IL-18 binding protein.

[0041] Antibody 12_GL, also known as camotetzumab (formerly known as AVTX-007, CERC-007, AEVI-007, and MEDI2338), is detailed in WO 2012 / 085015. Camotetzumab is a fully human IgG1κ monoclonal antibody capable of binding to and neutralizing IL-18. This antibody can inhibit the formation of the IL-18 / Rα / Rβ active complex in vitro and in vivo. Camotetzumab has a high affinity for its target (63 pM), which is 6 times higher than that of natural IL-18 inhibitors (IL-18 binding proteins), while its Fc binding ability is relatively lower, allowing it to exert its anti-inflammatory effect. As a fully human antibody, camotetzumab holds promise for reducing the probability of developing anti-drug antibodies (ADAs). In various in vitro models, this antibody exhibits IL-18 neutralizing and biological activity by attenuating the effects of IL-18, with an IC50 (half-maximal inhibitory concentration) reaching the sub-nanomolar level. It has also been demonstrated effective in a chronic obstructive pulmonary disease model (human rhinovirus-infected human bronchial epithelial cells (HRV) model), specifically by inhibiting the release of interferon-gamma from peripheral blood mononuclear cells exposed to infected cell culture medium. Furthermore, a 13-week intravenous toxicity study of camoteskiyb has been completed, showing no toxic reactions observed at weekly doses up to 100 mg / kg.

[0042] The kamotskiy monoclonal antibody comprises: (a) a heavy chain complementarity-determining region 1 (HCDR1) having an amino acid sequence identical to or comprising the amino acid sequence of SEQ ID NO: 122; (b) a heavy chain complementarity-determining region 2 (HCDR2) having an amino acid sequence identical to or comprising the amino acid sequence of SEQ ID NO: 123; (c) a heavy chain complementarity-determining region 3 (HCDR3) having an amino acid sequence identical to or comprising the amino acid sequence of SEQ ID NO: 124; (d) a light chain complementarity-determining region 1 (LCDR1) having an amino acid sequence identical to or comprising the amino acid sequence of SEQ ID NO: 126; and (e) a light chain complementarity-determining region 2 (LCDR2) having an amino acid sequence identical to or comprising the amino acid sequence of SEQ ID NO: 127. (f) The amino acid sequence of SEQ ID NO: 127; (f) Light chain complementarity determination region 1 (LCDR3), having the same amino acid sequence as the amino acid sequence of SEQ ID NO: 128, or having an amino acid sequence containing the amino acid sequence of SEQ ID NO: 128.

[0043] Kamoteszczumab includes a heavy chain variable region (VH) domain (SEQ ID NO: 121) that can pair with the light chain variable region (VL) domain (SEQ ID NO: 125) of the Kamoteszczumab to form an antigen-binding site that simultaneously contains both the VH and VL domains of the Kamoteszczumab.

[0044] Therefore, in this embodiment, the anti-IL-18 antibody or its antigen-binding fragment includes camotetzii monoclonal antibody. Thus, in a most preferred embodiment, the anti-IL-18 antibody or its antigen-binding fragment includes the following six complementarity-determining regions:

[0045] (a) A heavy chain CDR having the amino acid sequence of SEQ ID NO:122;

[0046] (b) A heavy chain CDR having the amino acid sequence of SEQ ID NO:123;

[0047] (c) Heavy chain CDR having the amino acid sequence of SEQ ID NO:124;

[0048] (d) A light chain CDR having the amino acid sequence of SEQ ID NO:126;

[0049] (e) A light chain CDR having the amino acid sequence of SEQ ID NO:127; and

[0050] (f) Light chain CDR having the amino acid sequence of SEQ ID NO:128.

[0051] In another embodiment, the anti-IL-18 antibody or its antigen-binding fragment may alternatively include the complementary determinant region sequence of other anti-IL-18 antibodies known in the art (see, for example, US6706487, WO 2001 / 058956, EP1621616, US 2005 / 0147610, EP 0 974 600 and WO 0158956).

[0052] In yet another embodiment, the anti-IL-18 antibody or its antigen-binding fragment may alternatively include the complementarity-determining region sequence or the heavy and light chain variable regions of any humanized antibody disclosed in US8133978 B2. Alternatively, the anti-IL-18 antibody or its antigen-binding fragment may be GSK1070806, a humanized immunoglobulin IgG1 / kappa antibody capable of binding to human IL-18 with high affinity (Kd = 30.3 pM) and neutralizing its function (e.g., see Reid, P. etal, Int J Clin Pharmacol Ther. 2014 Oct;52(10):867-79. doi: 10.5414 / CP202087).

[0053] Preferably, the anti-IL-18 antibody or its antigen-binding fragment may comprise one or more CDRs as described herein, such as a CDR3, and optionally may also comprise CDR1 and CDR2 to form a set of complementary determinant regions. In some embodiments, the CDR or CDR set is a CDR or CDR set of any one of antibody 1, antibody 1_GL, antibody 2, antibody 3, antibody 4, antibody 5, antibody 6, antibody 6_GL, antibody 7, antibody 7_GL, antibody 8_GL, antibody 9, antibody 10, antibody 11, antibody 11_GL, and kamoteskiy monoclonal antibody, or may be a variant thereof as described herein.

[0054] Therefore, in another respect, there is a camotetzumab or its antigen-binding fragment for use in treating, preventing or improving adult-onset Still's disease (AOSD), systemic juvenile idiopathic arthritis (SoJIA), atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD) and / or eosinophilic esophagitis (EoE) in subjects, wherein the camotetzumab or its antigen-binding fragment is administered subcutaneously at a dose of 0.1-4 mg / kg.

[0055] On the other hand, a method is provided for treating, preventing, or improving adult-onset Still's disease (AOSD), systemic juvenile idiopathic arthritis (SoJIA), atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD), and / or eosinophilic esophagitis (EoE), the method comprising subcutaneously administering kamotskimab or an antigen-binding fragment thereof to a subject requiring appropriate treatment at a therapeutically effective dose of 0.1-4 mg / kg.

[0056] Therefore, typically, a camotetzumab or its antigen-binding fragment is provided for use in treating, preventing or improving atopic dermatitis (AD) in a subject, wherein the camotetzumab or its antigen-binding fragment is administered subcutaneously at a dose of 0.1-4 mg / kg.

[0057] Typically, a method for treating, preventing, or improving atopic dermatitis (AD) is provided, which involves subcutaneously administering kamotskimab or its antigen-binding fragment to a subject requiring appropriate treatment at a therapeutically effective dose of 0.1-4 mg / kg.

[0058] In one embodiment, HCDR1 may be about 7 amino acids long, containing or consisting of residues at positions 31-35b of the Kabat number; HCDR2 may be about 16 amino acids long, containing or consisting of residues at positions 50-65 of the Kabat number; HCDR3 may be about 15 amino acids long, containing or consisting of residues at positions 95-102 of the Kabat number; LCDR1 may be about 11 amino acids long, containing or consisting of residues at positions 24-34 of the Kabat number; LCDR2 may be about 7 amino acids long, containing or consisting of residues at positions 50-56 of the Kabat number; and / or LCDR3 may be about 9 amino acids long, containing or consisting of residues at positions 89-97 of the Kabat number. It is known in the art that in the heavy chain variable region, the CDR may contain residues at positions 31-35 and insert two additional residues (i.e., residues at positions 35a and 35b). In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises HCDR1, HCDR2 and / or HCDR3 as described in Table 1, and / or LCDR1, LCDR2 and / or LCDR3 (the complementarity determinations belong to each independent antibody).

[0059] Preferably, the anti-IL-18 antibody or its antigen-binding fragment may include the heavy chain variable region (VH) described for any of the antibodies listed in Table 1. Optionally, it may also include the light chain variable region (VL) of any of the antibodies described above. The VL may be derived from the same or different antibodies or their antigen-binding fragments. This document also provides VH domains of a set of HCDRs comprising any of the antibodies listed in Table 1, and / or VL domains of a set of LCDRs comprising any of the antibodies listed in Table 1.

[0060] In a most preferred embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises a camotizoline antibody CDR having amino acid residue substitutions: (a) HCDR1 having the same amino acid sequence as SEQ ID NO:122, or having 1, 2, or 3 amino acid residue substitutions relative to the amino acid sequence of SEQ ID NO:122; (b) HCDR2 having the same amino acid sequence as SEQ ID NO:123, or having 1, 2, 3, or 4 amino acid residue substitutions relative to the amino acid sequence of SEQ ID NO:123; (c) HCDR3 having the same amino acid sequence as SEQ ID NO:124, or having 1, 2, 3, 4, or 5 amino acid residue substitutions relative to the amino acid sequence of SEQ ID NO:124; (d) LCDR1 having the same amino acid sequence as SEQ ID NO:126, or having 1, 2, 3, or 4 amino acid residue substitutions relative to the amino acid sequence of SEQ ID NO:126; (e) LCDR2 having the same amino acid sequence as SEQ ID NO:127, or having 1, 2, 3, or 4 amino acid residue substitutions relative to the amino acid sequence of SEQ ID NO:126. The amino acid sequence of NO:127 contains 1, 2, 3 or 4 amino acid residues substituted; and (f)LCDR3, having the same amino acid sequence as SEQ ID NO:128, or containing 1, 2, 3, 4, 5, 6, 7, 8 or 9 amino acid residues substituted relative to the amino acid sequence of SEQ ID NO:128.

[0061] In another embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain and / or light chain of the parent antibody. In yet another embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises any of the antibodies listed in Table 1, and its complementarity-determining region contains one or more amino acid substitutions. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises any of the antibodies listed in Table 1, and its heavy chain variable region and / or light chain variable region contains one or more amino acid substitutions. For example, the antibody molecule of the present invention may comprise any one of antibody 1, antibody 1_GL, antibody 2, antibody 3, antibody 4, antibody 5, antibody 6, antibody 6_GL, antibody 7, antibody 7_GL, antibody 8_GL, antibody 9, antibody 10, antibody 11, antibody 11_GL, and kamoteskiy monoclonal antibody, and the number of amino acid substitutions in its heavy chain variable region and / or light chain variable region is 17, 16, or less than 15, for example, 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2, or 1. The amino acid substitutions may occur at any amino acid residue, including amino acid residues within the complementarity-determining region.

[0062] Preferably, the VH domain is paired with the VL domain to form a camotetzii antibody antigen-binding site; however, as described above, either the VH or VL domain alone can also be used to bind the antigen. For example, the VH domain (SEQ ID NO: 121) of the camotetzii antibody can be paired with the VL domain (SEQ ID NO: 125) of the camotetzii antibody to form an antigen-binding site containing both the VH and VL domains of the camotetzii antibody. The VH and VL domains of other antibodies disclosed in this invention can also be configured similarly.

[0063] In one embodiment, the VH domain of a camotetzitzimbal is paired with the VL domain of a non-camotetzitzimbal. Light chain cross-pairing is common knowledge in the art. Other VH and VL domains disclosed in this invention can also adopt this configuration.

[0064] Therefore, the heavy chain variable region of parental antibody 1 or any optimized clone of antibody 1_GL, antibody 2, antibody 3, antibody 4, antibody 5, antibody 6, antibody 6_GL, antibody 7, anti-7_GL, antibody 8_GL, antibody 9, antibody 10, antibody 11, antibody 11_GL, and kamoteskiy antibody can be paired with a light chain variable region domain from another antibody. For example, the heavy chain variable region and the light chain variable region can be derived from two different antibodies selected from antibody 1, antibody 1_GL, antibody 2, antibody 3, antibody 4, antibody 5, antibody 6, antibody 6_GL, antibody 7, anti-7_GL, antibody 8_GL, antibody 9, antibody 10, antibody 11, antibody 11_GL, and kamoteskiy antibody, respectively.

[0065] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a VH domain and a VL domain, wherein: (i) the amino acid sequence of the VH domain is as shown in SEQ ID NO:121, and the amino acid sequence of the VL domain is as shown in SEQ ID NO:125; (ii) the amino acid sequence of the VH domain is substituted with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 amino acids relative to SEQ ID NO:121, and the amino acid sequence of the VL domain is substituted with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, or 13 amino acids relative to SEQ ID NO:125; or (iii) the amino acid sequence of the VH domain is at least 80%, at least 85%, at least 90%, or at least 95% identical to the sequence of SEQ ID NO:121, and the amino acid sequence of the VL domain is identical to the sequence of SEQ ID NO:125. The sequence identity of NO:125 is at least 80%, at least 85%, at least 90%, or at least 95%.

[0066] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a VH domain, the amino acid sequence of which has at least 90% sequence identity with the full-length sequence of SEQ ID NO:121. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a VH domain, the amino acid sequence of which is identical to the full-length sequence of SEQ ID NO:121. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a VL domain, the amino acid sequence of which has at least 90% sequence identity with the full-length sequence of SEQ ID NO:125. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a VL domain, the amino acid sequence of which is identical to the full-length sequence of SEQ ID NO:125. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a VH domain and a VL domain, wherein the amino acid sequences of the VH domain and the VL domain of the antibody have at least 90% sequence identity with the full-length sequences of SEQ ID NO:121 and SEQ ID NO:125, respectively.

[0067] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a heavy chain and a light chain, the heavy chain and the light chain comprising the following complementarity-determining regions (CDRs): (a) HCDR1 comprising the amino acid shown in SEQ ID NO:129; (b) HCDR2 comprising the amino acid shown in SEQ ID NO:130; (c) HCDR3 comprising the amino acid shown in SEQ ID NO:131; (d) LCDR1 comprising the amino acid shown in SEQ ID NO:132; (e) LCDR2 comprising the amino acid shown in SEQ ID NO:133; and (f) LCDR3 comprising the amino acid shown in SEQ ID NO:134.

[0068] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a heavy chain and a light chain, the heavy chain and the light chain comprising complementarity-determining regions (CDRs) as follows: (a) HCDR1, having an amino acid sequence identical to SEQ ID NO:129, or containing 1, 2, or 3 amino acid residues substituted relative to SEQ ID NO:129; (b) HCDR2, having an amino acid sequence identical to SEQ ID NO:130, or containing 1, 2, 3, or 4 amino acid residues substituted relative to SEQ ID NO:130; (c) HCDR3, having an amino acid sequence identical to SEQ ID NO:131, or containing 1, 2, 3, 4, or 5 amino acid residues substituted relative to SEQ ID NO:131; (d) LCDR1, having an amino acid sequence identical to SEQ ID NO:132, or containing 1, 2, 3, or 4 amino acid residues substituted relative to SEQ ID NO:132; (e) LCDR2, having an amino acid sequence identical to SEQ ID NO:133, or containing 1, 2, 3, or 4 amino acid residues substituted relative to SEQ ID NO:132. NO:133 contains one, two, three or four amino acid residues substituted; and (f)LCDR3, whose amino acid sequence is the same as SEQ ID NO:134, or contains one, two, three or four amino acid residues substituted relative to SEQ ID NO:134.

[0069] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a heavy chain and a light chain, wherein the amino acid sequence of the heavy chain is identical to, or includes 1 to 12 amino acid residues substituted relative to, the heavy chain amino acid sequences selected from SEQ ID NO:137, SEQ ID NO:145, and SEQ ID NO:149; and the amino acid sequence of the light chain is identical to, or includes 1 to 12 amino acid residues substituted relative to, the light chain amino acid sequences selected from SEQ ID NO:141 and SEQ ID NO:157. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment further includes replacing the 71st residue of the light chain with a corresponding residue found in a donor antibody, wherein the CDR is derived from the donor antibody. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a tyrosine residue at the 71st residue of its light chain. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a phenylalanine residue at the 71st residue of its light chain.

[0070] In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:137 and the light chain of SEQ ID NO:141. In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:145 and the light chain of SEQ ID NO:141. In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:149 and the light chain of SEQ ID NO:141. In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:137 and the light chain of SEQ ID NO:157. In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:145 and the light chain of SEQ ID NO:157. In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:149 and the light chain of SEQ ID NO:157. In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:137 and the light chain of SEQ ID NO:153. In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:145 and the light chain of SEQ ID NO:153. In one embodiment, the anti-IL-18 antibody or its antigen-binding fragment comprises the heavy chain of SEQ ID NO:149 and the light chain of SEQ ID NO:153.

[0071] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment may not contain an antibody constant region, such as a single-chain variable fragment (scFv).

[0072] In other embodiments, the anti-IL-18 antibody or its antigen-binding fragment may include an antibody constant region. The anti-IL-18 antibody or its antigen-binding fragment may be a complete antibody, such as immunoglobulin G (IgG), i.e., IgG1, IgG2, or IgG4, or may be an antibody fragment or antibody derivative described below. The antibody molecule may also have other forms, such as IgG1 with YTE in the Fc region (Dall'Acqua et al. (2002) J. Immunology, 169: 5171-5180;Dall'Acqua et al. (2006) J Biol. Chem. 281(33):23514-24) and / or TM mutation (Oganesyan et al. (2008) Acta Cryst D64:700-4).

[0073] Suitably, the anti-IL-18 antibody or its antigen-binding fragment may be administered subcutaneously at a dose of 0.1-3.9 mg / kg or 0.1-3.8 mg / kg. More preferably, the anti-IL-18 antibody or its antigen-binding fragment may be administered subcutaneously at a dose of 0.1-3.5 mg / kg or 0.1-3 mg / kg. Even more preferably, the anti-IL-18 antibody or its antigen-binding fragment may be administered subcutaneously at a dose of 0.15-3.2 mg / kg, 0.15-3.2 mg / kg, or 0.15-3 mg / kg. Even more preferably, the anti-IL-18 antibody or its antigen-binding fragment may be administered subcutaneously at a dose of 0.2-2.7 mg / kg, 0.2-2.5 mg / kg, or 0.25-2.5 mg / kg.

[0074] More preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of 0.3-3.7 mg / kg or 0.4-3.6 mg / kg. More preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of 0.4-3.5 mg / kg, 0.5-3.2 mg / kg, or 0.6-3.1 mg / kg. Even more preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of 0.7-3.5 mg / kg, 0.8-3 mg / kg, or 0.9-2.9 mg / kg.

[0075] Preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of 0.2-2.5 mg / kg or 0.25-2.5 mg / kg.

[0076] Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 0.1 mg / kg, about 0.2 mg / kg, about 0.25 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, or about 0.75 mg / kg. Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 0.25 mg / kg. This dosage is detailed in the examples.

[0077] Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 0.4 mg / kg. This dosage is detailed in the examples.

[0078] Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 1 mg / kg, about 1.25 mg / kg, about 1.4 mg / kg, about 1.5 mg / kg, or about 1.75 mg / kg. Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 1 mg / kg. This dosage is also detailed in the examples.

[0079] Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 1.4 mg / kg. This dosage is detailed in the examples.

[0080] Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 2 mg / kg, about 2.25 mg / kg, about 2.5 mg / kg, or about 2.75 mg / kg. Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 2 mg / kg. This dosage is also detailed in the examples.

[0081] Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 3 mg / kg, about 3.25 mg / kg, about 3.5 mg / kg, about 3.75 mg / kg, or about 4 mg / kg. Most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered subcutaneously at a dose of about 4 mg / kg. This dosage is detailed in the examples.

[0082] It should be understood that any of the above-mentioned dosages can be considered as the upper or lower limit of any of the above-mentioned dosage ranges. For example, anti-IL-18 antibodies or their antigen-binding fragments may be administered subcutaneously at doses of 0.15-4 mg / kg, 0.1-3 mg / kg, or 0.25-2.7 mg / kg, and so on.

[0083] In a third aspect of the invention, there is provided an anti-IL-18 antibody or an antigen-binding fragment thereof comprising an antigen-binding site of a kamotskiy monoclonal antibody for use in treating, preventing or improving adult-onset Still's disease (AOSD), systemic juvenile idiopathic arthritis (SoJIA), atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD) and / or eosinophilic esophagitis (EoE), wherein the anti-IL-18 antibody or the antigen-binding fragment thereof is administered subcutaneously at a dose of 0.1-4 mg / kg, and wherein the anti-IL-18 antibody competes with any antibody molecule that meets the following criteria: (i) is capable of binding IL-18; and (ii) comprises an antibody molecule listed in Table 1, a VH domain and / or a VL domain, a CDR (e.g., HCDR3), and / or a CDR group.

[0084] In a fourth aspect of the invention, a method is provided for treating, preventing, or improving adult-onset Still's disease (AOSD), systemic juvenile idiopathic arthritis (SoJIA), atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD), and / or eosinophilic esophagitis (EoE), the method comprising subcutaneously administering an anti-IL-18 antibody or an antigen-binding fragment thereof to a subject requiring appropriate treatment at a therapeutically effective dose of 0.1-4 mg / kg, said anti-IL-18 antibody or antigen-binding fragment thereof comprising an antigen-binding site of a kamotskiy monoclonal antibody or an antibody molecule, wherein said anti-IL-18 antibody competitively binds to IL-18 with any antibody molecule that meets the following criteria: (i) is capable of binding to IL-18; and (ii) comprises an antibody molecule listed in Table 1, a VH domain and / or a VL domain, a CDR (e.g., HCDR3), and / or a CDR group.

[0085] For example, in some embodiments, the anti-IL-18 antibody or its antigen-binding fragment may compete with antibody molecules that include the following features for binding to IL-18: (i) a VH domain having the sequence of SEQ ID NO:152 and a VL domain having the sequence of SEQ ID NO:157; (ii) a VH domain having up to 15 amino acid substitutions (e.g., 14, 13, 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1) relative to SEQ ID NO:152 and a VL domain having up to 13 amino acid substitutions (e.g., 12, 11, 10, 9, 8, 7, 6, 5, 4, 3, 2 or 1) relative to SEQ ID NO:157; or (iii) a VH domain and a VL domain having at least 90% sequence identity with SEQ ID NO:152 and SEQ ID NO:157, respectively.

[0086] Competition between anti-IL-18 antibodies can be conveniently detected in vitro, for example using enzyme-linked immunosorbent assays (ELISA) and / or biochemical competition assays. For instance, a specific reporter molecule can be labeled onto an anti-IL-18 antibody, allowing detection of the labeled antibody in the presence of one or more other unlabeled anti-IL-18 antibodies, thereby screening for anti-IL-18 antibodies capable of binding to the same or overlapping epitopes. Such methods are well known to those skilled in the art and are described in more detail herein. According to the invention, variants of the variable region amino acid sequence of any of the VH and VL domains specifically disclosed herein can be used.

[0087] As described above, in some embodiments, the VH domain of the anti-IL-18 antibody or its antigen-binding fragment has at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 95%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the VH domain of any antibody listed herein, the VH domain sequence of which is detailed in Table 1 attached below; and / or the VL domain of the anti-IL-18 antibody or its antigen-binding fragment has at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 95%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the VL domain of any antibody listed herein, the VL domain sequence of which is detailed in Table 1 attached below.

[0088] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment comprises a VH domain having a set of VH CDRs having at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 95%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the VH CDRs of any antibody listed in Table 1 below; and / or comprises a VL domain having a set of light chain VL CDRs having at least 75%, at least 80%, at least 85%, at least 90%, at least 93%, at least 95%, at least 96%, at least 95%, at least 97%, at least 98%, or at least 99% amino acid sequence identity with the VL CDRs of any antibody listed in Table 1 below.

[0089] Algorithms for calculating the percentage of identity between two amino acid sequences are known in the art, including, for example, BLAST [Altschul et al. (1990) J. Mol. Biol. 215: 405-410], FASTA [Pearson and Lipman (1988) PNAS USA 85: 2444-2448] or the Smith-Waterman algorithm [Smith and Waterman (1981) J. Mol Biol. 147: 195-197], for example, with default parameters.

[0090] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment can inhibit the binding of IL-18 to one or both of the IL-18 receptor (IL-18R, which includes IL-18Rα / IL-18Rβ) and IL-18BP, thereby reducing the activity of IL-18. In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment can bind to an epitope on the IL-18 molecule that completely or partially overlaps with the IL-18BP binding site.

[0091] For example, the anti-IL-18 antibody or its antigen-binding fragment can specifically bind to an epitope of IL-18 containing one or more of the residues of human IL-18, namely Tyr1, Gly3, Leu5, Glu6, Lys8, Met51, Lys53, Asp54, Ser55, Gln56, Pro57, Arg58, Gly59, Met60, Arg104, Ser105, and Pro107, or containing corresponding residues of IL-18 from other species (e.g., primates such as macaques). Anti-IL-18 antibodies or their antigen-binding fragments can bind to IL-18 epitopes containing 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, or all 17 residues selected from human IL-18 residues Tyr1, Gly3, Leu5, Glu6, Lys8, Met51, Lys53, Asp54, Ser55, Gln56, Pro57, Arg58, Gly59, Met60, Arg104, Ser105, and Pro107.

[0092] Preferably, the anti-IL-18 antibody or its antigen-binding fragment is used to treat AOSD.

[0093] Preferably, the anti-IL-18 antibody or its antigen-binding fragment is used to treat SoJIA.

[0094] Preferably, anti-IL-18 antibodies or their antigen-binding fragments are used to treat AD.

[0095] Preferably, the subject is a human subject diagnosed with any of the following diseases: AOSD, SoJIA, AD, ulcerative colitis (UC), Crohn's disease (CD), and / or eosinophilic esophagitis (EoE).

[0096] In some implementations, the subject was diagnosed with SoJIA.

[0097] In some embodiments, the subject's serum free IL-18 level or total serum IL-18 level is elevated. In some embodiments, serum IL-18 levels are measured before administration of an anti-IL-18 antibody or its antigen-binding fragment. In some embodiments, serum IL-18 levels are measured after administration of an anti-IL-18 antibody or its antigen-binding fragment. In some embodiments, the measurement of serum IL-18 levels is used as a biomarker of treatment effectiveness. In some embodiments, the subject's serum IL-18 level is elevated compared to the levels in subjects without AOSD or SoJIA, or compared to the levels in a negative control group. In some embodiments, the subject's serum IL-18 level is measured after administration of the anti-IL-18 antibody, kamaitskyimab, and is used as a biomarker of treatment effectiveness. In some embodiments, the measured serum IL-18 level is the free IL-18 level. In some embodiments, the free IL-18 level is calculated. In some embodiments, the measured serum IL-18 level is the total IL-18 level. In some implementations, the subject's serum free IL-18 level is elevated. In some implementations, the subject's serum total IL-18 level is elevated.

[0098] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment is administered in the form of a pharmaceutically acceptable composition.

[0099] In some embodiments, the administration period for the anti-IL-18 antibody or its antigen-binding fragment is at least 16 weeks.

[0100] In some embodiments, the anti-IL-18 antibody or its antigen-binding fragment is administered once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, or once every twelve weeks.

[0101] Preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered once every 4 weeks.

[0102] However, most preferably, the anti-IL-18 antibody or its antigen-binding fragment is administered once every 12 weeks.

[0103] In some implementation schemes, the subject's fever subsided.

[0104] In some implementations, the subjects' C-reactive protein (CRP) levels are reduced. In some implementations, the subjects' CRP levels are reduced by ≥50% from baseline to week 4. In some implementations, the subjects' CRP levels are reduced by ≥50% from baseline to week 12.

[0105] In some implementations, the subject's serum IL-18 levels are reduced.

[0106] In some implementations, the subjects' serum total IL-18 levels are reduced.

[0107] In some implementations, the subjects' serum free IL-18 levels are reduced.

[0108] In some embodiments, serum IL-18 levels in the subject decrease to undetectable levels approximately 4 weeks after administration of an anti-IL-18 antibody or its antigen-binding fragment. In some embodiments, serum IL-18 levels in the subject decrease to undetectable levels approximately 12 weeks after administration of an anti-IL-18 antibody or its antigen-binding fragment.

[0109] In some embodiments, approximately 4 weeks after administration of an anti-IL-18 antibody or its antigen-binding fragment, the subject's serum total IL-18 level drops to undetectable levels. In some embodiments, approximately 12 weeks after administration of an anti-IL-18 antibody or its antigen-binding fragment, the subject's serum free IL-18 level drops to undetectable levels. In some embodiments, approximately 12 weeks after administration of an anti-IL-18 antibody or its antigen-binding fragment, the subject's serum free IL-18 level drops to undetectable levels.

[0110] Preferably, the anti-IL-18 antibody or its antigen-binding fragment binds to free IL-18 in the subject's body. It should be understood that free IL-18 can also be referred to as unbound IL-18, meaning that it is not bound to the corresponding receptor or IL-18 binding protein (IL-18BP).

[0111] Most currently available detection methods can only detect total IL-18, which includes IL-18 bound to its receptor, IL-18BP. Total IL-18 levels may not accurately reflect the levels of disease-causing IL-18, as the pathogenic IL-18 may be free, unbound IL-18. Therefore, when methods require the detection of free IL-18, it may be desirable to use a method that detects free IL-18 separately. Alternatively, the level of free IL-18 can be calculated based on the concentrations of total IL-18 and total IL-18BP using formulas known in the art.

[0112] The anti-IL-18 antibody or its antigen-binding fragment can be administered in the form of a pharmaceutically acceptable composition. In various embodiments, the composition containing the anti-IL-18 antibody is provided as a formulation that also includes a variety of pharmaceutically acceptable carriers (see, for example, Gennaro, Remington: The Science and Practice of Pharmacy with Facts and Comparisons: Drugfacts Plus, 20th ed. (2003); Anselet et al., Pharmaceutical Dosage Forms and Drug Delivery Systems, 7th ed., Lippencott Williams and Wilkins (2004); Kibbe et al., Handbook of Pharmaceutical Excipients, 3rd ed., Pharmaceutical Press (2000)). Various pharmaceutically acceptable carriers are available, including excipients, adjuvants, and diluents. Furthermore, various pharmaceutically acceptable excipients are also available, such as pH adjusters, buffers, osmotic regulators, stabilizers, wetting agents, etc. Non-limiting exemplary carriers include physiological saline, buffered physiological saline, glucose solution, water, glycerol, ethanol, and combinations thereof.

[0113] In various embodiments, compositions comprising anti-IL-18 antibodies or antigen-binding fragments thereof may be formulated into injectable dosage forms and may be dissolved, suspended, or emulsified in aqueous or non-aqueous solvents, including vegetable oils or other oils, synthetic fatty acid glycerides, higher fatty acid esters, or propylene glycol; and, if necessary, may be added conventional excipients such as solubilizers, isotonic agents, suspending agents, emulsifiers, stabilizers, and preservatives.

[0114] In various embodiments, the composition may also be formulated into sustained-release capsules, for example, using biodegradable or non-biodegradable polymers. One non-limiting exemplary biodegradable formulation comprises a polylactic acid-glycolic acid copolymer. One non-limiting exemplary non-biodegradable formulation comprises a polyglycerol fatty acid ester. Methods for preparing such formulations are already described, for example, in EP 1125 584 A1.

[0115] Also provided are drug packages and kits comprising one or more containers, each container containing one or more doses of the anti-IL-18 antibody, Kamotsky monoclonal antibody. In some embodiments, a unit dosage form is provided, wherein the unit dosage form contains a predetermined amount of a composition comprising an anti-IL-18 antibody or an antigen-binding fragment thereof, and may or may not contain one or more additional pharmaceutical agents. In some embodiments, such a unit dosage form is supplied as a disposable pre-filled syringe. In many embodiments, the composition contained in the unit dosage form may comprise physiological saline, sucrose, etc.; buffer solutions (such as phosphate buffer, etc.); and / or be formulated within a stable and effective pH range. Furthermore, in some embodiments, the composition can be formulated as a lyophilized powder for injection, which can be reconstituted with a suitable solvent (e.g., sterile water for injection) for use. In some embodiments, the composition comprises one or more substances that inhibit protein aggregation, including but not limited to sucrose and arginine. In some embodiments, the compositions of the present invention comprise heparin and / or a proteoglycan.

[0116] Any of the above methods can be implemented using a kit for detecting and / or treating diseases associated with elevated IL-18 levels, including AOSD or SoJIA, atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD), and / or eosinophilic esophagitis (EoE). The kit may contain an antibody, one or more non-naturally occurring detectable markers or reporter substances, a pharmaceutically acceptable carrier, a physiologically acceptable carrier, instructions for use, a container, a delivery device, a detection substrate, or any combination thereof.

[0117] In some embodiments, the kit is used in methods for detecting IL-18 in biological samples. The kit may contain an anti-IL-18 antibody, carmotskiy monoclonal antibody, and reagents for performing the detection method.

[0118] In some embodiments, the kit is used for detecting IL-18 in a biological sample of a subject who has or is suspected of having AOSD or SoJIA, atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD), and / or eosinophilic esophagitis (EoE). The kit may contain an anti-IL-18 antibody, camotetzii monoclonal antibody, and reagents for performing the method.

[0119] In some embodiments, the kit is used in methods for detecting elevated IL-18 levels in a subject's biological sample, optionally in cases where the subject is suspected of having AOSD or SoJIA, atopic dermatitis (AD), ulcerative colitis (UC), Crohn's disease (CD), and / or eosinophilic esophagitis (EoE). The kit can also be used to treat the subject after diagnosis by administering an effective amount of anti-IL-18 antibody. The kit may contain the anti-IL-18 antibody camotetzimibe and reagents for performing the method.

[0120] In some embodiments, the kit used in detection and / or treatment methods comprises a solid-phase carrier on which the anti-IL-18 antibody reagent is attached. In some embodiments, the kit used in detection and / or treatment methods comprises a solid-phase carrier on which IL-18 derived from a biological sample is attached.

[0121] The solid-phase carriers used in the kits of this invention include, but are not limited to, microplates, magnetic particles, immunochromatographic filter paper, polymers such as polystyrene, glass beads, glass filters, and other insoluble carriers. In one embodiment, at least one well or region of the solid-phase matrix containing multiple wells or regions is coated with the antibody of this invention.

[0122] The kit of the present invention may also contain an additional component of a diagnostic reagent, namely an anti-IL-18 antibody. This additional component may include, but is not limited to, reagents, labeling enzymes, their corresponding substrates, radioisotopes, reflective substances, fluorescent substances, coloring substances, buffer solutions, and plate carriers, as well as all the substances described above.

[0123] According to the present invention, an "isolated" or "biopure" molecule refers to a compound that has been separated from its natural environment. Therefore, the terms "isolated" and "biopure" do not necessarily reflect the degree of purification of the compound. The isolated compounds described in this invention can be obtained from natural sources, prepared by laboratory synthesis techniques, or produced via any such chemical synthesis route.

[0124] IL-18, also known as interleukin-18, interferon-γ-inducible factor, or INF-γ-inducible factor, refers to a pro-inflammatory cytokine encoded by the IL-18 gene, belonging to the IL-1 cytokine family. Similar to IL-1β, it is initially synthesized in an inactive precursor form called pro-IL-18, which is activated upon cleavage by caspase-1. Pro-IL-18 is present in healthy cells and is constitutively expressed by monocytes and epithelial cells. IL-18 has the function of stimulating both adaptive and innate immune responses.

[0125] As used herein, "elevated IL-18" refers to a total IL-18 level detected in a subject that is higher than the normal control level. The normal control level can be determined by those skilled in the art based on the specific circumstances. In some cases, the normal control level is an industry standard generally accepted by those skilled in the art, representing the typical IL-18 level or range in individuals without IL-18-related conditions. In other cases, the normal control level is a reference IL-18 level for the same subject at a specific time point, and determining whether a subject has elevated IL-18 requires relying on IL-18 levels measured in samples taken from that subject at a different time point (usually a subsequent time point).

[0126] The terms "free IL-18" or "free (active) IL-18" as used in this article refer to the unbound form of IL-18, which is the active form of IL-18. In the human body, free IL-18 is neutralized (inactivated) by IL-18BP; IL-18BP binds to IL-18 and inhibits the activity of IL-18 by interfering with the interaction between IL-18 and IL-18Rα.

[0127] As used herein, “bound IL-18” or similar terms refer to IL-18 bound to a natural ligand, optionally IL-18Rα or IL-18BP. The amount of free IL-18 can be calculated using known methods, such as those described in Palladino et al. (2012) J. Neuroinflammation 9(206).

[0128] "Total IL-18" or similar terms refer to the total amount of free and bound IL-18. "Serum" or "circulating" IL-18 refers to IL-18 located in serum.

[0129] "Undetectable serum IL-18 levels" means that the IL-18 level is below the limit of quantitation of the IL-18 assay method.

[0130] The term "antibody" as used herein is used in the broadest sense, encompassing a variety of antibody structures, including but not limited to monoclonal antibodies, polyclonal antibodies, multispecific antibodies (such as bispecific antibodies), and antibody fragments, provided that such substances possess the desired antigen-binding activity. In this document, the term refers to a molecule that contains at least one complementarity-determining region (CDR) 1, CDR2, and CDR3 of a heavy chain, and at least one light chain of CDR1, CDR2, and CDR3, wherein the molecule is capable of binding to an antigen. As described herein, a "set of CDRs" includes CDR1, CDR2, and CDR3; therefore, a set of HCDRs refers to HCDR1, HCDR2, and HCDR3, and a set of LCDRs refers to LCDR1, LCDR2, and LCDR3. Unless otherwise stated, a "set of CDRs" includes both the aforementioned HCDRs and LCDRs. The term "antibody" as used herein includes, but is not limited to, antibody fragments with antigen-binding capabilities, such as variable fragments (Fv), single-chain variable fragments (scFv), antigen-binding fragments (Fab), Fab' fragments, and (Fab')2 fragments.

[0131] As used herein, the term "heavy chain" refers to a polypeptide chain containing at least a heavy chain variable region, which may or may not have a leader sequence. In some embodiments, the heavy chain contains at least one segment of the heavy chain constant region. The term "full-length heavy chain" refers to a polypeptide chain containing both the heavy chain variable region and the heavy chain constant region, which may or may not have a leader sequence.

[0132] The term "heavy chain variable region" or "VH domain" refers to the region containing the heavy chain complementarity-determining region 1 (CDR1), heavy chain framework region 2 (FR2), CDR2, FR3, and CDR3 of the heavy chain. In some embodiments, the heavy chain variable region may also contain at least one fragment of FR1 and / or at least one fragment of FR4. In some embodiments, heavy chain CDR1 corresponds to amino acid residues 31-35 of the Kabat; heavy chain CDR2 corresponds to amino acid residues 50-65 of the Kabat; and heavy chain CDR3 corresponds to amino acid residues 95-102 of the Kabat. For example, see Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, NIH, Bethesda, Md.).

[0133] As used herein, the term "light chain" refers to a polypeptide chain containing at least a light chain variable region, which may or may not have a leader sequence. In some embodiments, the light chain contains at least one segment of a light chain constant region. The term "full-length light chain" refers to a polypeptide chain containing both a light chain variable region and a light chain constant region, which may or may not have a leader sequence.

[0134] As used herein, the term "light chain variable region" or "VL domain" refers to the region containing light chain CDR1, FR2, HVR2, FR3, and HVR3. In some embodiments, the light chain variable region may also contain FR1 and / or FR4. In some embodiments, light chain CDR1 corresponds to amino acid residues 24-34 in the Kabat line; light chain CDR2 corresponds to amino acid residues 50-56 in the Kabat line; and light chain CDR3 corresponds to amino acid residues 89-97 in the Kabat line. See, for example, Kabat Sequences of Proteins of Immunological Interest (1987 and 1991, NIH, Bethesda, Md.).

[0135] As used herein, the term "chimeric antibody" refers to an antibody whose heavy and / or light chain sequences are derived from a specific species or source, while the remaining sequences of its heavy and / or light chains are derived from a different species or source. In some embodiments, a chimeric antibody is an antibody comprising at least one variable region derived from a first species (e.g., mouse, rat, cynomolgus monkey, etc.) and at least one constant region derived from a second species (e.g., human, cynomolgus monkey, etc.). In some embodiments, a chimeric antibody comprises at least one mouse variable region and at least one human constant region. In some embodiments, a chimeric antibody comprises at least one cynomolgus monkey variable region and at least one human constant region. In some embodiments, all variable regions of a chimeric kamotskyi antibody are derived from a first species, while all constant regions of the chimeric kamotskyi antibody are derived from a second species.

[0136] As used herein, the term "humanized antibody" refers to an antibody in which at least one amino acid in the non-human variable region backbone is replaced with a corresponding amino acid in the human variable region. In some embodiments, the humanized antibody comprises at least one human constant region or a fragment thereof. In some embodiments, the humanized antibody may be Fab, scFv, (Fab')2, etc.

[0137] The term "human antibody" as used in this article refers to antibodies produced in the human body, antibodies produced in non-human animals containing human immunoglobulin genes (such as XenoMouse®), and antibodies screened through in vitro methods such as phage display, with gene libraries of such antibodies constructed based on human immunoglobulin sequences.

[0138] The term "lead sequence" refers to a sequence of amino acid residues located at the N-terminus of a polypeptide, whose function is to facilitate the secretion of the polypeptide from mammalian cells. Once the polypeptide is transported out of the mammalian cell, the leader sequence can be cleaved, leading to the formation of the mature protein. The leader sequence can be a natural or synthetic sequence, and it can be heterologous or homologous to the protein it is linked to.

[0139] For peptide, polypeptide, or antibody sequences, "percentage of amino acid sequence identity (%)" and "homology" are defined as follows: After aligning a candidate sequence with a target peptide or polypeptide sequence, and introducing vacancies where necessary to maximize the percentage of sequence identity, the percentage of residues in the candidate sequence that are identical to the target sequence's amino acid residues is calculated relative to the total number of residues in the target sequence. Conserved substitutions are not considered in the sequence identity assessment. Alignment to determine the percentage of amino acid sequence identity can be performed using various methods known in the art, such as publicly available computer software like BLAST, BLAST-2, ALIGN, or MEGALIGN™ (DNASTAR) software. Those skilled in the art can determine appropriate parameters for measuring the alignment, including any algorithms required to achieve maximum alignment across the full length of the compared sequences.

[0140] The terms “inhibition” (verb) or “inhibition” (noun) refer to the attenuation or termination of any event (e.g., protein-ligand binding), or the attenuation or termination of any phenotypic trait, or the reduction or cessation of the probability, degree, or occurrence of that trait. “Reduction” or “inhibition” means a decrease, reduction, or cessation of a particular activity, function, and / or content compared to a control group. The effect of inhibition or reduction does not necessarily reach the level of complete blockade. For example, in some embodiments, “reduction” or “inhibition” means an overall reduction of 20% or more in the relevant indicator; in another embodiment, it means an overall reduction of 50% or more in the relevant indicator; and in yet another embodiment, it means an overall reduction of 75%, 85%, 90%, 95%, or more in the relevant indicator.

[0141] The terms "sample," "subject sample," or "biological sample" refer to any sample that can be used for a specific molecular assay. Samples include, but are not limited to, cells, bone marrow, and body fluids, including blood, serum, plasma, urine, saliva, feces, tears, pleural effusion, and similar fluids.

[0142] The terms “reagent” and “test compound” are used interchangeably herein to refer to a chemical compound, a mixture of chemical compounds, a biological macromolecule, or an extract prepared from biological materials such as bacteria, plants, fungi, or animal (especially mammalian) cells or tissues. Biological macromolecules include siRNA, shRNA, antisense oligonucleotides, polypeptides, polypeptide / DNA complexes, and any class of nucleic acid molecules that exhibit the ability to regulate the activity of nucleic acids containing SNPs or their encoded proteins as described herein.

[0143] "Subject" can be a mammal. In any implementation involving a subject, the subject can be a human; in any implementation involving a subject, the subject can be a cow, pig, monkey, sheep, dog, cat, fish, or bird.

[0144] In this article, the term "pediatric subject" refers to a human being under the age of 18, while "adult subject" refers to a human being 18 years of age or older.

[0145] The term "pharmaceuticalally acceptable composition" refers to a formulation containing an anti-IL-18 antibody and formulated with a variety of pharmaceutically acceptable carriers.

[0146] The term "pharmaceutically acceptable carrier" refers to a component in a pharmaceutical preparation or composition other than the active ingredient that is non-toxic to the subject. Pharmaceutically acceptable carriers include, but are not limited to, buffers, excipients, stabilizers, and / or preservatives.

[0147] "Treatment" (noun) or "treatment" (verb) refers to both therapeutic procedures and preventative or protective measures. Individuals requiring treatment include those already suffering from the disease, those susceptible to the disease, and those needing to prevent the disease from developing. For the purposes of this invention, beneficial or anticipated clinical effects include, but are not limited to: symptom relief, reduction in lesion size, stabilization of the condition (i.e., no further deterioration), delayed or slowed disease progression, improvement or reduction of the condition, and disease remission (whether partial or complete remission, whether detectable). "Treatment" can also refer to an extension of life expectancy compared to the expected life expectancy without treatment. Individuals requiring treatment include those already suffering from the disease, those susceptible to the disease, and those needing to prevent the disease from developing.

[0148] The term "effective dose" or "therapeutic effective dose" refers to a dose of medicine that is effective in treating a subject's disease or condition, such as a dose that partially or completely relieves one or more symptoms. In some implementations, the effective dose refers to the dose at which the desired therapeutic or preventative effect is achieved at the required dosage and duration of administration.

[0149] Adult-onset Still's disease (AOSD) can be diagnosed using various methods. Currently, a generally accepted diagnostic method is based on the following classification criteria: At least five of the following criteria must be met: fever >39°C for 1 week or more; joint pain or arthritis for 2 weeks or more; characteristic rash; white blood cell count >10,000 / mm³ with neutrophils >80%; sore throat; recent significant lymphadenopathy; hepatomegaly or splenomegaly; abnormal liver function tests; negative antinuclear antibody (IF) and rheumatoid factor (IgM) tests. Additionally, at least two of the following criteria must be met: fever >39°C for 1 week or more; joint pain or arthritis for 2 weeks or more; characteristic rash; white blood cell count >10,000 / mm³ with polymorphonuclear leukocytes >80%.

[0150] "Systemic onset juvenile idiopathic arthritis" (SoJIA), "systemic juvenile idiopathic arthritis" (SJIA), or "sJIA" refers to a subtype of juvenile idiopathic arthritis characterized by more severe extra-articular manifestations (fever, rash). This subtype accounts for 10-11% of juvenile idiopathic arthritis cases, with an age of onset typically between 3 and 5 years. Clinical symptoms include: fluctuating body temperature over 24 hours, peaking at 39°C or higher, often accompanied by a transient rash, manifesting as diffuse erythema or urticaria-like lesions; another typical symptom is arthritis, with the number of affected joints varying from person to person, but large and small joints are often nearly symmetrically affected. Some patients may also experience lymphadenopathy and / or hepatosplenomegaly; other symptoms such as pericarditis, pleural effusion, or serous peritonitis with abdominal pain may also be present. SoJIA patients typically have severe inflammatory disease, with significantly elevated ferritin levels and a decreased percentage of glycated ferritin. Doctors typically use the “clinical triad” to diagnose this disease: daily fever lasting more than two weeks, arthritis, and a rash. See Petty, R et al., J. Rheumatol. 31(2) 390-392 (2004). A diagnosis can also be made if the patient has adenosis, hepatosplenomegaly, or serous cavity effusion but no rash.

[0151] Atopic dermatitis (AD) is a chronic, persistent inflammatory skin condition that causes inflammation, redness, and irritation of the skin. It is a common condition that typically begins in childhood, but can affect people of any age. Atopic dermatitis causes intense itching, and scratching can further lead to redness, swelling, cracking, oozing of clear fluid, crusting, and scaling. In most cases, the condition involves exacerbation phases, known as flare-ups, followed by periods of improvement or complete resolution, known as remission phases.

[0152] Inflammatory bowel disease (IBD) refers to a group of chronic inflammatory diseases of the gastrointestinal tract with unknown causes, including Crohn's disease (CD), ulcerative colitis (UC), and unclassified inflammatory bowel disease. These diseases are all chronic, relapsing, or progressive inflammatory lesions that can affect the entire gastrointestinal tract and colonic mucosa.

[0153] "Ulcerative colitis (UC)" refers to a subtype of inflammatory bowel disease (IBD) characterized by continuous inflammation and lesions confined to the colon.

[0154] Crohn's disease (CD) is another subtype of inflammatory bowel disease (IBD), characterized by discontinuous inflammation that can affect the entire gastrointestinal tract from the mouth to the anus and can cause long-term disabling sequelae such as fistulas and intestinal stenosis.

[0155] Eosinophilic esophagitis (EoE) is a chronic disease characterized by esophageal dysfunction and histological features of eosinophilic infiltration in the esophageal epithelium. Eosinophilic esophagitis is a significant contributing factor to upper gastrointestinal tract diseases worldwide, representing a growing health problem and placing a heavy burden on healthcare systems.

[0156] In another aspect of the invention, an anti-IL-18 antibody or antigen-binding fragment thereof is provided for use in treating, preventing or improving adult-onset Still's disease (AOSD), systemic juvenile idiopathic arthritis (SoJIA), or atopic dermatitis (AD) in subjects, wherein the anti-IL-18 antibody or antigen-binding fragment thereof is administered subcutaneously at a dose of 0.1-4 mg / kg.

[0157] On the other hand, a method is provided for treating, preventing or improving adult-onset Still's disease (AOSD), systemic juvenile idiopathic arthritis (SoJIA), or atopic dermatitis (AD), comprising subcutaneously administering an anti-IL-18 antibody or its antigen-binding fragment at a therapeutically effective dose of 0.1-4 mg / kg to a subject requiring appropriate treatment.

[0158] All features described herein (including any features recorded in the appended claims, abstract and drawings) and / or all steps of any disclosed method or process may be used in any combination with any of the foregoing aspects, except where there are combinations in which at least some features and / or steps are mutually exclusive. Attached Figure Description

[0159] To better understand the present invention and to illustrate how to specifically implement the various embodiments of the present invention, the following description will be provided in conjunction with the embodiments and the accompanying drawings, wherein:

[0160] Figure 1A population pharmacokinetic (PK) model is presented, employing kamotskimab plasma concentration data and pharmacokinetic data from two clinical trials, NCT01322594 and NCT04671251. As observed in the aforementioned clinical trials, the half-life data for kamotskimab supports a dosing regimen every 4 weeks (Q4W). Subsequently, the PK model was used to simulate a dosing dose of 0.25 mg / kg. In the figure, the x-axis represents time in days, and the y-axis represents serum drug concentration in µg / mL.

[0161] Figure 2 It shows the relationship with Figure 1 The same modeling is used, but simulation results of the PK model are shown when the dosage is 1 mg / kg.

[0162] Figure 3 It shows the relationship with Figure 1 and Figure 2 The same modeling is used, but simulation results of the PK model are shown when the dosage is 2 mg / kg.

[0163] Figure 4 It shows Figure 1 , Figure 2 and Figure 3 The table shows a summary of the simulation results of the PK model of Kamoteskiy monoclonal antibody.

[0164] Figure 5 The diagram shows the predicted results of a PK model for subcutaneous administration of kamotskimab with the following dosing regimens: (A) 30 mg Q12W, (B) 100 mg Q12W, (C) 300 mg Q12W, and (D) 300 mg Q4W. The y-axis represents the percentage of remaining free IL-18, and the x-axis represents time in days. The colored lines represent 100 independent simulations, with the solid black line representing the geometric mean. The red horizontal line represents the critical value for kamotskimab to neutralize 90% of IL-18, and the red vertical line represents the endpoint of the dosing interval used in the simulation. Detailed Implementation

[0165] The inventors constructed a population pharmacokinetic (PK) model using plasma concentration data of kamotskimab and PK data from two completed adult clinical trials (NCT01322594 and NCT04671251). The results of these two clinical trials showed that the half-life data of kamotskimab supported a dosing regimen every 4 weeks (Q4W). This PK model was then used to simulate a low-dose dosing regimen every 4 weeks. To evaluate the dosing regimen for atopic dermatitis (AD), the PK model was further used to estimate IL-18 binding levels at low doses under a 12-week dosing regimen (longer dosing interval).

[0166] The simulation results of the PK model are as follows.

[0167] In addition, the inventors attempted to validate the pharmacokinetics of kamotskimab using a low-dose dosing regimen as described below.

[0168] The following examples are used to illustrate some embodiments disclosed in this disclosure and should not be construed as limiting the scope of protection of this disclosure in any way. In the following examples, "Camoteskimab" refers to an anti-IL-18 antibody comprising the following six CDRs: a heavy chain CDR having the amino acid sequence of SEQ ID NO:122; a heavy chain CDR having the amino acid sequence of SEQ ID NO:123; a heavy chain CDR having the amino acid sequence of SEQ ID NO:124; a light chain CDR having the amino acid sequence of SEQ ID NO:126; a light chain CDR having the amino acid sequence of SEQ ID NO:127; and a light chain CDR having the amino acid sequence of SEQ ID NO:128. In some embodiments, Camoteskimab has a heavy chain variable region (VH) and a light chain variable region (VL), wherein the heavy chain variable region has the amino acid sequence of SEQ ID NO:121 and the light chain variable region has the amino acid sequence of SEQ ID NO:125.

[0169] Example 1 - Evaluation of subcutaneous administration of carmotskimumab in population drug trials in adult subjects with onset Still's disease generational dynamics model

[0170] Population pharmacokinetic (PK) models were constructed using plasma concentration data of kamotskimab and PK data from two completed adult clinical trials. The two clinical trials were NCT04671251 (AEVI-007-MM-101, sample size n=13) and NCT01322594 (CD-RI-MEDI2338-1033, sample size n=24). The two-compartment linear clearance model showed the best fit to the data. A goodness-of-fit plot was used for validation to confirm the absence of any systematic bias or trend. The values ​​of pharmacokinetic parameters such as clearance and volume of distribution are consistent with the reported ranges for antibody drugs in the literature. As observed in the aforementioned clinical trials, the half-life data of kamotskimab supports a dosing regimen every 4 weeks (Q4W).

[0171] Subsequently, the PK model was used to simulate three dosage regimens under the Q4W plan: 0.25 mg / kg, 1 mg / kg, and 2 mg / kg. The simulation results are detailed in [link to simulation results]. Figures 1 to 3 The summarized data is as follows Figure 4 As shown.

[0172] Figure 4 The average valley concentration (C) trough The values ​​represent the lowest steady-state plasma levels of kamotisumab achieved at the aforementioned doses. The mean concentrations of kamotisumab corresponding to the dose groups of 0.25 mg / kg, 1 mg / kg, and 2 mg / kg neutralized 320,000 pg / mL, 1,300,000 pg / mL, and 2,500,000 pg / mL of free IL-18, respectively. Existing literature data indicate that the levels of free IL-18 in adult-onset Still's disease or atopic dermatitis are much lower than these values. Therefore, the above PK simulation results confirm that low-dose kamotisumab is unexpectedly suitable for subcutaneous administration.

[0173] Example 2 - Pharmacokinetic evaluation of the ability of low-dose kamotskimab to neutralize free IL-18 in animal serum Dynamics study

[0174] The standard formulation used in the above clinical trials, with a concentration of 50 mg / mL, will be concentrated to 100 mg / mL or higher.

[0175] The aforementioned new high-concentration formulation will be used in subcutaneous PK studies (e.g., in humans (healthy volunteers or patients) or monkeys) to verify that the physicochemical properties and biological activity of the antibody are not affected under low-dose conditions, while confirming that low-dose administration can enable camotetzib to reach serum concentrations sufficient to effectively neutralize IL-18.

[0176] The physicochemical properties of the antibodies to be evaluated include, but are not limited to: the presence or absence of aggregates, the degree of protein degradation (both of which can be detected by HPLC analysis), and / or the molecular weight of antibody subunits, which can be determined by gel electrophoresis. In addition, the viscosity of the high-concentration formulation will be analyzed to ensure that it is suitable for subcutaneous injection.

[0177] Similarly, the antibody biological activities to be evaluated include, but are not limited to, verifying the binding affinity of camotetzigmab to IL-18 (i.e., the antibody titer) through an antigen-binding assay. In addition, a cell-based activity assay will be employed to confirm that camotetzigmab can block the biological function of IL-18 by detecting its ability to induce the production of other cytokines (such as interferon-gamma).

[0178] The pharmacokinetics (PK) of the antibody administered subcutaneously will then be evaluated in animals or humans, with an intravenous (IV) injection group serving as a control. More specifically, experimental animals will be administered different doses of the antibody subcutaneously or intravenously, and blood samples will be collected and analyzed at different time points within a defined time period to determine serum camotetzumab concentrations. This analysis will confirm that subcutaneous injection can achieve serum camotetzumab concentrations required for clinical studies.

[0179] The results from the experimental and control groups will be compared and analyzed to determine the pharmacokinetic (PK) characteristics and antibody clearance rates of subcutaneous and intravenous administration. These data will be used to optimize the PK model and dosage simulation protocol before initiating clinical studies in human patients to test low-dose subcutaneous administration of kamotskimab.

[0180] Example 3 - Evaluation of population pharmacokinetics of subcutaneous administration of kamotskimab in subjects with atopic dermatitis (AD) Learning Model

[0181] Three low-dose dosing regimens were further simulated using the PK model described in Example 1, with doses of 30 mg, 100 mg, and 300 mg (equivalent to 0.4 mg / kg, 1.4 mg / kg, and 4 mg / kg, respectively), administered every 12 weeks (Q12W). This study also included simulations of a high-dose (300 mg) regimen administered every 4 weeks (Q4W). These simulations were used to determine the remaining percentage of free IL-18 after camotetzimiab treatment; the simulation results are detailed in [link to simulation results]. Figure 5 Given that the elevated IL-18 levels in patients with UC, CD, and EoE are similar to those in patients with AD, these PK simulation results are also applicable to studies of subcutaneous administration of low-dose camotetzizumab for the treatment of UC, CD, and EoE.

[0182] Each graph contains 100 independent simulations, with the black solid line representing the average. The data show that all dosages and dosing regimens can achieve a neutralization rate of over 90% for IL-18. This indicates that low-dose camotetzimiab can not only achieve this effect, but also, with longer and more convenient dosing intervals, can achieve IL-18 blockade, thus translating into clinically meaningful efficacy.

[0183] Example 4 - Formulation of an anti-IL-18 antibody drug suitable for subcutaneous delivery

[0184] The inventors prepared a high-concentration formulation of kamotskiy monoclonal antibody at a concentration of 100 mg / mL and subsequently evaluated its properties and suitability for subcutaneous injection using a microinjector. Preliminary results showed that the high-concentration formulation possesses suitable properties for subcutaneous administration and microinjector use. Notably, the pH value of the formulation is within the range that is unlikely to induce adverse reactions such as injection site pain, and the viscosity meets the requirements for use with standard autoinjectors.

[0185] property result pH value 6.04 density 1.065 g / mL viscosity 15.23 mg / mL protein concentration 105.7 mg / mL

[0186] Other reference materials

[0187] Dellon ES, Liacouras CA. Advances in clinical management ofeosinophilic esophagitis. Gastroenterology. 2014; 147(6):1238-1254.

[0188] Dutt P, Shukla JS, Ventateshaiah SU, Mariswamy SJ, Mattner J, ShuklaA, Mishra A. Allergen-induced interleukin-18 promotes experimentaleosinophilic oesophagitis in mice. Immunol Cell Biol. 2015 Nov;93(10):849-57.

[0189] Fellermann, K., Wehkamp, J., Herrlinger, K.R., and Stange, E.F.(2003). Crohn’s disease: a defensin deficiency syndrome? Eur. J.Gastroenterol. Hepatol. 15, 627–634.

[0190] Girard C, Rech J, Brown M, Allali D, Roux-Lombard P, Spertini F,Schiffrin EJ, Schett G, Manger B, Bas S, Del Val G, Gabay C. Elevated serumlevels of free interleukin-18 in adult-onset Still’s disease. Rheumatology(Oxford). 2016 Dec;55(12):2237-2247.

[0191] Inoue Y, Aihara M, Kirino M, Harada I, Komori-Yamaguchi J, YamaguchiY, Nagashima Y, Ikezawa Z. Interleukin-18 is elevated in the horny layer inpatients with atopic dermatitis and is associated with Staphylococcus aureuscolonization. Br J Dermatol. 2011 Mar;164(3):560-7.

[0192] Jung KH, Kim JJ, Lee JS, Park W, Kim TH, Jun JB, Yoo DH. Interleukin-18 as an efficient marker for remission and follow-up in patients withinactive adult-onset Still’s disease. Scand J Rheumatol. 2014;43(2):162-9.

[0193] Kaser, A., Zeissig, S., and Blumberg, R.S. (2010). Inflammatory boweldisease. Annu. Rev. Immunol. 28, 573-621.

[0194] Kudela H, Drynda S, Lux A, Horneff G, Kekow J. 2019. Comparativestudy of Interleukin-18 (IL-18) serum levels in adult onset Still’s disease(AOSD) and systemic onset juvenile idiopathic arthritis (sJIA) and its use asa biomarker for diagnosis and evaluation of disease activity. BMC Rheumatol.3:4.

[0195] McCormick, D.A., Horton, L.W., and Mee, A.S. (1990). Mucin depletionin inflammatory bowel disease. J. Clin. Pathol. 43, 143–146.

[0196] McGowan LM, Davey Smith G, Gaunt TR, Richardson TG. IntegratingMendelian randomization and multiple-trait colocalization to uncover cell-specific inflammatory drivers of autoimmune and atopic disease. Hum MolGenet. 2019 Oct 1;28(19):3293-3300.

[0197] Mokry , LE , Zhou , S. , Guo , C. et al. Interleukin-18 as a drugrepositioning opportunity for inflammatory bowel disease: A Mendelian randomization study. Sci Rep 9, 9386 (2019).

[0198] Muir A, Falk GW. Eosinophilic Esophagitis: A Review. JAMA. 2021 Oct5;326(13):1310-1318.

[0199] Niranjan R, Rajavelu P, Ventateshaiah SU, Shukla JS, Zaidi A,Mariswamy SJ, Mattner J, Fortgang I, Kowalczyk M, Balart L, Shukla A, MishraA. Involvement of interleukin-18 in the pathogenesis of human eosinophilicesophagitis. Clin Immunol. 2015 Apr;157(2):103-13.

[0200] Nowarski R, Jackson R, Gagliani N, de Zoete MR, Palm NW, Bailis W,Low JS, Harman CC, Graham M, Elinav E, Flavell RA. Epithelial IL-18Equilibrium Controls Barrier Function in Colitis. Cell. 2015 Dec 3;163(6):1444-56.

[0201] Pizarro TT, Michie MH, Bentz M, Woraratanadharm J, Smith MF Jr, FoleyE, Moskaluk CA, Bickston SJ, Cominelli F. IL-18, a novel immunoregulatorycytokine, is up-regulated in Crohn's disease: expression and localization in intestinal mucosal cells. J Immunol. 1999 Jun 1;162(11):6829-35.

[0202] Reed CC, Dellon ES. Eosinophilic Esophagitis. North Am Clin Med. 2019Jan;103(1):29-4

[0203] Steiner A, Reygaerts T, Pontillo A, Ceccherini I, Moecking J,Moghaddas F, Davidson S, Caroli F, Grossi A, Castro FFM, Kalil J, Gohr FN,Schmidt FI, Bartok E, Zillinger T, Hartmann G, Geyer M, Gattorno M, MendonçaLO, Masters SL. Recessive NLRC4-Autoinflammatory Disease Reveals anUlcerative Colitis Locus. J Clin Immunol. 2022 Feb;42(2):325-335.

[0204] Trzeciak M, Gleń J, Bandurski T, Sokołowska-Wojdyło M, Wilkowska A,Roszkiewicz J. Relationship between serum levels of interleukin-18, IgE anddisease severity in patients with atopic dermatitis. Clin Exp Dermatol. 2011Oct;36(7):728-32.

[0205] [ PMC free article ] [ PubMed ] Venkateshaiah SU, Mishra A, Manohar M, Verma AK, Rajavelu P, NiranjanR, Wild LG, Parada NA, Blecker U, Lasky JA, Mishra A. A critical role for IL-18 in transformation and maturation of naive eosinophils to pathogeniceosinophils. J Allergy Clin Immunol. 2018 Jul;142(1):301-305.

[0206] Weiss ES, Girard-Guyonvarc'h C, Holzinger D, de Jesus AA, Tariq Z,Picarsic J, Schiffrin EJ, Foell D, Grom AA, Ammann S, Ehl S, Hoshino T,Goldbach-Mansky R, Gabay C, Canna SW. 2018. Interleukin-18 diagnostically distinguishes and pathogenically promotes human and murine macrophage activation syndrome. Blood. 131(13):1442–1455.

[0207] Wiercinska-Drapalo A, Flisiak R, Jaroszewicz J, Prokopowicz D. Plasma interleukin-18 reflects severity of ulcerative colitis. World JGastroenterol. 2005 Jan 28;11(4):605-8.

[0208] Yadavalli CS, Upparahalli Venkateshaiah S, Kumar S, Kandikattu HK,Oruganti L, Kathera CS, Mishra A. Allergen-induced NLRP3 / caspase1 / IL-18signaling initiates eosinophilic esophagitis and respective inhibitors protectdisease pathogenesis. Commun Biol. 2023 Jul 31;6(1):763.

[0209] Zedan K, Rasheed Z, Farouk Y, Alzolibani AA, Bin Saif G, Ismail HA,Al Robaee AA. Immunoglobulin, interleukin-18 and interleukin-12 in patientswith atopic dermatitis: correlation with disease activity. J Clin Diagn Res.2015 Apr;9(4):WC01-5.

[0210] McGowan LM, Davey Smith G, Gaunt TR, Richardson TG. Integrating Mendelian randomization and multiple-trait colocalization to uncover cell-specific inflammatory drivers of autoimmune and atopic disease. Hum MolGenet. 2019 Oct 1;28(19):3293-3300.

[0211] The following table provides the sequences referenced in this application.

[0212] Table 1 - Sequence List

[0213] Serial Number (SEQ ID NO) describe sequence 1 Antibody 1 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Lys Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 2 Antibody 1 HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 3 Antibody 1 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 4 Antibody 1 HCDR3 Thr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val 5 Antibody 1 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Arg Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer Tyr Ser Thr Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 6 Antibody 1 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 7 Antibody 1 LCDR2 Lys Ala Ser Thr Leu Glu Ser 8 Antibody 1 LCDR3 Gln Gln Ser Tyr Ser Thr Pro Trp Thr 9 Antibody 1_GL VH Gln Val Gln Leu Gln Glu Ser Gly ProGly Leu Val Lys Pro Ser Glu Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Pro Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Ser Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 10 Antibody 1_GL HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 11 Antibody 1_GL HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 12 Antibody 1_GL HCDR3 Thr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val 13 Antibody 1_GL VL Asp Ile Gln Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Glu Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro AspAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer Tyr Ser Thr Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 14 Antibody 1_GL LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 15 Antibody 1_GL LCDR2 Lys Ala Ser Thr Leu Glu Ser 16 Antibody 1_GL LCDR3 Gln Gln Ser Tyr Ser Thr Pro Trp Thr 17 Antibody 2 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Lys Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 18 Antibody 2 HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 19 Antibody 2 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 20 Antibody 2 HCDR3 Thr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val 21 Antibody 2 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Arg Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln AspIle Ser Phe Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 22 Antibody 2 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 23 Antibody 2 LCDR2 Lys Ala Ser Thr Leu Glu Ser 24 Antibody 2 LCDR3 Gln Asp Ile Ser Phe Pro Pro Trp Thr 25 Antibody 3 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Lys Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 26 Antibody 3 HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 27 Antibody 3 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 28 Antibody 3 HCDR3 Thr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val 29 Antibody 3 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Arg Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer Leu Tyr Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 30 Antibody 3 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 31 Antibody 3 LCDR2 Lys Ala Ser Thr Leu Glu Ser 32 Antibody 3 LCDR3 Gln Gln Ser Leu Tyr Pro Pro Trp Thr 33 Antibody 4 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Lys Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 34 Antibody 4 HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 35 Antibody 4 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 36 Antibody 4 HCDR3 Thr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val 37 Antibody 4 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Arg Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Asn Trp Asp Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 38 Antibody 4 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 39 Antibody 4 LCDR2 Lys Ala Ser Thr Leu Glu Ser 40 Antibody 4 LCDR3 Gln Gln Ser His His Pro Asn Trp Asp 41 Antibody 5 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Lys Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 42 Antibody 5 HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 43 Antibody 5 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 44 Antibody 5 HCDR3 Thr Pro Ala Tyr Asp Gly Asp Ala ArgAla Asp Phe Phe Asp Val 45 Antibody 5 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Arg Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer Leu Ile Pro Gln Trp Asp Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 46 Antibody 5 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 47 Antibody 5 LCDR2 Lys Ala Ser Thr Leu Glu Ser 48 Antibody 5 LCDR3 Gln Gln Ser Leu Ile Pro Gln Trp Asp 49 Antibody 6 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Lys Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 50 Antibody 6 HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 51 Antibody 6 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 52 Antibody 6 HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 53 Antibody 6 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Arg Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Ala AsnIle Ala Phe Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 54 Antibody 6 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 55 Antibody 6 LCDR2 Lys Ala Ser Thr Leu Glu Ser 56 Antibody 6 LCDR3 Ala Asn Ile Ala Phe Pro Pro Trp Thr 57 Antibody 6_GL VH Gln Val Gln Leu Gln Glu Ser Gly ProGly Leu Val Lys Pro Ser Glu Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Pro Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Ser Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 58 Antibody 6_GL HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 59 Antibody 6_GL HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 60 Antibody 6_GL HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 61 Antibody 6_GL VL Asp Ile Gln Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Glu Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro AspAsp Phe Ala Thr Tyr Tyr Cys Ala AsnIle Ala Phe Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 62 Antibody 6_GL LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 63 Antibody 6_GL LCDR2 Lys Ala Ser Thr Leu Glu Ser 64 Antibody 6_GL Ala Asn Ile Ala Phe Pro Pro Trp Thr 65 Antibody 7 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Lys Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 66 Antibody 7 HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 67 Antibody 7 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 68 Antibody 7 HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 69 Antibody 7 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Arg Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 70 Antibody 7 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 71 Antibody 7 LCDR2 Lys Ala Ser Thr Leu Glu Ser 72 Antibody 7 LCDR3 Gln Gln Ser His His Pro Pro Trp Thr 73 Antibody 7_GL VH Gln Val Gln Leu Gln Glu Ser Gly ProGly Leu Val Lys Pro Ser Glu Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Pro Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Ser Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 74 Antibody 7_GL HCDR1 Ser Gly Gly Tyr Tyr Trp Ser 75 Antibody 7_GL HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 76 Antibody 7_GL HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 77 Antibody 7_GL VL Asp Ile Gln Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Glu Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro AspAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 78 Antibody 7_GL LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 79 Antibody 7_GL LCDR2 Lys Ala Ser Thr Leu Glu Ser 80 Antibody 7_GL LCDR3 Gln Gln Ser His His Pro Pro Trp Thr 81 Antibody 8_GL VH Gln Val Gln Leu Gln Glu Ser Gly ProGly Leu Val Lys Pro Ser Glu Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ala Gly Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Pro Gly LysGly Leu Glu Trp Ile Gly Ser Leu TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Gly Arg Val Thr Ile SerGly Asp Thr Ser Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 82 Antibody 8_GL HCDR1 Ala Gly Gly Tyr Tyr Trp Ser 83 Antibody 8_GL HCDR2 Ser Leu Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Gly 84 Antibody 8_GL HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 85 Antibody 8_GL VL Asp Ile Gln Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Glu Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro AspAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 86 Antibody 8_GL LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 87 Antibody 8_GL LCDR2 Lys Ala Ser Thr Leu Glu Ser 88 Antibody 8_GL LCDR3 Gln Gln Ser His His Pro Pro Trp Thr 89 Antibody 9 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Glu Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Asp Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 90 Antibody 9 HCDR1 Ser Asp Gly Tyr Tyr Trp Ser 91 Antibody 9 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Ser 92 Antibody 9 HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 93 Antibody 9 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Arg Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 94 Antibody 9 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 95 Antibody 9 LCDR2 Lys Ala Ser Thr Leu Glu Ser 96 Antibody 9 LCDR3 Gln Gln Ser His His Pro Pro Trp Thr 97 Antibody 10 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Glu Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ser Asp Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Ile TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Arg Ser Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 98 Antibody 10 HCDR1 Ser Asp Gly Tyr Tyr Trp Ser 99 Antibody 10 HCDR2 Ser Ile Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Arg Ser 100 Antibody 10 HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 101 Antibody 10 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Gly Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Pro Trp Thr Phe SerGln Gly Thr Lys Leu Glu Ile Lys 102 Antibody 10 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 103 Antibody 10 LCDR2 Lys Ala Ser Thr Leu Glu Ser 104 Antibody 10 LCDR3 Gln Gln Ser His His Pro Pro Trp Thr 105 Antibody 11 VH Gln Val Gln Leu Gln Gln Ser Gly ProArg Leu Val Glu Pro Ser Gln Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ala Asp Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Ala Gly LysGly Leu Glu Trp Ile Gly Ser Leu TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Arg Gly Arg Val Thr Ile SerGly Asp Thr Pro Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 106 Antibody 11 HCDR1 Ala Asp Gly Tyr Tyr Trp Ser 107 Antibody 11 HCDR2 Ser Leu Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Arg Gly 108 Antibody 11 HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 109 Antibody 11 VL Asp Ile Val Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Gly Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Pro Trp Thr Phe SerGln Gly Thr Lys Leu Glu Ile Lys 110 Antibody 11 LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 111 Antibody 11 LCDR2 Lys Ala Ser Thr Leu Glu Ser 112 Antibody 11 LCDR3 Gln Gln Ser His His Pro Pro Trp Thr 113 Antibody 11_GL VH Gln Val Gln Leu Gln Glu Ser Gly ProGly Leu Val Lys Pro Ser Glu Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ala Asp Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Pro Gly LysGly Leu Glu Trp Ile Gly Ser Leu TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Arg Gly Arg Val Thr Ile SerGly Asp Thr Ser Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 114 Antibody 11_GL HCDR1 Ala Asp Gly Tyr Tyr Trp Ser 115 Antibody 11_GL HCDR2 Ser Leu Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Arg Gly 116 Antibody 11_GL HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 117 Antibody 11_GL VL Asp Ile Gln Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Glu Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro AspAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 118 Antibody 11_GL LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 119 Antibody 11_GL LCDR2 Lys Ala Ser Thr Leu Glu Ser 120 Antibody 11_GL LCDR3 Gln Gln Ser His His Pro Pro Trp Thr 121 Antibody 12_GL (Camoteskimab) VH Gln Val Gln Leu Gln Glu Ser Gly ProGly Leu Val Lys Pro Ser Glu Thr LeuSer Leu Thr Cys Thr Val Ser Gly GlySer Ile Ser Ala Asp Gly Tyr Tyr TrpSer Trp Ile Arg Gln Pro Pro Gly LysGly Leu Glu Trp Ile Gly Ser Leu TyrTyr Ser Gly Ser Thr Tyr Tyr Asn ProSer Leu Lys Gly Arg Val Thr Ile SerGly Asp Thr Ser Lys Asn Gln Phe SerLeu Lys Leu Ser Ser Val Thr Ala AlaAsp Thr Ala Val Tyr Tyr Cys Ala ArgThr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val Trp Gly ArgGly Thr Leu Val Thr Val Ser Ser 122 Antibody 12_GL (Camoteskimab) HCDR1 Ala Asp Gly Tyr Tyr Trp Ser 123 Antibody 12_GL (Camoteskimab) HCDR2 Ser Leu Tyr Tyr Ser Gly Ser Thr TyrTyr Asn Pro Ser Leu Lys Gly 124 Antibody 12_GL (Camoteskimab) HCDR3 Thr Pro Ala Tyr Phe Gly Gln Asp ArgThr Asp Phe Phe Asp Val 125 Antibody 12_GL (Camoteskimab) VL Asp Ile Gln Met Thr Gln Ser Pro SerThr Leu Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysVal Leu Ile Tyr Lys Ala Ser Thr LeuGlu Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Glu Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro AspAsp Phe Ala Thr Tyr Tyr Cys Gln GlnSer His His Pro Pro Trp Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 126 Antibody 12_GL (Camoteskimab) LCDR1 Arg Ala Ser Gln Gly Ile Ser Ser TrpLeu Ala 127 Antibody 12_GL (Camoteskimab) LCDR2 Lys Ala Ser Thr Leu Glu Ser 128 Antibody 12_GL (Camoteskimab) LCDR3 Gln Gln Ser His His Pro Pro Trp Thr 129 HCDR1 Gly Tyr Tyr Phe His 130 HCDR2 Arg Ile Asp Pro Glu Asp Asp Ser ThrLys Tyr Ala Glu Arg Phe Lys Asp 131 HCDR3 Trp Arg Ile Tyr Arg Asp Ser Ser GlyArg Pro Phe Tyr Val Met Asp Ala 132 LCDR1 Leu Ala Ser Glu Asp Ile Tyr Thr TyrLeu Thr 133 LCDR2 Gly Ala Asn Lys Leu Gln Asp 134 LCDR3 Leu Gln Gly Ser Lys Phe Pro Leu Thr 135 Human IL-18 Met Ala Ala Glu Pro Val Glu Asp AsnCys Ile Asn Phe Val Ala Met Lys PheIle Asp Asn Thr Leu Tyr Phe Ile AlaGlu Asp Asp Glu Asn Leu Glu Ser AspTyr Phe Gly Lys Leu Glu Ser Lys LeuSer Val Ile Arg Asn Plhe Gln Gl Asp Le Asp G ArgPro Leu Phe Glu Asp Met Thr Asp SerAsp Cys Arg Asp Asn Ala Pro Arg ThrIle Phe Ile Ile Ser Met Tyr Lys AspSer Gln Pro Arg Gly Met Ala Val ThrIle Ser Val Lys Glu Lys Ile SerThr Leu Ser Cys Glu Asn Lys Pro Lys Ple Ile Ile Lys Asp Thr Lys Ser Asp IleIle Phe Phe Phe Gln Arg Ser Val ProGlyHis Asp Asn Lys Met Gln Phe GluSer Ser Ser Tyr Glu Gly Tyr Phe LeuAla Cys Glu Lys Glu Arg Asp Leu PheLys Leu Ile Leu Lys Gly Asp Gly Arg Lys Glu Asp ThrVal Gln Asn Glu Asp 136 Human Il-18 (PN) atggctgctg aaccagtaga agacaattgcatcaactttg tggcaatgaa atttattgac60aatacgcttt actttatagc tgaagatgatgaaaacctgg aatcagatta ctttggcaag120cttgaatcta aattatcagt cataagaaatttgaatgacc aagttctctt cattgaccaa180ggaaatcggc ctctatttga agatatgactgattctgact gtagagataa tgcaccccgg240accatattta ttataagtat gtataaagatagccagccta gaggtatggc tgtaactatc300tctgtgaagt gtgagaaaat ttcaactctctcctgtgaga acaaattat ttcctttaag360gaaatgaatc ctcctgataa catcaaggatacaaaaagtg acatcatatt ctttcagaga420agtgtcccag gacatgataa taagatgcaatttgaatctt catcatacga aggatacttt480ctagcttgtg aaaaagagag agacctttttaaactcattt tgaaaaaaga ggatgaattg540ggggatagat ctataatgtt cactgttcaaaacgaagact ag 582 137 H1 heavy chain Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Val Ser Gly Glu Ile Ser Thr Gly Tyr Tyr Phe His Trp Val Arg Gln Ala Pro Gly Lys Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Glu Asp Asp Ser Thr Lys Tyr Ala Glu Arg Phe Lys Asp Arg Val Thr Met Thr Glu Asp Thr Ser Thr Asp Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Thr Thr Trp Arg Ile Tyr Arg Asp Ser Ser Gly Arg Pro Phe Tyr Val Met Asp Ala Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro LysAsp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Pro Gly Lys 138 H1 heavy chain (PN) aggtgcagct ggtgcagagc ggagccgagg tgaagaagcc tggcgccagc gtcaaggtg 60 tcctgtaagg tgtccggcga gatcagcacc ggctactact tccactgggt gaggcaggcc 120 cctggcaagg gcctggagtg gatgggcaga atcgaccccg aggacgacag caccaagtac 180 gccgagcggt tcaaggacag ggtgaccatg accgaggaca ccagcaccga taccgcctac 240 atggagctgt ccagcctgag aagcgaggata ccgccgtgtactactgtaccacctggcgg 300 atctacagag acagcagcgg cagacccttc tacgtgatgg atgcctgggg ccagggcaca 360 ctagtgaccg tgtccagcgc cagcaccaag ggccccagcg tgttccccct ggcccccagc 420 agcaagagca ccagcggcgg cacagccgcc ctgggctgcc tggtgaagga ctacttcccc 480 gaaccggtga ccgtgtcctg gaacagcggagccctgacca gcggcgtgca caccttcccc 540 gccgtgctgc agagcagcg gcctgtacag cctgagcagc gtggtgaccg tgcccagcagc 600 agcctgggcac ccagacctca tcctgtaacg tgaaccaca agcccagcaa caccaaggtg 660 gacaagaagg tggagcccaa gagctgtgac aagacccaca cctgcccccc ctgccctgcc 720 cccgagctgc tgggaggccc cagcgtgttc ctgttccccc ccaagcctaa ggacaccctg 780 atgatcagc agaacccccg aggtgacctg tgtggtggtg gtggatgtga gccacgagga 840 cctgaggtga agttcaactg gtacgtggac ggcgtggagg tgcacaatgc caagaccaagccc 900 agggaggagc agtacaacag cacctaccgg gtggtgtccg tgctgaccgt gctgcaccag 960 gattggctga acggcaagga gtacaagtgta aggtgtccaa caaggccctg cctgcccct 1020 atcgagaaaa ccatcagcaa ggccaagggc cagcccagag agccccaggt gtacaccctg 1080 ccccccagca gagatgagct gaccaagaac caggtgtccc tgacctgcct ggtgaagggc 1140 ttctacccca gcgacatcgc cgtggagtgg gagagcaacg gccagcccga gaacaactac 1200 aagaccaccc cccctgtgct ggacagcgat ggca gcttcttc ctgtacagca agctgacc 1260 gtggacaaga gcagatggca gcagggcaac gtgttcagct gctccgtgat gcacgaggcc 1320 ctgcacaatc actacaccca gaagagcctgagcctgtccc ctggcaagtg a 1371 139 H1 variable region Gln Val Gln Leu Val Gln Ser Gly AlaGlu Val Lys Pro Gly Ala Ser ValLys Val Ser Cys Lys Val Ser Gly GluIle Ser Thr Gly Tyr Phe His TrpVal Arg Gln Ala Pro Gly Lys Gly LeuGlu Trp Asp Met Gly Arg Ile Asp Asp Pro Lys GluA Arg Val Thr Met Thr GluAsp Thr Ser Thr Asp Thr Ala Tyr MetGlu Leu Ser Ser Leu Arg Ser Glu AspThr Ala Val Tyr Cys Thr Thr TrpArg Ile Tyr Arg Asp Ser Gly ArgPro Phe Tyr Val Met Asp Ala Trp Le Gly Seru Val Thr Thr 140 H1 variable region (PN) caggtgcagc tggtgcagag cggagccgaggtgaagaagc ctggcgccag cgtcaggtg60tcctgtagg tgtccggcga gatcagcaccggctactact tccactggt gaggcaggcc120cctggcagg gcctggagtg gatgggaccgccgacgaat caccaagtac180gccgagcggt tcaggacag ggtgaccatgaccgaggaca ccagcaccga taccgcctac240atggagctgt ccagcctgag aagcgaggataccgccgt actactgtac cacctggcgatgg300atctacagggcgg accgaccg acccagcag ccagggcaca360ctagtgaccg tgtccagc378 141 L2 light chain Asp Ile Gln Met Thr Gln Ser Pro SerSer Val Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Leu Ala Ser GluAsp Ile Tyr Thr Tyr Leu Thr Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysLeu Leu Ile Tyr Gly Gly Ala PG SerG Serg Serg Pro Asp Leu Gly Ser Gly Thr Asp Tyr ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Cys Leu GlnGly Ser Lys Phe Pro Leu Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys ArgThr Val Ala Pro Ser Val Phe Sern Lys Glu AspPhe Val Val Cys LeuLeu Asn Asn Phe Tyr Pro Arg Glu AlaLys Val Gln Trp Lys Val Asp AlaLeu Gln Ser Gly Asn Ser Gln Glu SerVal Thr Glu Gln Asp Ser Lys Asp SerThr Tyr Ser Leu Ser Thr Leu ThrLeu Ser Glu Lys Glu Val Lys Val Tyr Ala Tyr HisGln Gly Leu Ser Ser Pro Val Thr LysSer Phe Asn Arg Gly Glu Cys 142 L2 light chain (PN) gatatccaga tgacccagtc ccccagcagcgtgtccgcct ctgtgggcga tagagtgacc60atcacctgcc tggccagcga ggacatctacacctacctga cctggtatca gcagaagcct120ggcaaggccc ctaagctgct gatctacggcgccaacaagc tgcaggacgg cgtgcccagc180agattcagcg gcagcggctc cggcaccgactacaccctga ccatcagcag cctgcagcct240gaggatttcg ccacctacta ctgcctgcagggcagcaagt tccccctgac cttcggccag300ggcaccaagc tggagatcaa gcgtacggtggccgccccca gcgtgttcat cttccccccc360agcgatgagc agctgaagag cggcaccgccagcgtggtgt gtctgctgaa caacttctac420ccccgggagg ccaaggtgca gtggaaggtggacaatgccc tgcagagcgg caacagccag480gagagcgtga ccgagcagga cagcaaggactccacctaca gcctgagcag caccctgacc540ctgagcaagg ccgactacga gaagcacaaggtgtacgcct gtgaggtgac ccaccagggc600ctgtccagcc ccgtgaccaa gagcttcaaccggggcgagt gc 642 143 L2 variable region Asp Ile Gln Met Thr Gln Ser Pro SerSer Val Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Leu Ala Ser GluAsp Ile Tyr Thr Tyr Leu Thr Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysLeu Leu Ile Tyr Gly Gly Ala PG SerG Serg Serg Pro Asp Leu Gly Ser Gly Thr Asp Tyr ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Leu GlnGly Ser Lys Phe Pro Leu Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 144 L2 variable region (PN) gatatccaga tgacccagtc cccagcagcgtgtccgcct ctgtgggcga tagtgacc60atcacctgcc tggccagcga ggacatctactacctacctga cctgtatca gcagaagcct120ggcaaggccc ctaagctca gatcaggacggcc t cgtgcccagc180agattcagcg gcagcggctc cggcaccgactacaccctga ccacccag cctgcagcct240gaggatttcg ccacctacta ctgcctgcaggcagcagt tccccctgac cttcggccagc30 t1ggagatcagcca 145 H2 heavy chain Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Val Ser Gly Glu Ile Ser Thr Gly Tyr Tyr Phe His Trp Val Arg Arg Arg Pro Gly Lys Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Glu Asp Asp Ser Thr Lys Tyr Ala Glu Arg Phe Lys Asp Arg Val Thr Met Thr Glu Asp Thr Ser Thr Asp Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Val Tyr Tyr Cys Thr Thr Trp Arg Ile Tyr Arg Asp Ser Ser Gly Arg Pro Phe Tyr Val Met Asp Ala Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro LysAsp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser His Glu Asp Pro Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gin Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Ala Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gin Pro Arg Glu Pro Gin Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gin Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gin Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gin Gin Gly Asn Val Phe Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gin Lys Ser Leu Ser Leu Ser Pro Gly Lys 146 H2 heavy chain (PN) caggtccagc tggtacagtc tggggctgaggtgaagaagc ctggggcctc agtgaaggtc 60 tcctgcaagg tttccggaga aataagtactggatactatt tccactgggt gcgacgaagg 120 cctggaaaag ggcttgagtg gatgggaaggattgatcctg aggatgatag tactaaatat 180 gctgagaggt tcaaagacag agtcaccatgaccgaggaca catctacaga cacagcctac 240 atggagctga gcagcctgag atctgaggacacggccgtgt attactgtac cacatggcgg 300 atataccgag atagttctgg ccgccccttctatgttatgg atgcctgggg ccaagggaca 360 ctagtcacag tctcctcagc ctccaccaagggcccatcgg tcttccccct ggcaccctcc 420 tccaagagca cctctggggg cacagcggccctgggctgcc tggtcaagga ctacttcccc 480 gaaccggtga cggtgtcgtg gaactcaggcgccctgacca gcggcgtgca caccttcccg 540 gctgtcctac agtcctcagg actctactccctcagcagcg tggtgaccgt gccctccagc 600 agcttgggca cccagaccta catctgcaacgtgaatcaca agcccagcaa caccaaggtg 660 gacaagaaag ttgagcccaa atcttgtgacaaaactcaca catgcccacc gtgcccagca 720 cctgaactcc tggggggacc gtcagtcttcctcttccccc caaaacccaa ggacaccctc 780 atgatctccc ggacccctga ggtcacatgcgtggtggtgg acgtgagcca cgaagaccct 840 gaggtcaagt tcaactggta cgtggacggcgtggaggtgc ataatgccaagacaaagccg 900 cgggaggagc agtacaacag cacgtaccgt gtggtcagcg tcctcaccgt cctgcaccag 960 gactggctga atggcaagga gtacaagtgc aaggtctcca acaaagccct cccagccccc 1020 atcgagaaaa ccatctccaa agccaaaggg cagccccgag aaccacaggt gtacaccctg 1080 ccccccatcc gggtgagctg accaagaacc aggtcagcc tgacctgcct ggtcaaaggc 1140 ttctatccca gcgacatcgc cgtggagtgg gagagcaatg ggcagccgga gaacaactac 1200 aagaccacgc ctcccgtgct ggactccgac ggctccttct tcctctacag caagctcacc 1260 gtggacaaga gcaggtggca gcaggggaac gtcttctcat gctccgtgat gcatgaggct 1320 ctgcacaacc actacacgca gaagagcctct ccctgtctcc gggtaaa 1368 147 H2 region variable Gln Val Gln Leu Val Gln Ser Gly AlaGlu Val Lys Pro Gly Ala Ser ValLys Val Ser Cys Lys Val Ser Gly GluIle Ser Thr Gly Tyr Phe His TrpVal Arg Arg Pro Gly Lys Gly LeuGlu Trp Asp Met Gly Arg Ile Asp Asp Pro Lys GluA Arg Val Thr Met Thr GluAsp Thr Ser Thr Asp Thr Ala Tyr MetGlu Leu Ser Ser Leu Arg Ser Glu AspThr Ala Val Tyr Cys Thr Thr TrpArg Ile Tyr Arg Asp Ser Gly ArgPro Phe Tyr Val Met Asp Ala Trp Le Gly Seru Val Thr Thr 148 H2 variable region (PN) caggtccagc tggtacagtc tggggctgaggtgaagaagc ctggggcctc agtgaaggtc60tcctgcaagg tttccggaga aaagtactggatactatt tccactggt gcgacgaagg120cctggagat ggcttgagtg gatggtggaggattg tactaaatat180gctgagaggt tcaagacag agtcaccatgaccgaggaca catctacaga cacagcctac240atggagctga gcagcctgag atctgaggacacgggtgt attactgtac cacatggcgg300atataccgag atagggttggttgg atccgatcctgg ccaagggaca360ctagtcacag tctcctca378 149 H3 heavy chain Gln Val Gln Leu Val Gln Ser Gly Ala Glu Val Lys Lys Pro Gly Ala Ser Val Lys Val Ser Cys Lys Val Ser Gly Glu Ile Ser Thr Gly Tyr Tyr Phe His Phe Val Arg Arg Arg Pro Gly Lys Gly Leu Glu Trp Met Gly Arg Ile Asp Pro Glu Asp Asp Ser Thr Lys Tyr Ala Glu Arg Phe Lys Asp Arg Val Thr Met Thr Ala Asp Thr Ser Thr Asp Thr Ala Tyr Met Glu Leu Ser Ser Leu Arg Ser Glu Asp Thr Ala Thr Tyr Phe Cys Thr Thr Trp Arg Ile Tyr Arg Asp Ser Ser Gly Arg Pro Phe Tyr Val Met Asp Ala Trp Gly Gln Gly Thr Leu Val Thr Val Ser Ser Ala Ser Thr Lys Gly Pro Ser Val Phe Pro Leu Ala Pro Ser Ser Lys Ser Thr Ser Gly Gly Thr Ala Ala Leu Gly Cys Leu Val Lys Asp Tyr Phe Pro Glu Pro Val Thr Val Ser Trp Asn Ser Gly Ala Leu Thr Ser Gly Val His Thr Phe Pro Ala Val Leu Gln Ser Ser Gly Leu Tyr Ser Leu Ser Ser Val Val Thr Val Pro Ser Ser Ser Leu Gly Thr Gln Thr Tyr Ile Cys Asn Val Asn His Lys Pro Ser Asn Thr Lys Val Asp Lys Lys Val Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly Gly Pro Ser Val Phe Leu Phe Pro Pro Lys Pro LysAsp Thr Leu MetIle Ser Arg Thr Pro Glu Val Thr CysVal Val Val Asp Val Ser His Glu AspPro Glu Val Lys Phe Asn Trp Tyr ValAsp Gly Val Glu Val His Asn Ala LysThr Lys Pro Arg Glu Glu Gln Tyr AsnSer Thr Tyr Arg Val Val Ser Val LeuThr Val Leu His Gln Asp Trp Leu AsnGly Lys Glu Tyr Lys Cys Lys Val SerAsn Lys Ala Leu Pro Ala Pro Ile GluLys Thr Ile Ser Lys Ala Lys Gly GlnPro Arg Glu Pro Gln Val Tyr Thr LeuPro Pro Ser Arg Asp Glu Leu Thr LysAsn Gln Val Ser Leu Thr Cys Leu ValLys Gly Phe Tyr Pro Ser Asp Ile AlaVal Glu Trp Glu Ser Asn Gly Gln ProGlu Asn Asn Tyr Lys Thr Thr Pro ProVal Leu Asp Ser Asp Gly Ser Phe PheLeu Tyr Ser Lys Leu Thr Val Asp LysSer Arg Trp Gln Gln Gly Asn Val PheSer Cys Ser Val Met His Glu Ala LeuHis Asn His Tyr Thr Gln Lys Ser LeuSer Leu Ser Pro Gly Lys 150 H3 heavy chain (PN) caggtccagc tggtacagtc tggggctgaggtgaagaagc ctggggcctc agtgaaggtc60tcctgcaagg tttccggaga aataagtactggatactatt tccactttgt gcgacgaagg120cctggaaaag ggcttgagtg gatgggaaggattgatcctg aggatgatag tactaatat180gctgagaggt tcaaagacag agtcaccatgaccgcagaca catctacaga cacagcctac240atggagctga gcagcctgag atctgaggacacggccactt atttttgtac cacatggcgg300atataccgag atagttctgg ccgccccttctatgttatgg atgcctgggg ccaagggaca360ctagtcacag tctcctcagc ctccaccaagggcccatcgg tcttccccct ggcaccctcc420tccaagagca cctctggggg cacagcggccctgggctgcc tggtcaagga ctacttcccc480gaaccggtga cggtgtcgtg gaactcaggcgccctgacca gcggcgtgca caccttcccg540gctgtcctac agtcctcagg actctactccctcagcagcg tggtgaccgt gccctccagc600agcttgggca cccagaccta catctgcaacgtgaatcaca agcccagcaa caccaaggtg660gacaagaaag ttgagcccaa atcttgtgacaaaactcaca catgcccacc gtgcccagca720cctgaactcc tggggggacc gtcagtcttcctcttccccc caaaacccaa ggacaccctc780atgatctccc ggacccctga ggtcacatgcgtggtggtgg acgtgagcca cgaagaccct840gaggtcaagt tcaactggta cgtggacggcgtggaggtgc ataatgccaagacaaagccg900cgggaggagc agtacaacag cacgtaccgtgtggtcagcg tcctcaccgt cctgcaccag960gactggctga atggcaagga gtacaagtgcaaggtctcca acaaagccct cccagccccc1020atcgagaaaa ccatctccaa agccaaagggcagccccgag aaccacaggt gtacaccctg1080cccccatccc gggatgagct gaccaagaaccaggtcagcc tgacctgcct ggtcaaaggc1140ttctatccca gcgacatcgc cgtggagtgggagagcaatg ggcagccgga gaacaactac1200aagaccacgc ctcccgtgct ggactccgacggctccttct tcctctacag caagctcacc1260gtggacaaga gcaggtggca gcaggggaacgtcttctcat gctccgtgat gcatgaggct1320ctgcacaacc actacacgca gaagagcctctccctgtctc cgggtaaa1368 151 H3 region variable Gln Val Gln Leu Val Gln Ser Gly AlaGlu Val Lys Lys Pro Gly Ala Ser ValLys Val Ser Cys Lys Val Ser Gly GluIle Ser Thr Gly Tyr Phe His PheVal Arg Arg Pro Gly Lys Gly LeuGlu Trp Met Gly Arg Ile Asp Asp Pro Lys GluA Arg Val Thr Met Thr AlaAsp Thr Ser Thr Asp Thr Ala Tyr MetGlu Leu Ser Ser Leu Arg Ser Glu AspThr Ala Thr Tyr Phe Cys Thr TrpArg Ile Tyr Arg Asp Ser Gly ArgPro Phe Tyr Val Met Asp Ala Trp LeGln Val Gly Thr 152 H3 variable region (PN) caggtccagc tggtacagtc tggggctgaggtgaagaagc ctggggccctc agtgaaggtc60tcctgcaagg tttccggaga ataagtactggatactatt tccacttgt gcgacgaagg120cctggagat ggcttgagtg gatggtgagaggattg tactaaatat180gctgagaggt tcaaagacag agtcaccatgaccgcagaca catctacaga cacagcctac240atggagctga gcagcctgag atctgaggacacggccactt atttgtac cacatggcgg300atataccgag atagttgttg atccgtggttcc ccaagggaca360ctagtcacag tctcctca378 153 L1 light chain Asp Ile Gln Met Thr Gln Ser Pro SerSer Val Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Leu Ala Ser GluAsp Ile Tyr Thr Tyr Leu Thr Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysLeu Leu Ile Tyr Gly Gly Ala PG SerG Serg Serg Pro Asp Leu Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Leu GlnGly Ser Lys Phe Pro Leu Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys ArgThr Val Ala Pro Ser Val Phe Sern Lys Gly Phe Ser Glu AspPhe Val Val Cys LeuLeu Asn Asn Phe Tyr Pro Arg Glu AlaLys Val Gln Trp Lys Val Asp AlaLeu Gln Ser Gly Asn Ser Gln Glu SerVal Thr Glu Gln Asp Ser Lys Asp SerThr Tyr Ser Leu Ser Thr Leu ThrLeu Ser Glu Lys Glu Val Lys Val Tyr Ala Tyr HisGln Gly Leu Ser Ser Pro Val Thr LysSer Phe Asn Arg Gly Glu Cys 154 L1 light chain (PN) gacatccaga tgacccagtc tccatcttctgtgtctgcat ctgtaggaga cagagtcacc60atcacttgtc tggcaagtga ggacatatacacttatttaa catggtatca gcagaaacca120gggaaagccc ctaagctcct gatctatggtgcaaataagt tgcaagatgg ggtcccatca180aggttcagcg gcagtggatc tgggacagatttcactctca ctatcagcag cctgcagcct240gaagattttg caacttacta ttgtctacagggttccaagt ttccgctcac gtttggccag300gggaccaagc tggagatcaa acgtacggtggctgcaccat ctgtcttcat cttcccgcca360tctgatgagc agttgaaatc tggaactgcctctgttgtgt gcctgctgaa taacttctat420cccagagagg ccaaagtaca gtggaaggtggacaacgccc tccaatcggg taactcccag480gagagtgtca cagagcagga cagcaaggacagcacctaca gcctcagcag caccctgacg540ctgagcaaag cagactacga gaaacacaaagtctacgcct gcgaagtcac ccatcagggc600ctgagctcgc ccgtcacaaa gagcttcaacaggggagagt gt 642 155 L1 variable region Asp Ile Gln Met Thr Gln Ser Pro SerSer Val Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Leu Ala Ser GluAsp Ile Tyr Thr Tyr Leu Thr Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysLeu Leu Ile Tyr Gly Gly Ala PG SerG Serg Serg Pro Asp Leu Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Leu GlnGly Ser Lys Phe Pro Leu Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 156 L1 variable region (PN) gabatccaga tgacccagtc tccatcttctgtgtctgcat ctgtaggaga cagagtcacc60atcacttgtc tggcaagtga ggacatatacacttta catggtatca gcagaaacca120gggaaagccc ctaagctcct gatctatggtgcaagatgt ggtcccatca180aggttcagcg gcagtggatc tgggacagatttcactca ctatcagcag cctgcagcct240gaagatttg caacttacta ttgtctacagggttccaagt ttccgctcac gttggccag300gggaccaagc31 tggagatcaa 157 L3 light chain Asp Ile Gln Met Thr Gln Ser Pro SerSer Val Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Leu Ala Ser GluAsp Ile Tyr Thr Tyr Leu Thr Trp TyrGln Gln Lys Pro Gly Lys Ala Pro GlnLeu Leu Ile Tyr Gly Ala Asn Lys LeuGln Asp Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Tyr ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Glu Gly Asp Tyr Tyr Cys Leu GlnGly Ser Lys Phe Pro Leu Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys ArgThr Val Ala Ala Pro Ser Val Phe IlePhe Pro Pro Ser Asp Glu Gln Leu LysSer Gly Thr Ala Ser Val Val Cys LeuLeu Asn Asn Phe Tyr Pro Arg Glu AlaLys Val Gln Trp Lys Val Asp Asn AlaLeu Gln Ser Gly Asn Ser Gln Glu SerVal Thr Glu Gln Asp Ser Lys Asp SerThr Tyr Ser Leu Ser Ser Thr Leu ThrLeu Ser Lys Ala Asp Tyr Glu Lys HisLys Val Tyr Ala Cys Glu Val Thr HisGln Gly Leu Ser Ser Pro Val Thr LysSer Phe Asn Arg Gly Glu Cys 158 L3 light chain (PN) gacatccaga tgacccagtc tccatcttctgtgtctgcat ctgtaggaga cagagtcacc60atcacttgtc tggcaagtga ggacatatacacttatttaa catggtatca gcagaaacca120gggaaagccc ctcaactcct gatctatggtgcaaataagt tgcaagatgg ggtcccatca180aggttcagcg gcagtggatc tgggacagattatactctca ctatcagcag cctgcagcct240gaagatgaag gggattacta ttgtctacagggttccaagt ttccgctcac gtttggccag300gggaccaagc tggagatcaa acgtacggtggctgcaccat ctgtcttcat cttcccgcca360tctgatgagc agttgaaatc tggaactgcctctgttgtgt gcctgctgaa taacttctat420cccagagagg ccaaagtaca gtggaaggtggacaacgccc tccaatcggg taactcccag480gagagtgtca cagagcagga cagcaaggacagcacctaca gcctcagcag caccctgacg540ctgagcaaag cagactacga gaaacacaaagtctacgcct gcgaagtcac ccatcagggc600ctgagctcgc ccgtcacaaa gagcttcaacaggggagagt gttag 645 159 L3 variable region Asp Ile Gln Met Thr Gln Ser Pro SerSer Val Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Leu Ala Ser GluAsp Ile Tyr Thr Tyr Leu Thr Trp TyrGln Gln Lys Pro Gly Lys Ala Pro GlnLeu Leu Ile Tyr Gly Ala Asn Lys LeuGln Asp Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Tyr ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Glu Gly Asp Tyr Tyr Cys Leu GlnGly Ser Lys Phe Pro Leu Thr Phe GlyGln Gly Thr Lys Leu Glu Ile Lys 160 L3 variable region (PN) gacatccaga tgacccagtc tccatcttctgtgtctgcat ctgtaggaga cagagtcacc60atcacttgtc tggcaagtga ggacatatacacttatttaa catggtatca gcagaaacca120gggaaagccc ctcaactcct gatctatggtgcaaataagt tgcaagatgg ggtcccatca180aggttcagcg gcagtggatc tgggacagattatactctca ctatcagcag cctgcagcct240gaagatgaag gggattacta ttgtctacagggttccaagt ttccgctcac gtttggccag300gggaccaagc tggagatcaa a321 161 2c10 rat-human IgG1 chimera Glu Val Gln Leu Gln Gln Ser Gly AlaGlu Leu Val Arg Pro Gly Thr Ser ValLys Leu Ser Cys Lys Val Ser Gly GluIle Ser Thr Gly Tyr Tyr Phe His PheVal Arg Arg Arg Pro Gly Gln Gly LeuGlu Trp Ile Gly Arg Ile Asp Pro GluAsp Asp Ser Thr Lys Tyr Ala Glu ArgPhe Lys Asp Arg Ala Thr Leu Thr AlaGln Thr Ser Ser Asn Thr Ala Tyr LeuAsn Leu Ser Ser Leu Thr Ser Glu AspThr Ala Thr Tyr Phe Cys Thr Thr TrpArg Ile Tyr Arg Asp Ser Ser Gly ArgPro Phe Tyr Val Met Asp Ala Trp GlyGln Gly Thr Leu Val Thr Val Ser SerAla Ser Thr Lys Gly Pro Ser Val PhePro Leu Ala Pro Ser Ser Lys Ser ThrSer Gly Gly Thr Ala Ala Leu Gly CysLeu Val Lys Asp Tyr Phe Pro Glu ProVal Thr Val Ser Trp Asn Ser Gly AlaLeu Thr Ser Gly Val His Thr Phe ProAla Val Leu Gln Ser Ser Gly Leu TyrSer Leu Ser Ser Val Val Thr Val ProSer Ser Ser Leu Gly Thr Gln Thr TyrIle Cys Asn Val Asn His Lys Pro SerAsn Thr Lys Val Asp Lys Lys Val GluPro Lys Ser Cys Asp Lys Thr His ThrCys Pro Pro Cys Pro Ala Pro Glu LeuLeu Gly Gly Pro Ser Val Phe Leu PhePro Pro Lys Pro LysAsp Thr Leu MetIle Ser Arg Thr Pro Glu Val Thr CysVal Val Val Asp Val Ser His Glu AspPro Glu Val Lys Phe Asn Trp Tyr ValAsp Gly Val Glu Val His Asn Ala LysThr Lys Pro Arg Glu Glu Gln Tyr AsnSer Thr Tyr Arg Val Val Ser Val LeuThr Val Leu His Gln Asp Trp Leu AsnGly Lys Glu Tyr Lys Cys Lys Val SerAsn Lys Ala Leu Pro Ala Pro Ile GluLys Thr Ile Ser Lys Ala Lys Gly GlnPro Arg Glu Pro Gln Val Tyr Thr LeuPro Pro Ser Arg Asp Glu Leu Thr LysAsn Gln Val Ser Leu Thr Cys Leu ValLys Gly Phe Tyr Pro Ser Asp Ile AlaVal Glu Trp Glu Ser Asn Gly Gln ProGlu Asn Asn Tyr Lys Thr Thr Pro ProVal Leu Asp Ser Asp Gly Ser Phe PheLeu Tyr Ser Lys Leu Thr Val Asp LysSer Arg Trp Gln Gln Gly Asn Val PheSer Cys Ser Val Met His Glu Ala LeuHis Asn His Tyr Thr Gln Lys Ser LeuSer Leu Ser Pro Gly Lys 162 2c10 rat-human IgG1 chimera (PN) gaggtccagc tacagcagtc tggggctgagcttgtgagac ctgggacctc tgtgaagtta60tcttgcaaag tttctggcga aataagtacaggatactatt tccactttgt gaggcgaagg120cctggacagg gtctggaatg gataggaaggattgatcctg aggatgatag tactaaatat180gctgagaggt tcaaagacag ggcgacgctcactgcacaaa catcctccaa cacagcctac240ctgaacctca gcagcctgac ctctgaggacactgcaactt atttttgtac cacatggcgg300atataccgag atagttctgg ccgccccttctatgttatgg atgcctgggg tcaaggaaca360ctagtcacag tctcctcagc ctccaccaagggcccatcgg tcttccccct ggcaccctcc420tccaagagca cctctggggg cacagcggccctgggctgcc tggtcaagga ctacttcccc480gaaccggtga cggtgtcgtg gaactcaggcgccctgacca gcggcgtgca caccttcccg540gctgtcctac agtcctcagg actctactccctcagcagcg tggtgaccgt gccctccagc600agcttgggca cccagaccta catctgcaacgtgaatcaca agcccagcaa caccaaggtg660gacaagaaag ttgagcccaa atcttgtgacaaaactcaca catgcccacc gtgcccagca720cctgaactcc tggggggacc gtcagtcttcctcttccccc caaaacccaa ggacaccctc780atgatctccc ggacccctga ggtcacatgcgtggtggtgg acgtgagcca cgaagaccct840gaggtcaagt tcaactggta cgtggacggcgtggaggtgc ataatgccaagacaaagccg900cgggaggagc agtacaacag cacgtaccgtgtggtcagcg tcctcaccgt cctgcaccag960gactggctga atggcaagga gtacaagtgcaaggtctcca acaaagccct cccagccccc1020atcgagaaaa ccatctccaa agccaaagggcagccccgag aaccacaggt gtacaccctg1080cccccatccc gggatgagct gaccaagaaccaggtcagcc tgacctgcct ggtcaaaggc1140ttctatccca gcgacatcgc cgtggagtgggagagcaatg ggcagccgga gaacaactac1200aagaccacgc ctcccgtgct ggactccgacggctccttct tcctctacag caagctcacc1260gtggacaaga gcaggtggca gcaggggaacgtcttctcat gctccgtgat gcatgaggct1320ctgcacaacc actacacgca gaagagcctctccctgtctc cgggtaaa1368 163 2c10 rat-human Ckappa chimera Asp Ile Gln Met Thr Gln Ser Pro AlaSer Leu Ser Ala Ser Leu Glu ThrVal Ser Ile Glu Cys Leu Ala Ser GluAsp Ile Tyr Thr Tyr Leu Thr Trp TyrGln Gln Lys Pro Gly Lys Ser Pro GlnLeu Leu Ile Tyr Leu Serly Ar Le Gly Gly Ala PG ValG Asn Ser Gly Ser Gly Thr Gln Tyr SerLeu Lys Ile Ser Gly Ile Gln Pro GluAsp Glu Gly Asp Tyr Phe Cys Leu GlnGly Ser Lys Phe Pro Leu Thr Phe GlySer Gly Thr Lys Leu Glu Ile Lys Le ArgThr Val Ala Ala Pro Gly Ser Glu Ser Lys Phe Pro Ser Ile Ala Ser Val Val Cys LeuLeu Asn Asn Phe Tyr Pro Arg Glu AlaLys Val Gln Trp Lys Val Asp Asn AlaLeu Gln Ser Gly Asn Ser Gln Glu SerVal Thr Gln Asp Ser Lys Asp SerThr Tyr Ser Leu Ser Thr Leu ThrLeu Ser GLys Tyr Lys Tyr Lys Val Asp HisGln Gly Leu Ser Ser Pro Val Thr LysSer Phe Asn Arg Gly Glu Cys 164 2c10 rat-human Ckappa chimera (PN) gacattcaaa tgacccagtc tccagcttccctgtctgcat ctctgggaga aactgtctcc60atcgaatgtc tggcaagtga ggacatatacacttatttaa catggtatca gcagaaacca120gggaaatctc ctcaactcct gatctatggtgcaaataagt tgcaagatgg ggtcccatca180cggttcagtg gcagtggatc tggcacacagtattctctca agatcagcgg catacaacct240gaagatgaag gggattattt ctgtctacagggttccaagt ttccgctcac gttcggttct300gggaccaagc tggagatcaa acgtacggtggctgcaccat ctgtcttcat cttcccgcca360tctgatgagc agttgaaatc tggaactgcctctgttgtgt gcctgctgaa taacttctat420cccagagagg ccaaagtaca gtggaaggtggacaacgccc tccaatcggg taactcccag480gagagtgtca cagagcagga cagcaaggacagcacctaca gcctcagcag caccctgacg540ctgagcaaag cagactacga gaaacacaaagtctacgcct gcgaagtcac ccatcagggc600ctgagctcgc ccgtcacaaa gagcttcaacaggggagagt gt 642 165 Heavy chain acceptor framework Gln Val Gln Leu Val Gln Ser Gly AlaGlu Val Lys Lys Pro Gly Ala Ser ValLys Val Ser Cys Lys Val Ser Gly TyrThr Leu Thr Glu Leu Ser Met His TrpVal Arg Gln Ala Pro Gly Lys Gly LeuGlu Trp Met Gly Gly Phe Asp Pro GluAsp Gly Glu Thr Ile Tyr Ala Gln LysPhe Gln Gly Arg Val Thr Met Thr GluAsp Thr Ser Thr Asp Thr Ala Tyr MetGlu Leu Ser Ser Leu Arg Ser Glu AspThr Ala Val Tyr Tyr Cys Ala Thr 166 Light chain acceptor framework Asp Ile Gln Met Thr Gln Ser Pro SerSer Val Ser Ala Ser Val Gly Asp ArgVal Thr Ile Thr Cys Arg Ala Ser GlnGly Ile Ser Ser Trp Leu Ala Trp TyrGln Gln Lys Pro Gly Lys Ala Pro LysLeu Leu Ile Tyr Ala Ala Ser Ser LeuGln Ser Gly Val Pro Ser Arg Phe SerGly Ser Gly Ser Gly Thr Asp Phe ThrLeu Thr Ile Ser Ser Leu Gln Pro GluAsp Phe Ala Thr Tyr Tyr Cys Gln GlnAla Asn Ser Phe Pro 167 JH6 amino acid sequence added to SEQID NO: 37 Trp Gly Gln Gly Thr Leu Val Thr ValSer Ser 168 Jkappa 2 amino acid sequence addedto SEQ ID NO: 38 Phe Gly Gln Gly Thr Lys Leu Glu IleLys

Claims

1. A camotezinib or its antigen-binding fragment for use in treating, preventing, or improving atopic dermatitis (AD) in subjects, characterized in that: in, The said carmotskiy monoclonal antibody or its antigen-binding fragment is administered subcutaneously at a dose of 0.1 mg / kg to 4 mg / kg.

2. The kamotskiy monoclonal antibody or its antigen-binding fragment according to claim 1, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment contains the following six CDRs: (a) A heavy chain CDR having the amino acid sequence of SEQ ID NO:122; (b) A heavy chain CDR having the amino acid sequence of SEQ ID NO:123; (c) Heavy chain CDR having the amino acid sequence of SEQ ID NO:124; (d) A light chain CDR having the amino acid sequence of SEQ ID NO:126; (e) A light chain CDR having the amino acid sequence of SEQ ID NO:127; and (f) Light chain CDR having the amino acid sequence of SEQ ID NO:

128.

3. The kamotskiy monoclonal antibody or its antigen-binding fragment according to claim 2, characterized in that: in, Anti-IL-18 antibodies or their antigen-binding fragments contain camotezin monoclonal antibody CDRs with amino acid residue substitutions: (a) HCDR1, having the same amino acid sequence as SEQ ID NO:122, or having 1, 2 or 3 amino acid residues substituted relative to the amino acid sequence of SEQ ID NO:122; (b) HCDR2, having the same amino acid sequence as SEQ ID NO:123, or having 1, 2, 3 or 4 amino acid residues substituted relative to the amino acid sequence of SEQ ID NO:123; (c) HCDR3, having the same amino acid sequence as SEQ ID NO:124, or having 1, 2, 3, 4 or 5 amino acid residues substituted relative to the amino acid sequence of SEQ ID NO:124; (d) LCDR1, having the same amino acid sequence as SEQ ID NO:126, or having 1, 2, 3 or 4 amino acid residues substituted relative to the amino acid sequence of SEQ ID NO:126; (e) LCDR2, having the same amino acid sequence as SEQ ID NO:127, or containing 1, 2, 3, or 4 amino acid residues substituted relative to the amino acid sequence of SEQ ID NO:127; and (f) LCDR3, having the same amino acid sequence as SEQ ID NO:128, or having substituted 1, 2, 3, 4, 5, 6, 7, 8 or 9 amino acid residues relative to the amino acid sequence of SEQ ID NO:

128.

4. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetramacium or its antigen-binding fragment was administered subcutaneously at the following doses: (i) 0.1 mg / kg to 3.9 mg / kg, 0.1 mg / kg to 3.8 mg / kg, 0.1 mg / kg to 3.5 mg / kg, or 0.1 mg / kg to 3 mg / kg; or (ii) about 3 mg / kg, about 3.25 mg / kg, about 3.5 mg / kg or about 3.75 mg / kg.

5. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment is administered subcutaneously at the following doses: 0.15 mg / kg to 3.2 mg / kg, 0.15 mg / kg to 3.2 mg / kg, or 0.15 mg / kg to 3 mg / kg.

6. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment is administered subcutaneously at the following doses: 0.2 mg / kg to 2.7 mg / kg, 0.2 mg / kg to 2.5 mg / kg, or 0.25 mg / kg to 2.5 mg / kg.

7. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment is administered subcutaneously at the following doses: about 0.1 mg / kg, about 0.2 mg / kg, about 0.25 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, or about 0.75 mg / kg.

8. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The kamotskiy monoclonal antibody or its antigen-binding fragment is administered subcutaneously at a dose of approximately 0.4 mg / kg.

9. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetzumab or its antigen-binding fragment is administered subcutaneously at a dose of approximately 0.25 mg / kg.

10. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment is administered subcutaneously at the following doses: about 1 mg / kg, about 1.25 mg / kg, about 1.4 mg / kg, about 1.5 mg / kg, or about 1.75 mg / kg.

11. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetramacium or its antigen-binding fragment is administered subcutaneously at a dose of approximately 1 mg / kg.

12. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment was administered subcutaneously at a dose of approximately 1.4 mg / kg.

13. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment is administered subcutaneously at the following doses: approximately 2 mg / kg, approximately 2.25 mg / kg, approximately 2.5 mg / kg, or approximately 2.75 mg / kg.

14. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetzii monoclonal antibody or its antigen-binding fragment was administered subcutaneously at a dose of approximately 2 mg / kg.

15. A camotezinib or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment is administered subcutaneously at the following doses: approximately 3 mg / kg, approximately 3.25 mg / kg, approximately 3.5 mg / kg, approximately 3.75 mg / kg, or approximately 4 mg / kg.

16. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetzumab or its antigen-binding fragment was administered subcutaneously at a dose of approximately 4 mg / kg.

17. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotetskiy monoclonal antibody or its antigen-binding fragment was administered for at least 16 weeks.

18. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The administration frequency of the said carmotskiy monoclonal antibody or its antigen-binding fragment is once a week, once every two weeks, once every three weeks, once every four weeks, once every five weeks, once every six weeks, once every eight weeks, once every nine weeks, once every ten weeks, once every eleven weeks, or once every twelve weeks.

19. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The carmotskiy monoclonal antibody or its antigen-binding fragment is administered once every four weeks.

20. A camotezinib or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The kamotezinib or its antigen-binding fragment is administered once every twelve weeks.

21. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to any one of the preceding claims, characterized in that: in, The camotezinib or its antigen-binding fragment specifically binds to free IL-18, but not to IL-18 bound to its corresponding receptor or IL-18-binding protein (IL-18bp).

22. A camotezinumab or its antigen-binding fragment for use in treating, preventing or improving atopic dermatitis (AD) in a subject, characterized in that: in, The camotetzumab or its antigen-binding fragment is administered subcutaneously at doses ranging from 0.1 mg / kg to 4 mg / kg, wherein the camotetzumab competitively binds to IL-18 with any antibody molecule that meets the following criteria: (i) capable of binding to IL-18; and (ii) Includes antibody molecules, VH domains and / or VL domains, CDRs and / or CDR groups listed in Table 1, wherein the CDR is, for example, HCDR3.

23. The kamotskiy monoclonal antibody or its antigen-binding fragment for the use according to claim 22, characterized in that: in, The camotetrazine or its antigen-binding fragment is as described in any one of claims 2-21.

Citation Information

Patent Citations

  • Betacellulin protein-containing preparations

    EP1125584A1

  • Monoclonal antibody and the method of using the antibody

    US6706487B1

  • Humanised anti-interleukin-18 antibody

    US8133978B2

  • Antibodies that bind human interleukin-18 and methods of making and using

    WO2001058956A2

  • Anti-il-18 antibodies and their uses

    WO2012085015A1