Compositions, methods and uses

By blocking type I interferon signaling, particularly inhibiting the interaction between type I interferon and its receptor, the effectiveness and persistence of rheumatoid arthritis-related pain have been addressed, providing a specific and long-term pain relief strategy.

CN121586729APending Publication Date: 2026-02-274E THERAPEUTICS INC
View PDF 101 Cites 0 Cited by

Patent Information

Application Number
CN202480042324.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2024-02-13
Filing Date
2024-05-01
Publication Date
2026-02-27

AI Technical Summary

Technical Problem

Existing treatments for rheumatoid arthritis-related pain often fail to provide an effective and long-term solution, especially for patients with inadequate inflammatory disease control or those who continue to experience pain despite successful treatment, due to a lack of specific and effective analgesic strategies.

Method used

Pain associated with rheumatoid arthritis can be reversed by blocking type I interferon signaling, particularly by inhibiting the interaction between type I interferon and its receptor or by blocking signaling downstream of the type I interferon receptor.

Benefits of technology

Effectively stopping and reversing pain associated with rheumatoid arthritis without affecting inflammatory disease activity provides a novel and advantageous approach to pain treatment or prevention.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present disclosure relates to type I interferon inhibitors for treating or preventing pain associated with rheumatoid arthritis (RA) in a patient, related uses and kits, and methods for identifying patients having such pain and in need of treatment with such inhibitors.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Related applications

[0002] This application claims priority and interest in UK application No. 2306456.1, filed on 2 May 2023, and UK application No. 2401979.6, filed on 13 February 2024, the entire contents of each of which are incorporated herein by reference. Technical Field

[0003] This invention relates to type I interferon inhibitors for the treatment or prevention of pain associated with rheumatoid arthritis (RA) in patients, related uses and kits, and methods for identifying patients with such pain who require treatment with such inhibitors. Background Technology

[0004] Rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by chronic inflammation and progressive degeneration of the joints, leading to severe pain and stiffness. It is estimated that approximately 1% of the global population suffers from RA. The pain associated with RA can cause extreme debilitating symptoms and significantly impacts the quality of life for affected patients.

[0005] The breakdown of T-cell and / or B-cell tolerance initiates the complex process of RA. This leads to the activation and subsequent production of a suite of antibodies that recognize autoproteins, including disease-specific IgG autoantibodies against modified IgG (rheumatoid factor), citrullinated or carbamylated proteins, and collagen type II. Circulating autoantibodies activate both the innate and adaptive immune systems, accompanied by the production of a range of inflammatory factors, including cytokines. Cytokines can be classified as circulating pro-inflammatory cytokines and / or inflammatory cytokines in the joints, but anti-inflammatory cytokines and natural cytokine antagonists are also involved.

[0006] Rabies (RA) involves elevated levels of different classes of cytokines, accompanied by dynamic changes throughout the disease process, where different combinations of cytokines exhibit hierarchical dominance. Examples of systemic cytokines that have been associated with RA include increased levels of pro-inflammatory cytokines such as interleukin (IL)-1, IL-32, IL-33, IL-36, tumor necrosis factor (TNF)-α, as well as increased levels of IL-1, TNF-α, IL-6, IL-15, IL-16, IL-17, IL-18, granulocyte-macrophage colony-stimulating factor (GM-CSF), and various types of interferon (IFN) in the joints. Some anti-inflammatory cytokines associated with RA include IL-10, IL-4, IL-13, IL-20, IL-27, IL-35, IL-37, IL-38, as well as natural cytokine antagonists targeting the IL-1 receptor, soluble forms of IL-1 and TNF receptors, IL-18 binding protein, etc. (Alunno et al., 2017; Selim et al., 2017; Ridgley et al., 2018).

[0007] Pain is the most troubling symptom of rheumatoid arthritis (RA), and its etiology remains unclear. People with RA experience pain during rest and normal activity and may exhibit increased sensitivity to pain induced by stimuli such as normal movement or mild pressure on a joint. In addition, generalized pain and other evidence of central sensitization are common and contribute to pain in people with RA (Heisler et al., 2020).

[0008] Pain associated with rheumatoid arthritis (RA) is considered complex and its etiology is multifactorial, including alterations in immune cells and changes in several areas of the nervous system, such as primary afferent nerve sensitization, spinal cord sensitization, and changes at the supra-spinal level. Peripheral nerve dysfunction, including increased excitability and ectopic activity of afferent nerves, is thought to contribute to the pain. Such sensitization may be triggered by pro-inflammatory factors present systemically and / or in the synovial fluid of RA, including TNF, IL-1, IL-6, IL-17, interferon and other cytokines, inflammatory lipids (e.g., PGE2), neuropeptides (CGRP, SP, etc.), and growth factors (e.g., NGF) (Cao et al., 2020).

[0009] Disease-modifying antirheumatic drugs (DMARDs) are effective in relieving inflammatory conditions, but in many cases, pain persists even in the absence of inflammation (Vergne-Salle et al., 2020). DMARDs can reduce severe pain associated with high disease activity, but complete pain relief is rare in practice. It is estimated that approximately 10% to 25% of patients who receive DMARD treatment and successfully reduce inflammation still experience chronic pain.

[0010] Therefore, RA patients often seek to use analgesics to treat the pain symptoms of RA; however, the currently available analgesic compounds prescribed to people with RA do not provide an effective and / or long-term solution for preventing or treating RA-related pain.

[0011] Therefore, persistent pain associated with RA remains a real problem.

[0012] For many RA patients, finding satisfactory pain relief is a primary task. This lack of adequate pain relief in RA patients underscores the urgent need for new analgesic strategies. In particular, new strategies are needed to alleviate pain between cycles of DMARD onset for patients with inadequate inflammatory disease control and those experiencing persistent pain despite successful treatment. Identifying the specific cellular types and molecular mechanisms of pain associated with RA will contribute to the development of more specific and effective analgesics. Summary of the Invention

[0013] Against this backdrop, the inventors unexpectedly discovered that pain associated with RA is heavily dependent on a specific type of peripheral nociceptor that becomes sensitive via type I interferon signaling. The inventors also surprisingly found that sensitization and pain exacerbation can be reversed by blocking a specific type of cytokine signaling: type I interferon signaling. Consistently, inhibiting the interaction between type I interferon and its receptor, or blocking signaling downstream of the type I interferon receptor, can both prevent and completely reverse pain associated with RA. Notably and surprisingly, blocking type I interferon signaling did not strongly affect inflammatory disease activity, suggesting that pain is mechanistically an independent process from inflammation. The inventors also demonstrated that the characteristics of type I interferon signaling present in RA patients indicate that type I interferons are key cytokines in causing pain.

[0014] Therefore, in one aspect, the present invention provides a type I interferon inhibitor for treating or preventing pain associated with rheumatoid arthritis in patients.

[0015] In a related aspect, the present invention provides the use of type I interferon inhibitors in the preparation of medicaments for the treatment or prevention of pain associated with rheumatoid arthritis in patients.

[0016] In another related aspect, the present invention provides a method for treating or preventing pain associated with rheumatoid arthritis in a patient, the method comprising the step of administering a type I interferon inhibitor to the patient.

[0017] Therefore, this invention provides a novel and advantageous method for treating or preventing pain associated with RA in patients. As further discussed herein, the inventors have unexpectedly discovered that pain can be treated or prevented by specifically targeting the type I interferon pathway. Attached Figure Description

[0018] Preferred, non-limiting examples embodying certain aspects of the invention will now be described with reference to the following accompanying drawings:

[0019] Figure 1, including Figures 1A to 1I : Perturbation of primary sensory neuron types in antibody-induced arthritis.

[0020] Figure 1A A mouse model of arthritis induced by cartilage antibody (Cab).

[0021] Figure 1B From day 6 to day 23 after injection of cab in C57BL / 6 N mice, arthritic mice exhibited transient joint inflammation (clinical score).

[0022] Figure 1C Mechanically induced pain appeared as early as 4 hours after Cab injection and persisted until day 63 (n=6).

[0023] Figure 1D Illustration of DRG neuronal populations driven by different Cre and CreERT2 mouse strains. Percentage of reflex responses to blue light stimulation in these mouse strains (crossed with R26-ChR2) at different stages of RA.

[0024] Figure 1E: Unified manifold approximation and projection (UMAP) shows the distribution of cell clusters (86,052 cells) from scRNA-seq of DRGs from control mice and RA mice. NonmyelSC, unmyelinated Schwann cells; MyelSC, myelinated Schwann cells; VSMC, vascular smooth muscle cells; EC, endothelial cells.

[0025] Figure 1F: Heatmap showing the predicted similarity score of a single neuron to neuron type using a machine learning classifier, according to the annotations of Usoskin et al. (2015).

[0026] Figure 1G: UMAP of neuronal clusters (6,200 cells) from DRG scRNA-seq of control mice and RA mice.

[0027] Figure 1H: Mean of the maximum prediction score for predictive neurons within each cluster.

[0028] Figure 1I : Perturbations of neuronal types in arthritis at different disease stages.

[0029] Figure 2, including Figures 2A to 2J: IFN signaling in sensory neurons during arthritis.

[0030] Figure 2A: Average scores of co-regulatory gene modules induced by arthritis in DRG neurons at different time points.

[0031] Figure 2B: Heatmap of average expression of arthritis-induced modules in DRG neurons at different time points in RA.

[0032] Figure 2C Dot plot of GO biological pathway analysis for module genes.

[0033] Figure 2D Visualization of the STRING network of the co-regulation module.

[0034] Figure 2E Box plots of gene module scores for individual neuronal clusters at different time points in arthritis.

[0035] Figure 2F Heatmap of the activity of four recurring SCENIC regulators in single neuron types during arthritis.

[0036] Figure 2G: Serum IFNa levels at different time points in arthritis.

[0037] Figure 2H: The pain-like behavior test of von Frey wire (threshold) and 2g von Frey wire (number of claw swings) showed that the Endo-bN-acetylglucosidase (EndoS)-treated Cab antibody failed to induce pain.

[0038] Figure 2I: Box plots show the scores of co-regulated gene modules in neurons from control mice, EndoS-treated mice, and IFNAR1 antibody-blocked mice.

[0039] Figure 2J Heatmap of expression of top differentially regulated genes at 0.25 days in DRG neurons of arthritis (left) and in mice treated with EndoS in cab or blocked by IFNAR1 antibody (right).

[0040] Figure 3, including Figures 3A to 3G Multimodal C nociceptors are involved in pain associated with arthritis.

[0041] Figure 3ACutaneous nerve recordings. Representative C-fiber recordings (CV < 1.2 m / s) showing activity in mice injected with saline (“C-control”, middle panel) or Cab (“C-RA”, right panel) during a force ramp (10 seconds; 0–100 mN). Insets show the waveforms of all action potentials induced during mechanical stimulation. This force ramp protocol was used to determine the mechanical threshold of each fiber.

[0042] Figure 3B: Mechanical thresholds in mice injected with saline (“Control”) or Cab (“RA”). Dots represent individual values ​​for each fiber, and lines represent the mean and SD [unpaired t-test (*p < 0.05)].

[0043] Figure 3C: Frequency of mechanically induced firing during force-slope application in mice injected with saline (“Control”) or Cab (“RA”). The thick line represents the mean number of action potentials in a 1-second time period, and the shaded area represents the SEM. (Two-way ANOVA of repeated measures treatment effect, p < 0.01; compared with controls by unpaired t-test, *p < 0.05, †p < 0.005).

[0044] Figure 3D: Number of mechanically induced action potentials during the applied slope [unpaired t-test (*p < 0.05)].

[0045] Figure 3E Gfra3-Cre ERT2 *R26-ChR2 (Gfra3-CHR2) mice (n=8) mechanical retraction threshold (von Fraser test) in the absence of light or under subthreshold blue light (470 nm), response to 2 g von Fraser and acetone test (number of claw flicks).

[0046] Figure 3F Gfra3-Cre ERT2 *R26-ArchT (Gfra3-ArchT) mice were exposed to yellow light (566 m) (0.44 mWatt / mm²). 2 Mechanical sensitivity and cold sensitivity before and after 45 minutes (n=8).

[0047] Figure 3G : Without applying yellow light or with applying yellow light (0.44 mWatt / mm) 2 Percentage of von Fritz reflex responses at different times (45 minutes): before antibody injection (baseline) and after antibody injection (early and late RA) (n=8). *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05.

[0048] Figure 4, including Figures 4A to 4F : Continuous interferon signaling drives pain associated with arthritis.

[0049] Figure 4A Perturbation of non-neuronal DRG cells in different stages of arthritis.

[0050] Figure 4B KEGG pathway of differentially expressed genes in endothelial macrophages.

[0051] Figure 4C Quantitative PCR of INFa and IFNb expression in DRG.

[0052] Figure 4D: Reversal of arthritis-induced pain by TYK2 inhibitor treatment. Five oral doses of TYK2 inhibitor (15 mg / kg, twice daily, days 13–21) blocked cab-induced mechanosensitive hypersensitivity, while treatment with the mediator (EtOH:TPGs:PEG300=5:5:90) was ineffective (n=5–6).

[0053] Figure 4E: Compared with the isotype group (mouse IgG), systemic administration of IFNAR1 mAb (1 mg, intraperitoneal injection) had no effect on joint inflammation.

[0054] Figure 4F IFNAR1 mAb administered one hour prior to Cab injection prevented mechanically induced pain and reversed established pain associated with arthritis on days 22 and 45 (n=5). *** indicates p < 0.001, ** indicates p < 0.01, and * indicates p < 0.05.

[0055] Figure 5 Phosphorylation status of STAT1 (S-727), MNK1 (T-197 / 202), and eIF4E (S-209) in the dorsal root ganglion. Phosphorylation of STAT1, MNK1, and eIF4E was elevated in mice with cartilage antibody-induced arthritis. Numbers refer to different animals. Cont, control mice; RA-d33, samples from animals 33 days after induced arthritis; RA-d33 anti-IFNR animals neutralizing IFNAR1 (interferon α / β receptor subunit 1) on day 33 after induced arthritis. 2 hours, 12 hours, and 33 hours refer to the time after induced arthritis.

[0056] Figure 6, including Figures 6A to 6B Mechanical and cold hypersensitivity in mice with cartilage antibody-induced arthritis.

[0057] Figure 6AC57BL / 6N mice began to exhibit mechanically induced pain 4 hours after antibody injection, which persisted until day 63. Using the von Frey up-and-down test, the claw withdrawal threshold was significantly reduced at 4 hours, day 12, day 30, and day 63 compared to control mice (n=6). Increased claw flicking frequency was observed in both the acetone test and the 2 g von Freys test at both early and late stages. No difference was detected between the Cab group and the control group in terms of latency in the Hargreaves test or needle prick test.

[0058] Figure 6B Mouse strains were characterized using immunohistochemistry by comparing reporter genes and neuronal cluster markers. NF200, neurofilament 200; CGRP, calcitonin gene-related peptide; IB4, isolectin B4; TH, tyrosine hydroxylase. Scale bar = 100 μm, while the scale bar for insets is 20 μm.

[0059] Figure 7, including Figures 7A to 7E Single-cell RNA sequencing of DRGs in mice injected with antibodies.

[0060] Figure 7A A diagram illustrating the sampling and workflow of scRNA-seq for cells in the DRG of antibody-induced arthritis mice.

[0061] Figure 7B The violin plot represents the sample parameters after initial quality control of scRNA-seq data.

[0062] Figure 7C The dot plot represents the top 3 marker genes used for sequenced cells of each major cell type in DRG.

[0063] Figure 7D The dot plot represents the first 3 marker genes used for each neuronal cluster in DRG neurons.

[0064] Figure 7E UMAP represents the same distribution of DRG neuron clusters as that used in a randomly sampled (25%) dataset, where cells from control and RA samples are mixed together.

[0065] Figure 8, including Figures 8A to 8K : Sc-RNA seq dataset of neurons and immune cells in RA's DRG.

[0066] Figure 8A UMAP represents the distribution of cell clusters (86,052 cells) from different time points in the RA sample and the control DRG sample.

[0067] Figure 8B Stacked bar chart of cell type composition (percentage) at different stages of RA.

[0068] Figure 8C UMAP of the distribution of immune cell subclusters.

[0069] Figure 8D Stacked bar chart of immune cell composition (percentage) at different stages of RA.

[0070] Figure 8E: CCL2 (MCP-1) and CCL4 (MIP-1β) in serum from arthritic animals.

[0071] Figure 8F: Feature map showing Ccl2 and Ccl4 expression in control and RA 12-hour single-cell datasets (9500 cells each).

[0072] Figure 8G Stacked bar chart showing the percentage of neuronal types at different stages of arthritis.

[0073] Figure 8H Heatmaps of regulator activity at different DRG neuron types and time points, analyzed using SCENIC.

[0074] Figure 8I: UMAP of the distribution of sequenced cells from control DRG sample, EndoS-treated Cab antibody arthritis sample, and IFNAR1 antibody-treated Cab antibody arthritis sample.

[0075] Figure 8J: UMAP of the distribution of cell clusters from DRG samples in (I).

[0076] Figure 8K : Composition (percentage) of immune cell subclusters in stacked bar chart identifier (J).

[0077] Figure 9 Gene expression of cytokine receptors in DRG neuronal types. In the top figure, the dot plot represents the gene expression of receptors for cytokines (TNF-α receptor, CCR, CXCR, CSF receptor, interleukin receptor, Fc-γ receptor, and type I interferon receptors IFNAR1 and IFNAR2) for each neuronal cluster in DRG neurons; in the bottom figure, the dot plot represents the gene expression of cytokine receptors in the PEP1 cluster at different time points in arthritis.

[0078] Figure 10, including Figures 10A to 10D TrkA-positive populations of sensory neurons contribute to pain associated with arthritis.

[0079] Figure 10ARepresentative C-fiber recordings of mice injected with saline (“C-control”; top) or Cab (“C-RA group”; bottom) during static application. The inset shows all action potential waveforms induced during mechanical stimulation.

[0080] Figure 10B Mean number of mechanically induced action potentials during static indentation (two-way ANOVA of repeated measures treatment effect, p = 0.05; compared with controls by unpaired t-test, *p < 0.05).

[0081] Figure 10C In Wnt1-Cre*R26-ChR2 (Wnt1-CHR2) mice, under blue light stimulation, normal mice exhibited a decreased paw withdrawal threshold in the von Frey up-and-down test and an increased number of paw flicks in the 2 g von Freys and acetone test (reflection subthreshold: 12.7 x 10⁻⁶). -3 mWatt / mm 2 Subthreshold response: 18.5 x 10 -3 mWatt / mm 2 The combination of blue LEDs (reflection subthreshold: 11.7x10) -3 mWatt / mm 2 Subthreshold response: 14.5 mWatt / mm 2 This further enhanced the hypersensitivity to mechanical and cold stimuli in mice with early and late RA (n=6-7). In Mrgprd-Cre*R26-ChR2 (MrgprD-CHR2) mice, a decreased paw withdrawal threshold was only observed in normal mice when combined with subthreshold blue light for the von Frey test; no difference was detected between the dark and light-exposed groups. In TrkA-Cre ERT2 In *R26-ChR2 (TrkA-CHR2) mice, the claw retraction threshold at blue light (reflectance subthreshold: 12.6 x 10⁻⁶) was [not specified]. -3 mWatt / mm 2 Compared to no light, blue light levels decreased in both early and late stages of RA; the combination of blue light (response subthreshold: 31.6 x 10) -3 mWatt / mm 2 It only enhanced the number of claw flicks in the 2g von Fresne and acetone tests in the early stages. In the Sst-Cre*R26-ChR2 (SSt-CHR2) or Vglut3-Cre*R26-ChR2 (Vglut3-CHR2) strains, no effect was shown on functional acquisition via blue LED in normal or RA mice.

[0082] Figure 10D: In normal TrkA-Cre ERT2 *R26-ArchT (TrkA-ArchT) mice exposed to yellow LED light (0.44 mWatt / mm²) 2 (30 minutes) reduced the percentage of reflex responses to 1.4 g and 2.0 g von Fritz; in antibody-induced arthritis mice, stimulation with yellow light (0.44 mWatt / mm) reduced the percentage of reflex responses to 1.4 g and 2.0 g von Fritz; 2 (30 minutes) Inhibition of TrkA in the population completely reversed mechanical touch-induced pain and cold touch-induced pain in both early and late RA, as well as mechanical responses (n=7-8). t-tests showed *** indicating p < 0.001, ** indicating p < 0.01, and * indicating p < 0.05.

[0083] Figure 11, including Figures 11A to 11C The PEP1 group is involved in normal mechanosensitization and cryosensitization.

[0084] Figure 11A Gfra3-Cre ERT2 *Gfra3 in the DRG of R26-Tom (Gfra3-Tom) mice + Neuron (Tom), DAPI (blue) as nuclear counterstain. Scale bar = 100 μm.

[0085] Figure 11B : In Gfra3-Cre ERT2 *Percentage of blue light reflectance response in R26-ChR2 (Gfra3-CHR2) mice, with the response curve shifting to the left after antibody injection (n=8).

[0086] Figure 11C Blue light combination (reflection subthreshold: 30.2 x 10⁻⁶) -3 mWatt / mm 2 Subthreshold response: 39.6 x 10 -3 mWatt / mm 2 This combination increased mechanosensitivity and cold sensitivity, thereby lowering the mechanosensitivity threshold, and increased response events to the 2g von Fresnel and acetone test, but had no effect on the thermosensitivity of Gfra3-CHR2 mice (n=25); when exposed to yellow LED light (0.44 mWatt / mm²), 2 After 45 minutes of inhibition, Gfra3-Cre ERT2 *R26-ArchT (Gfra3-ArchT) mice showed a higher claw withdrawal threshold only than those exposed to yellow light in the von Frey test (n=16). t-tests *** indicate p < 0.001, and ** indicate p < 0.01.

[0087] Figure 12 The TYK2 inhibitor deucravacitinib reversed pain in mice with chronic arthritis. Oral administration of the TYK2 inhibitor deucravacitinib (15 mg / kg, twice daily for 7 days) reversed joint pain, flexibility, and limb function; the analgesic effect of deucravacitinib subsided 24 hours after the last injection (n=10). ***p <0.001.

[0088] Figure 13: Systemic inhibition of MNK completely blocked RA-induced pain. (A) On day 48 post-antibody injection, intraperitoneal injection of the MNK1 / 2 inhibitor eFT508 (tomivostastatin / HY-100022, 1 mg / kg, dissolved in a 5:40:5:50 solution of DMSO:PEG300:Tween-80:saline) completely reversed joint pain (number of paw swings in the pinch test) and mechanosensitivity in antibody-induced arthritis mice (n=10). (B) Oral administration of 4ET-03-053 (MNK1 / 2 inhibitor, 1 mg / kg, dissolved in a 50:50 solution of PEG300:saline, on day 51) to arthritis mice. Joint pain (pinch test) was measured at 1 hour and 24 hours post-4ET-03-053 delivery (n=6). *p < 0.05, ***p < 0.001.

[0089] Figure 14 Local inhibition of MNK attenuated type I IFN-induced mechanosensitive hypersensitivity. In mediator + IFN mice, paw injection (i.pl.) of IFNA3 (300 U / 10 μl) induced paw mechanosensitive responses, leading to a decrease in the paw withdrawal threshold (touch-evoked pain) and an increase in paw flicking frequency (response). Pretreatment with the MNK inhibitor eFT508 (2 mg / kg, a 10:40:50 solution of MSO:PEG300:saline) delayed the onset of IFN-induced mechanosensitive touch-evoked pain to 24 hours and reversed it more rapidly. In mice (n=5) injected with BSA (0.1%, control), mechanosensitive hypersensitivity was unchanged.

[0090] Figure 15 eIF4E inhibitors reversed chronic RA pain. Systemic injection of the eIF4E / eIF4G interaction inhibitor 4EGI-1 (1 mg / kg, dissolved in a 5:40:5:50 solution of DMSO:PEG300:Tween-80:physiological saline) completely reversed joint and mechanical touch-induced pain and responses in arthritic mice (n=5) on day 56 post-injection, with effects resolving within 24 hours. **p < 0.01.

[0091] Figure 16: MNK inhibitors block IFN-α-induced hyperexcitability in DRG neurons. (A) Representative trajectories of action potential firing in the control (BSA, n = 9 cells) and IFN-α (n = 11 cells) groups. The number of spikes was significantly higher in the IFN-α group at each ramp intensity. In the right panel, the left bar represents the control value and the right bar represents the IFN value for each ramp current. (B) Representative trajectories of action potential firing in IFN + mediator (n = 13 cells) and IFN + MNK1 / 2 inhibitor (n = 15 cells), with firing increased by type I interferon reversed by preconditioning with MNK1 / 2 inhibitor (eFT508, 10 μM, 1 h). In the right panel, the left bar represents the IFN + mediator value and the right bar represents the IFN + MNK1 / 2 inhibitor value for each ramp current. (C) Sampling of small to medium-sized DRG neurons for patch-clamp electrophysiology experiments. Resting membrane potentials were similar across groups, and IFN-α treatment had no significant effect. Two-way ANOVA was used, followed by Fischer's LSD test to assess differences between groups. *p < 0.05.

[0092] Figure 17 Elevated levels of type I IFN protein in DRGs from RA patients with joint pain. Western blot analysis showed elevated levels of IFNα protein and phosphorylated STAT (S727) in donor DRGs (n=4) from patients with rheumatoid arthritis and joint pain compared to healthy donor tissues (n=6) without rheumatoid arthritis and pain. *p < 0.05. Detailed Implementation

[0093] Rabies (RA) is a complex autoimmune disease in which many cytokines and immune cells play a role. The etiology of pain associated with RA is unclear, and many factors are thought to be involved. For example, any of a long list of pro-inflammatory cytokines, inflammatory lipid mediators, neuropeptides, and NGF associated with RA can induce sensory sensitization and pain when injected into laboratory animals. These include, for example, TNF-α, IL-1β, IL-6, IL-8, IL-12, IL-15, IL-17, IL-18, IL-23, prostaglandin E2 (PGE2), NGF (nerve growth factor), GM-CSF, CGRP, SP, and PGE2 (Cunha et al., 2000; Poole et al., 1995; Amann et al., 1996; Iyengar et al., 2017; Kim et al., 2011; Lee et al., 2020; Ji et al., 2021; Barragán-Iglesias et al., 2020; Achuthan et al., 2016; Raoof et al., 2018). In the study by Ridgley et al. (2018), cytokines of the IL-23 / Th17 axis and IL-8 were associated with the progression of joint pain. Inhibitors targeting multiple cytokine pathways (e.g., GM-CSF, G-CSF, IL-3, IL-4, IL-6, IL-7, IL-9, IL-10, IL-11, IL-12, IL-13, IL-15, IL-17, IL-22, IL-23, IFN), namely JAK1 / JAK2 inhibitors, have been shown to alleviate pain associated with RA (Simon et al., 2021). Furthermore, inflammatory mediators are also thought to contribute to pain associated with RA.

[0094] The invention described herein specifically inhibits type I interferon cytokines to alleviate pain associated with rheumatoid arthritis (RA). Such type I inhibitors do not necessarily target the inflammatory components of RA. The inventors' discovery is unexpected and surprising because RA-associated pain was previously thought to be caused by multiple interacting cytokines; and it was previously unknown that specific inhibition of type I interferon could alleviate RA-associated pain.

[0095] Prior to this invention, it was believed that the onset and progression of pain in RA were associated with a variety of different cytokines, while the key molecules and their relative contributions to pain were unknown. Others had attempted to treat pain by targeting other cytokine types, but without success—for example, adalimumab (an antibody that specifically inhibits the tumor necrosis factor (TNF) cytokine class) was unsuccessful in treating pain associated with RA.

[0096] Those skilled in the art will be familiar with type I interferons. Interferons are a class of potent immunostimulatory cytokines, broadly classified into three subtypes: type I interferons (α, β, ε, κ, and ω), type II interferons (γ), and type III interferons (λ).

[0097] Therefore, the type I interferons we refer to include one or more selected from the group consisting of: interferon α; interferon β; interferon ε; interferon κ; and interferon ω.

[0098] Interferon α is the most abundant and characteristic, present in 13 distinct but homologous isoforms, excluding pseudogenes. Different genes can be active in different cells and under different conditions. In some embodiments, interferon α is selected from one or more of the following: IFNA1, IFNA2, IFNA4, IFNA5, IFNA6, IFNA7, IFNA8, IFNA10, IFNA13, IFNA14, IFNA16, IFNA17, and IFNA21. In one embodiment, type I interferon is interferon α.

[0099] In contrast, interferon β is encoded by only one gene (IFNB1). In another embodiment, type I interferon is interferon β.

[0100] The production of type I interferon is so tightly regulated that its levels are almost undetectable in healthy individuals. However, during pro-inflammatory states, type I interferon can be produced rapidly and in large quantities. Plasma-like dendritic cells (pDCs) are particularly noteworthy in their tendency to secrete type I interferon, as these cells express large amounts of intracellular pattern recognition receptors such as Toll-like receptors (TLRs)-7 and TLR-9. Following type I interferon receptor binding, type I interferon exerts its effects on intracellular signaling proteins, including but not limited to IRF7, IRF9, STAT1 and STAT2, JAK1, TYK2, AKT, MAPK, and NFkB. In turn, these intracellular signaling proteins induce the upregulation of a set of typical genes called interferon-stimulated genes (ISGs). ISGs are upregulated in some patients with rheumatoid arthritis (RA). ISG may include, but is not limited to, IFIT1, BST2, IFITM3, B2M, OASL or EPSTI1, HERC5, IFI44L, ISG15, LY6E, MX1, MX2, RSAD2 or IFI27, IFI44, IFI44L, IFI6, RSAD2 or other genes activated by type I interferon intracellular signal transduction.

[0101] Type I interferon has a pro-inflammatory effect, including dendritic cell maturation and activation, Th1 and Th17 polarization, and decreased regulatory T cells (T cells).reg This enhances B cell function and leads to increased B cell activation and subsequent antibody production.

[0102] Type I interferons, namely interferon-α and interferon-β, have previously been discussed as being associated with the development and / or progression of rheumatoid arthritis (RA), although a long list of other cytokines and inflammatory factors are also involved (Castaneda-Delgado et al., 2017; Ridgley et al., 2018; and van der Pouw Kraan, 2007). It is evident that, in all these studies, the actual role (if any) of type I interferons in the pathogenesis of RA remains unclear.

[0103] As discussed herein and in the accompanying examples, the present invention now surprisingly identifies the key role of type I interferon in pain associated with RA, and that inhibition of type I interferon can be used to treat or prevent this pain.

[0104] The term "inhibitor" as used here refers to a substance, such as a small molecule or biological agent, that reduces or inhibits one or more activities of its target (such as a specific reactant, catalyst, or enzyme). It should be understood that this invention relates to type I interferon inhibitors, and thus reduces or inhibits one or more activities of type I interferon. Such activities may include pro-inflammatory effects, dendritic cell maturation, dendritic cell activation, Th1 and Th17 polarization, T... reg Decreased function, enhanced B cell activation, increased antibody production, activation of type I interferon receptors, activation of intracellular signal transduction stimulated by type I interferon, expression of one or more type I interferon-stimulated genes and / or expression of one or more type I interferon-inhibiting genes.

[0105] In some embodiments, type I interferon inhibitors specifically target or specifically inhibit type I interferon. In this context, "specific" means that the type I interferon inhibitor reduces or blocks one or more activities of type I interferon to a significantly higher degree than it reduces or blocks one or more activities of another molecule (such as another cytokine). Therefore, in this case, the primary function of the inhibitor is to reduce or block one or more activities of type I interferon.

[0106] The term "patient" as we use it includes patients who experience pain associated with RA and patients who are capable of experiencing pain associated with RA.

[0107] It should be understood that rheumatoid arthritis (RA) is a systemic autoimmune disease characterized by chronic inflammation and progressive joint degeneration. Disease progression can be divided into: early stage (joint pain, stiffness, swelling, and tenderness); intermediate stage (inflammation damages the cartilage of the joint bones, resulting in decreased mobility and joint range of motion); severe stage (further impact on mobility and range of motion, joint deformities, and the formation of rheumatoid nodules); and terminal stage (symptoms become more difficult to treat and severe, making it impossible to perform daily tasks and requiring assistive devices).

[0108] In a preferred embodiment, the patient is a human or an animal (such as a fish, bird, reptile, amphibian, or mammal). Mammals include, but are not limited to, primates (including humans), cattle, sheep, goats, horses, dogs, cats, mink, rabbits, guinea pigs, hamsters, ferrets, rats, mice, or species of the Bovidae, Oligidae, Equidae, Canidae, Felidae, Rodentia, or Muridae families.

[0109] Various delivery systems are known and can be used to administer type I interferon inhibitors to patients, such as encapsulation in various ways (e.g., liposomes, microparticles, microcapsules), delivery via small molecules or proteins, delivery via gene vectors (e.g., viruses), and gene therapy (DNA or RNA). Methods of administration include, but are not limited to, intradermal, transdermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, epidural, and oral routes. Type I interferon inhibitors can be administered via any convenient route, such as by infusion or bolus, absorption through the epithelial or mucosal lining (e.g., oral mucosa, rectal and intestinal mucosa), and can be administered together with other biologically active agents. Type I interferon inhibitors can also be delivered via vesicles, particularly liposomes. Administration can be systemic or local. Those skilled in the art are able to select an appropriate route of administration for a specific patient and type I interferon inhibitor therapy. The substance can be administered to the patient at a therapeutic dose.

[0110] By “pain associated with RA”, we mean at least one type of pain associated with and / or caused by RA, such as the pain discussed in this article.

[0111] Pain can be associated with RA flare-ups. For example, the Disease Activity Score (DAS) can be used to measure RA flare-ups, indicating the intensity of RA disease activity at a given moment. For instance, DAS28 is a measure of RA disease activity, where the number 28 refers to the 28 joints examined in this assessment.

[0112] Recognized tests and scales can be used to identify, determine, assess, and / or quantify pain associated with RA. Those skilled in the art can select appropriate methods—for example, by:

[0113] (i) Use questionnaires, such as the Visual Analogue Scale (VAS) or the Patient Pain VAS, to assess perceived pain; and / or

[0114] (ii) Clinical examination and quantification of joint tenderness and / or swelling (count of swollen joints and count of tender joints, possibly 28); and / or

[0115] (iii) Measure the distance (mm) between the “no pain” anchor point and the patient mark on a 10 cm scale to provide a scoring range of 0 to 100 (where a higher score indicates greater pain intensity). Based on the distribution of pain VAS scores as no, mild, moderate, or severe, the following cutoff points have been recommended for use on the pain VAS: no pain (0 to 4 mm), mild pain (5 to 44 mm), moderate pain (45 to 74 mm), and severe pain (75 to 100 mm); and / or

[0116] (iv) Use the standardized Quantitative Sensory Test (QST) (German Network for Neuropathic Pain Research (DFNS)) to assess neuropathic pain.

[0117] It should be understood that pain associated with alternative diagnoses (i.e. pain that is not associated with RA and / or is not caused by RA, but is associated with other diseases such as psoriatic arthritis, acute viral polyarthritis, polyarticular gout, calcium phosphate deposition disease, systemic lupus erythematosus (SLE)) can be ruled out by other examinations such as X-ray examination (hand, wrist, foot), magnetic resonance imaging (MRI), serological studies for infection, and synovial fluid analysis.

[0118] As we refer to “RA-associated pain,” we mean reducing the severity of at least one type of pain associated with RA in a patient. This term includes slowing or halting the progression or exacerbation of pain. It also includes slowing or delaying a positive prognosis associated with RA-associated pain.

[0119] By “preventing pain associated with RA”, we mean suppressing the manifestation of at least one type of pain associated with RA, that is, the subject may experience no pain, or the pain may be reduced or eliminated after taking a substance (such as a type I interferon inhibitor).

[0120] In one embodiment, the pain is functional pain, such as inflammatory joint pain.

[0121] The term "functional pain" refers to a specific type of inflammatory pain that occurs and / or is felt in the skin, muscles, tendons, bones, and joints through communication between immune cells and other non-neuronal cells and sensory neurons. Functional pain includes peripheral nerve dysfunction, such as increased excitability and / or ectopic activity of afferent nerves. Functional pain can occur independently of peripheral stimulation of nociceptors and can be caused by central sensitization or other central mechanisms. Functional pain results from a disruption of normal sensory nociceptive function, leading to spontaneous or stimulus-induced chronic pain. In contrast, nociceptive pain is the body's "normal" defense against harmful or potentially harmful stimuli.

[0122] Peripheral sensitization can also enhance subsequent signal transduction in central circuits at various levels of the ascending neural pathway; this process is called central sensitization. This central sensitization of the spinal cord has been attributed to: increased pain sensitivity due to synaptic changes caused by the spatiotemporal summation of repetitive nociceptive inputs; enhanced neurotransmission via N-methyl-D-aspartate (NMDA) receptors leading to increased pain sensitivity; and activation of spinal microglia and secondary spinal cord inflammation caused by local cytokine release. It has been proposed that pain associated with rheumatoid arthritis (RA) involves changes in the brain (spinal cord). Pain is continuously regulated through descending pathways that integrate inputs about emotion, stress, sleep, etc., thereby affecting pain perception. The executive area for descending pain regulation is the ventromedial medulla oblongata, which integrates afferent information and determines how much pain signal transduction is allowed to reach the brain via the spinal cord (Cao et al., 2020).

[0123] Peripheral sensitization may be caused by joint inflammation. This pain sensitivity can indicate sensitization of peripheral or central nociceptive pathways and lead to clinical pain reported by people with RA (Joharatnam et al., 2015).

[0124] The term "joint" as we use it refers to an anatomical region where two or more skeletal parts of a patient's body connect. For example, the metacarpophalangeal joint is the joint between the first and second phalanges; the proximal interphalangeal joint is the junction of the phalanges and hand bones; and the elbow joint is the joint between the humerus, ulna, and radius. A joint may include the bone itself, cartilage, ligaments, joint capsule, synovium, bursa, and / or synovial fluid. Joints can be fibrous joints, cartilaginous joints, synovial joints, ankle joints, condylar joints (such as those found in the wrist and at the base of the index finger), elbow joints, glenohumeral joints, humeral (shoulder) joints, sacroiliac joints, hip joints, knee joints, and temporomandibular joints.

[0125] The term "inflammatory joint pain" refers to the presence of pro-inflammatory factors (e.g., cytokines, lipid mediators, peptides, growth factors) systemically (e.g., in serum) and / or locally at the site of pain, such as in joints (e.g., synovial joints), resulting in pain, swelling, and tenderness. Inflammatory pain can be assessed by identifying clinical inflammation.

[0126] As we refer to “clinical inflammation,” it means that the level of inflammation can be detected using standard clinical measures and inflammatory markers. Those skilled in the art can select appropriate measures, such as erythrocyte sedimentation rate (ESR or “settling” rate), swollen / tender joint count, hand tenderness, acute phase reactants (APRs) such as C-reactive protein (CRP), ferritin, plasma fibrinogen, and platelet count. Those skilled in the art can select appropriate inflammatory markers, such as pro-inflammatory cytokines that are systemically present and / or locally present at the site of pain, such as TNF, IL-6, IL-1, GM-CSF, IL-17, IL-20, IL-23, and IL-24. Statistical tests for comparing changes in cytokine levels are known to those skilled in the art.

[0127] In one embodiment, the pain is not inflammatory pain. By "non-inflammatory pain," we mean pain present in the absence of clinical inflammation. Non-inflammatory pain is pain not associated with measures of inflammation and is common in patients with RA. In this case, the patient experiences RA-associated pain despite a significant lack (or "healthy") of pro-inflammatory factors. Without being bound by theory, the inventors believe that some degree of subclinical inflammation still exists in such cases.

[0128] In one embodiment, the pain is not neuropathic pain or neuroplastic pain.

[0129] In an alternative embodiment, the pain is neuropathic pain or neuroplastic pain. Neuropathic pain can occur alone or in conjunction with other forms of pain, such as inflammatory pain. In some embodiments, neuropathic pain may occur alongside inflammatory pain, where type I interferon inhibitors may be particularly useful.

[0130] The term "neuropathic pain" as used here refers to pain caused by lesions, diseases, and / or damage to the nervous system. This may include peripheral nervous system (PNS) and / or central nervous system (CNS). In some embodiments, neuropathic pain may be peripheral neuropathic pain, central neuropathic pain, or mixed (peripheral and central) neuropathic pain. Appropriate examinations for determining the presence of pain are well known to those skilled in the art. For example, questionnaires such as VAS, quantitative sensory tests, etc., are used. Appropriate examinations for determining whether pain is neuropathic pain are well known to those skilled in the art. For example, clinicians may look for underlying lesions in the CNS or PNS or precipitating factors consistent with the development of neuropathic pain. Magnetic resonance imaging (MRI), quantitative sensory tests (QST), sweating assessment, or skin biopsy may also be used.

[0131] The term "neuroplastic pain" as we refer to it means that pain symptoms are caused by learned neural pathways in the brain, rather than by persistent structural damage or disease in the body. Neuroplastic pain does not involve any damage or alteration to the afferent sensory system. Neuroplastic changes in brain structure and function can be a consequence of chronic pain and may also be involved in the maintenance of pain symptoms. Appropriate examinations for determining the presence of pain are well known to those skilled in the art. For example, a clinical examination is performed to determine the presence of pain that is disproportionate to persistent / spontaneous pain that is invasive, burning, or tingling, and / or a neurological examination is performed to determine the presence of nerve damage or spinal cord or brain lesions / damage.

[0132] Regardless of the origin and the mechanisms involved (discussed in this article), a patient's perception of the "feeling" of pain can be the same. For example, non-inflammatory pain processes (such as those involving some neuropathic pain) can produce the same pain symptoms as inflammatory pain processes.

[0133] In one embodiment, the pain is chronic pain. By "chronic pain," we mean pain that exceeds the expected healing period. Chronic pain contrasts with acute pain, which lasts much shorter. Chronic pain can be nociceptive and / or neuropathic chronic pain. Chronic pain is typically persistent and unrelated to RA treatment.

[0134] Preferably, "chronic pain" refers to pain that has been present for twelve weeks or longer, three months or longer, thirteen weeks or longer, fourteen weeks or longer, fifteen weeks or longer, sixteen weeks or longer, four months or longer, five months or longer, six months or longer, seven months or longer, eight months or longer, nine months or longer, ten months or longer, eleven months or longer, twelve months or longer, one year or longer, thirteen months or longer, fourteen months or longer, fifteen months or longer, sixteen months or longer, seventeen months or longer, eighteen months or longer, two years or longer, three years or longer, four years or longer, five years or longer, ten years or longer, or for the remainder of the patient's life.

[0135] When we say "pain that persists for a period of time", we mean that the pain may persist, recur, and / or progress over a period of time.

[0136] When we say "pain may persist for a period of time," we mean persistent pain, meaning that the pain may persist at the same, weaker, or stronger intensity as at the beginning of the assessment at all time points. For example, the recognized pain tests and scales discussed in this article may not show statistically significant changes when tested at multiple time points. Therefore, the pain neither improves nor worsens, but persists over time.

[0137] When we say "pain may recur over a period of time," we mean that although there is an initial statistically significant improvement in at least one of the recognized pain tests and scales when tested at multiple time points, the improvement is reversed later. Therefore, pain may be absent but recur at one or more of the assessed time points for a period of time that is not present but recurs. This means that pain may be absent but recur at one or more of the assessed time points for a period of time that is not present at ...

[0138] When we say "pain may progress over time," we mean that when tested at multiple time points, there is a statistically significant improvement in at least one of the recognized pain tests and scales discussed in this article. Therefore, pain improves (i.e., lessens) over time.

[0139] In yet another embodiment, the pain is selected from one or more of the following: pain hypersensitivity; touch-induced pain; hyperalgesia; arthralgia.

[0140] The term "pain hypersensitivity" refers to a patient's heightened sensitivity to pain, or an abnormal pain response. Patients with pain hypersensitivity may have a lower pain threshold (the point at which uncomfortable or unpleasant things cause pain) compared to the same patient or another patient without pain hypersensitivity. Different types of pain hypersensitivity can include hyperalgesia and tactile pain. Hyperalgesia and tactile pain can be caused by neural and non-neural mechanisms (e.g., skin, joints) and can be felt in the lesion area, discrete areas, or in a more diffuse, systemic manner.

[0141] The term "touch-evoked pain" as we use it refers to a pain response to a stimulus that would not normally cause pain. In touch-evoked pain, the patient experiences pain when the stimulus does not normally cause pain (i.e., a non-painful stimulus is perceived as painful). Different types of touch-evoked pain include mechanical / tactile touch-evoked pain, static mechanical touch-evoked pain, dynamic mechanical touch-evoked pain, thermal (cold or hot) touch-evoked pain, and motor touch-evoked pain (i.e., pain evoked by normal movement of a joint or muscle). Those skilled in the art will recognize suitable methods for determining touch-evoked pain, such as using swabs or brushes for assessing dynamic mechanical touch-evoked pain, pressure pain meters and standardized monofilaments, quantitative sensory tests (QST), thermal testing devices, or the Von Frey test for RA patients or animal models of RA.

[0142] The term "hyperalodynia" as used here refers to an excessive or inappropriate response to painful stimuli. In hyperalodynia, a patient experiences pain in a "normal" situation, but may experience a greater intensity of pain compared to the same patient or another patient without hyperalodynia. A patient with hyperalodynia may respond more rapidly to painful stimuli compared to the same patient or another patient without hyperalodynia. The pain experienced by a patient with hyperalodynia to a painful stimulus may last longer than the pain experienced by the same patient or another patient without hyperalodynia to the same painful stimulus. Hyperalodynia can be primary hyperalodynia, secondary hyperalodynia, referred hyperalodynia, visceral hyperalodynia, or a combination thereof. Those skilled in the art will be aware of appropriate methods for determining hyperalodynia; for example, applying painful stimuli to the patient and rating the perceived pain, performing a quantitative sensory test (QST) or using a pressure pain meter, and applying weighted needle stimulation.

[0143] In these forms of increased sensitivity, neurons may exhibit increased excitability and / or be able to generate action potentials in the absence of any stimulus (persistent or spontaneous pain), or generate an increased number of action potentials upon stimulation compared to normal neurons (pain hypersensitivity). Increased sensitivity can be caused by a lower firing threshold, depolarization, larger and / or longer receptor potential amplitudes, and more efficient generation of action potentials from receptor potentials. In some cases, increased sensitivity is caused by ectopic activity of sensory neurons, such as dormant or silent nociceptors that can be considered to "un-silence" or "awaken."

[0144] The term "joint pain" as used here refers to pain in the joints. This joint pain can occur with or without inflammation, such as during or after RA remission or in RA patients whose inflammatory disease is well controlled. Preferably, the RA-related joint pain to be prevented or treated is not joint pain present in the prodromal phase of RA. Technicians should be familiar with appropriate methods for determining joint pain, for example, by using questionnaires and performing physical examinations on patients.

[0145] It should be understood, and as described herein, that pain may be associated with and / or caused by:

[0146] - Systemic inflammation; and / or

[0147] - Local inflammation; and / or

[0148] - Clinical inflammation.

[0149] The term "systemic inflammation" means that inflammation can occur anywhere in the body. Inflammatory factors (e.g., cytokines, lipid mediators, peptides, growth factors) may be present in blood cells and / or serum.

[0150] The term "local inflammation" means that inflammation may only exist in a localized part of the body. Inflammatory factors (e.g., cytokines, lipid mediators, peptides, growth factors) may be present in a specific organ, joint, or other part of the body, but not in another part. Inflammatory factors may be different from or overlap with those present in systemic inflammation.

[0151] When we say "caused by systemic inflammation; and / or local inflammation; and / or clinical inflammation," we mean that the pain is a direct consequence of systemic inflammation; and / or local inflammation; and / or clinical inflammation.

[0152] When we say "associated with systemic inflammation; and / or local inflammation; and / or clinical inflammation," we mean that the pain is not necessarily caused by systemic inflammation; and / or local inflammation; and / or clinical inflammation, but the pain coexists with such inflammatory conditions.

[0153] In one embodiment, the pain is not associated with and / or caused by inflammatory disease activity in rheumatoid arthritis.

[0154] The term "inflammatory disease activity in rheumatoid arthritis" as used here refers to a state of active RA inflammatory disease in RA patients. This "active RA inflammatory disease state" means that the inflammation has reached a clinically recognized level, which can be assessed as described herein. For example, this can be achieved using the Clinical Disease Activity Index (CDAI), the Routine Patient Index Data Assessment 3 (RAPID3), or the DAS28 score. As is known in the art, inflammatory disease activity can be categorized as low-activity, moderate-activity, or high-activity. For example, a DAS28 score greater than or equal to 2.6 and less than 3.1 indicates low-activity; a score greater than or equal to 3.1 and less than 5.1 indicates moderate-activity; and a score greater than or equal to 5.1 indicates high-activity.

[0155] A patient may be in an inactive inflammatory state of RA before, during, or after being diagnosed with RA. A patient is considered to have RA when diagnosed with RA (including when differentiating it from other inflammatory polyarthritis diagnoses).

[0156] Patients who were in an inactive RA inflammatory state prior to being diagnosed with RA may be experiencing any of the pains described herein and have circulating anti-citrullinated peptide antibody (ACPA) / circulating anti-cyclic citrullinated peptide (CCP) antibodies in their bodies. In a preferred embodiment, the patient did not have an inactive RA inflammatory state prior to being diagnosed with RA.

[0157] Patients in an inactive RA inflammatory state during a period considered to have RA may be able to control the inflammatory disease with DMARDs; however, upon discontinuation of DMARDs, (i) the patient will regress to an active RA inflammatory state or (ii) the patient will remain in an inactive RA inflammatory state (i.e., RA remission). By "remission," we mean a reduction or disappearance of inflammatory signs and / or symptoms. Those skilled in the art are able to select appropriate methods for determining remission, such as a DAS28 score less than 2.6 indicating remission.

[0158] When we say "not caused by inflammatory activity of rheumatoid arthritis," we mean that the pain is not a direct consequence of RA inflammatory activity (also known as an active RA inflammatory state). Therefore, eliminating or reducing this RA inflammatory activity should not alleviate or stop the pain.

[0159] When we say "pain not associated with inflammatory activity of rheumatoid arthritis," we mean that the pain does not necessarily occur simultaneously with inflammatory activity of RA. Therefore, pain may be present even without inflammatory activity of RA (also known as an inactive inflammatory state of RA).

[0160] In another embodiment, the pain is located at the affected joint and / or the contralateral part of the affected joint and / or the cephalic part of the affected joint and / or the caudal part of the affected joint.

[0161] The term "affected joint" refers to a joint that is inflamed, swollen, tender, and / or the joint where the first onset of pain is felt.

[0162] When we say "the opposite side of the affected joint", we mean the side of the affected joint opposite to the left and right axes.

[0163] When we say "the cephalic portion of the affected joint" and "the caudal portion of the affected joint," we mean the cephalic (upper) and caudal (lower) portions of the affected joint relative to the cephalic-coccygeal axis. For example, if the affected joint is the right knee, the contralateral portion could be the left knee; the cephalic portion could be any shoulder joint; and the caudal portion could be any ankle joint.

[0164] In alternative or additional embodiments, the pain is extra-articular pain. By "extra-articular pain," we mean pain that is not joint pain. This extra-articular pain, discomfort, or itching may be perceived by the patient as originating from the skin.

[0165] In one embodiment, type I interferon inhibitors do not prevent or treat inflammatory diseases with enhanced type I interferon signaling.

[0166] The “inflammatory diseases with enhanced type I interferon signaling” we are referring to include any one of RA, polyarthritis, Aicardi–Goutieres syndrome (AGS) 1, systemic lupus erythematosus (SLE), Crohn's disease, psoriasis, psoriatic arthritis, osteoarthritis, dermatomyositis, primary Sjögren's syndrome, systemic sclerosis, type I interferon disease, and fibromyalgia.

[0167] In one embodiment, pain is present along with inflammation of the disease.

[0168] By "coexisting with disease inflammation," we mean that pain may be present in a patient with active RA inflammatory disease. The patient may be receiving treatment, such as DMARDs, or not. If a patient is receiving DMARD treatment and still has active RA inflammatory disease, then the inflammation is considered not fully controlled.

[0169] In an alternative embodiment, the pain is present in the absence of disease-related inflammation.

[0170] Patients may transition from an active RA inflammatory disease state to an inactive RA inflammatory disease state due to treatment such as DMARDs. When a patient is receiving DMARD treatment and is no longer in an active RA inflammatory disease state, the inflammation is considered to be under control.

[0171] In a preferred embodiment, pain is absent prior to inflammation of the disease. By "prior to inflammation of the disease," we mean the prodromal phase of RA. Patients presenting with both pain (such as arthralgia) and circulating anti-citrullinated peptide antibody (ACPA) / circulating anti-cyclic citrullinated peptide (CCP) antibodies can be considered to be in the prodromal phase of RA.

[0172] In one embodiment, pain exists during or after the relief of inflammation in the disease.

[0173] The term "disease-remission period" as we use it refers to a period in which pain may be present in patients with reduced inflammatory signs and / or symptoms. Patients may still be in or may no longer be in an active RA inflammatory disease state. The reduction in inflammatory signs and / or symptoms may be caused by treatments such as DMARDs. During disease-remission period, RA patients may still rely on such treatments to enter and remain in an inactive RA inflammatory disease state.

[0174] "After disease inflammation has subsided" means that pain may be present in patients whose inflammatory signs and / or symptoms are no longer present or measurable. The patient may still be in an inactive RA inflammatory disease state. The disappearance of inflammatory signs and / or symptoms may be caused by treatments such as DMARDs. After disease inflammation has subsided, RA patients may no longer rely on such treatments to maintain an inactive RA inflammatory disease state.

[0175] It should be understood, and as described in this article, that patients may have received or are receiving pain management, but pain may persist and / or may recur and / or may progress.

[0176] Pain management is known in the art and may include nonsteroidal anti-inflammatory drugs (NSAIDs) such as celecoxib, diclofenac, etoricoxib, ibuprofen, and naproxen; steroids such as corticosteroids and glucocorticoids (e.g., prednisolone); acetaminophen (also known as paracetamol); weak opioids such as codeine, dextropropoxyphene, and tramadol; antidepressants such as tricyclic antidepressants; anticonvulsants; or combinations thereof. Pain management may be considered ineffective, suboptimal, and / or failed in cases of persistent, recurrent, or progressive pain.

[0177] It is estimated that NSAIDs relieve symptoms in only about 15 percent of people. Steroids and weak opioids help reduce pain and swelling in affected joints; however, long-term use can lead to serious side effects, and therefore they are mainly used for short-term management of RA pain (McWilliams et al., 2022; Day et al., 2019). Paracetamol has only weak anti-inflammatory effects and has been shown to be even less effective than NSAIDs in relieving RA-related pain (Bullock et al., 2018; Evidence review G Analgesics, NICE guidelines, 2018).

[0178] When we say "the patient may have already received pain management," we mean that the patient was no longer receiving pain management at the time of the pain assessment described in this article.

[0179] When we say "the patient may be receiving pain management," we mean that the patient was still receiving pain management at the time of the pain assessment described in this article.

[0180] In one embodiment, pain is associated with and / or caused by enhanced type I interferon signaling in the patient's body.

[0181] Changes (enhancement or decrease) in type I interferon signaling can be detected in serum and at different sites within the patient's body, such as sensory neurons and surrounding tissues or cells. Depending on the location of the sample (e.g., blood, synovium, or sensory neuron, nerve, or skin sample), the markers of enhanced / decreased type I interferon signaling may vary. Therefore, the methodology for determining whether type I interferon signaling differs from that of healthy controls will be tailored to the type of sample obtained from the patient.

[0182] When we say that "pain is associated with type I interferon signaling in the patient's body," we mean that pain is not necessarily caused by enhanced type I interferon signaling in the patient's body, but rather that pain may occur simultaneously with enhanced type I interferon signaling in the patient's body.

[0183] When we say that "pain is caused by enhanced type I interferon signaling in the patient's body," we mean that pain is a direct consequence of enhanced type I interferon signaling in the patient's body. Therefore, reducing enhanced type I interferon signaling in the patient's body may alleviate or stop the pain.

[0184] Preferably, the enhanced type I interferon signal transduction includes:

[0185] - Enhanced intracellular signal transduction of type I interferon in the patient's body;

[0186] - Elevated levels of type I interferon in the patient's body;

[0187] - Enhanced activation of type I interferon receptors in the patient's body;

[0188] - Increased expression of one or more type I interferon-stimulated genes in the patient's body; and / or

[0189] - Reduced expression of one or more type I interferon-suppressing genes in the patient's body.

[0190] It should be understood that, for example, due to intrinsic negative feedback mechanisms that can lead to the maintenance or reduction of signal transduction, patients may have elevated levels of type I interferon, but without enhanced intracellular signal transduction of type I interferon.

[0191] Alternatively, for example, due to intracellular interferon-induced transcriptional inhibitors (which may or may not affect signal transduction), patients may have elevated levels of type I interferon and / or enhanced type I interferon receptor activation, but without increased expression of one or more interferon-stimulated genes.

[0192] The terms "enhanced" signaling, "elevated" levels, "enhanced" activation, "increased" expression, and "decreased" expression refer to, for example, in patients or healthy controls without pain, a statistically significant enhancement / elevation / enhancement / increase or decrease in signaling, levels, activation, or expression compared to baseline. In some embodiments, p-values ​​are less than 0.05, less than 0.04, less than 0.03, less than 0.02, less than 0.01, less than 0.001, and less than 0.0001.

[0193] Those skilled in the art can select appropriate assays to detect intracellular signal transduction of type I interferon in patients.

[0194] Those skilled in the art can select appropriate assays to detect type I interferon levels in patients. Methods may include, but are not limited to, quantitative PCR (qPCR), single-cell or batch RNA sequencing, hybridization-based methods or enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), mass spectrometry, and reporter gene assays. For example, the transcriptional level of any of the interferon α genes listed herein can be assessed.

[0195] Those skilled in the art can select appropriate assays to detect type I interferon receptor activation. Methods may include, but are not limited to, quantitative PCR (qPCR), single-cell or batch RNA sequencing, hybridization-based methods or enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), mass spectrometry, and phosphorylation / dephosphorylation status. For example, phosphorylation of intracellular domains of IFNAR1, IFNAR2, TYK2, MNK1, MNK2, and / or eukaryotic translation initiation factor 4E (eIF4E) can be assessed.

[0196] Those skilled in the art can select appropriate assays to detect increased expression of one or more type I interferon-stimulated genes or decreased expression of one or more type I interferon-repressive genes. Methods may include, but are not limited to, quantitative PCR (qPCR), single-cell or batch RNA sequencing, hybridization-based methods or enzyme-linked immunosorbent assay (ELISA), sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), mass spectrometry, and reporter gene assays. For example, the transcriptional level of any of the interferon-stimulated genes listed herein can be assessed.

[0197] It should be understood that, for example, the level of significant fold change in transcriptional levels detected by qPCR may depend on the specific transcript being detected and the specific internal reference transcript used for normalization. In some embodiments, the fold change value is at least 1.2-fold, at least 1.3-fold, at least 1.4-fold, at least 1.5-fold, at least 1.6-fold, at least 1.7-fold, at least 1.8-fold, at least 1.9-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, at least 30-fold, at least 40-fold, or at least 50-fold.

[0198] In some embodiments, samples may be obtained systemically, such as blood samples (e.g., whole blood cells, peripheral blood mononuclear cells) or serum. In other and / or alternative embodiments, samples may be obtained locally, such as in the dorsal root ganglion (DRG), synovium, nerves, skin, or muscle. Anatomically, DRGs originate from the dorsal roots of spinal nerves. They transmit sensory information from various receptors (i.e., pain and temperature) in the periphery to the central nervous system for a response. The role of DRGs in chronic pain has been confirmed; however, until now, it has been unclear which specific cell type is affected in pain associated with RA.

[0199] Increases or decreases can occur over time and can be measured by periodically obtaining samples. In one embodiment, the increase or decrease may be temporary, where signal transduction, levels, activation, or expression return to baseline after a few hours. In another embodiment, the increase may be persistent, where signal transduction, levels, activation, or expression remains increased or decreased over days, weeks, or months. In some embodiments, the systemic increase in type I interferon signaling is temporary. In another embodiment, the localized increase in type I interferon signaling is persistent.

[0200] Suitable type I interferons are selected from the group consisting of: interferon α; interferon β.

[0201] In another embodiment, pain is associated with an increase in the number and / or enhanced activity of one or more active sensory neurons in the patient's body; preferably, it is associated with an increase in the number and / or enhanced activity of one or more nociceptors in the patient.

[0202] The term "sensory neuron" as we use it includes the meaning of afferent neurons, which are specific cell types in the nervous system that translate stimuli into actions or gradations of electrical potentials. In vertebrates, the cell bodies of sensory neurons are located in the dorsal ganglia, jugular ganglia, and trigeminal ganglia of the spinal cord. Sensory information is transmitted from the ganglia to the brain via the spinal cord or brainstem.

[0203] As will be understood, a specific type of sensory neuron is called a nociceptor (also known as a pain receptor). Nociceptors respond to damage or the threat of damage to body tissues, resulting in (usually but not always) a sensation of pain. The brain generates a sensation of pain by diverting attention to the body part, thereby reducing the threat; this process is called nociception.

[0204] Nociceptors can exist inside the body (such as nociceptors in muscles, joints, bladder, internal organs, and gastrointestinal tract) or outside the body (such as nociceptors in the skin, cornea, and mucous membranes), and can detect different kinds of noxious stimuli.

[0205] Noxious stimuli are detected at the peripheral end of mature nociceptors and converted into electrical energy. When this energy reaches a threshold, an action potential is induced and conducted to the central nervous system (CNS). This, in turn, leads to the sensation of pain. The sensory specificity of nociceptors is determined by a high threshold for specific characteristics of the stimulus. Nociceptors are only triggered when a chemical, thermal, or mechanical environment has reached this high threshold.

[0206] Most nociceptors are classified according to the type of modality in which they respond. For example, some nociceptors may respond to one modality and are called monomodal nociceptors. Other nociceptors may respond to more than one of these modalities and are therefore called multimodal nociceptors, such as C-multimodal nociceptors. Other nociceptors do not respond to any of these modalities (although they may respond to stimuli in the presence of inflammation in the surrounding tissue) and are called dormant or silent nociceptors. Alternatively, nociceptors can be classified according to the axons that transmit pain signals and are divided into A-fiber nociceptors (such as Aδ and Aβ nociceptors) with conduction velocities higher than 5 m / s or C-fiber nociceptors with conduction velocities typically less than 2 m / s. In one embodiment, sensory neurons are C-multimodal nociceptors and / or C-fiber nociceptors and / or A-fiber nociceptors.

[0207] The term "active sensory neuron" as used here refers to a sensory neuron that generates one or more electrical currents, thereby producing one or more graded potentials and / or one or more action potentials. Those skilled in the art can select appropriate assays to assess the activity of sensory neurons, for example, through the use of electrophysiological techniques.

[0208] It should be understood that a relatively small increase in the number of active sensory neurons is sufficient to cause pain and / or exacerbate pain—for example, activating or adding one or a few sensory neurons (out of approximately 10,000 sensory neurons in each ganglion) is sufficient to cause pain and / or exacerbate pain.

[0209] In one embodiment, the increase in the number of active sensory neurons (compared to inactive sensory neurons) is an increase of the following percentages in one or more ganglia: at least 0.0001%, at least 0.0002%, at least 0.0005%, at least 0.001%, at least 0.002%, at least 0.005%, at least 0.01%, at least 0.02%, at least 0.05%, at least 0.1%, at least 0.2%, at least 0.5%, at least 1%, at least 2%, at least 5%, at least 10%.

[0210] In another embodiment, the increase in the number of active sensory neurons is an increase in the following percentages in one or more sensory ganglia: at least 100%, at least 125%, at least 150%, at least 175%, at least 200%, at least 225%, at least 250%, at least 275%, at least 300%, at least 325%, at least 350%, at least 375%, at least 400%, at least 425%, at least 450%, at least 475%, at least 500%, at least 525%, at least 550%, at least 575%, at least 600%.

[0211] The phrase "enhanced activity of one or more sensory neurons" means that sensory neurons may have an increased number of action potentials (also known as nerve impulses) and / or larger and / or longer receptor potential amplitudes. This can occur during chronic pain. The increased number of action potentials and / or larger receptor potentials lead to an increase in pain intensity. Those skilled in the art can select appropriate assays to detect sensory neuron activity, for example, by using microelectrocardiography techniques.

[0212] In one embodiment, the patient's sensory neurons are sensory neurons that express tropomyosin receptor kinase A (TrkA); preferably, they are nociceptors that express (TrkA).

[0213] TrkA can also be referred to as tyrosine kinase A, high-affinity nerve growth factor (NGF) receptor, neurotrophic tyrosine kinase receptor (NTKR) type 1, or TRK1-converted tyrosine kinase protein; TRK; TRK1; TRKA; Trk-A; p140-TrkA. In humans, TrkA is encoded by the NTRK1 gene. This kinase is a membrane-bound receptor that, upon binding to neurotrophic factors, undergoes autophosphorylation and activates intracellular signaling via the MAPK pathway. In some embodiments, TrkA is expressed in sensory neurons (DRGs).

[0214] In another or alternative embodiment, the patient’s sensory neurons are sensory neurons expressing GDNF family receptor α3 (GFRa3); preferably, they are nociceptors expressing GFRa3.

[0215] GFRa3, also known as GFRA3 or GFR-α3, is encoded by the GDNFR3 gene in humans. This protein is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor and a member of the glial cell line-derived neurotrophic factor (GDNF) receptor family. It forms a signal transduction receptor complex with RET tyrosine kinase receptors and binds to the ligand artesunate (also known as enovin or neuroembryocin). In some embodiments, sensory neurons expressing GFRa3 are located in the DRG (Diagnosis Related Groups).

[0216] In another or alternative embodiment, the patient’s sensory neurons are sensory neurons expressing transient receptor potential cation channel subfamily V member 1 (TrpV1); preferably, they are nociceptors expressing TrpV1.

[0217] TrpV1 is also known as transient receptor potential vanillic acid subfamily 1 receptor, vanillic acid receptor, capsaicin receptor, or VR1. In humans, TrpV1 is encoded by the TRPV1 gene. Four transcriptomorphs of this gene have been described, encoding the same protein but with different 5'UTR sequences. The protein encoded by this gene is a receptor for capsaicin and is a non-selective cation channel structurally associated with members of the TRP ion channel family. TrpV1 is a multimodal channel sensitive to various physical and chemical stimuli, including heat, low pH, and mechanical stimuli, and can be activated by various ligands, such as vanillin, capsaicin, resin toxins, cannabinoids, and ginsenosides. In sensory neurons, the TrpV1 channel can interact with the TRPA1 ion channel to mediate the detection of noxious stimuli. In some embodiments, sensory neurons expressing TrpV1 are located in the DRG (Diagnosis Related Group).

[0218] In another or alternative embodiment, the patient's sensory neurons are sensory neurons expressing calcitonin gene-related peptide (CGRP); preferably, they are nociceptors expressing CGRP.

[0219] CGRP is also known as Calca. In humans, CGRP is encoded by the Calca gene and is also called CT, KC, PCT, CALC1, CGRP1, CGRP-I, and CGRP-α. Calcitonin gene-related peptide is a member of the calcitonin peptide family and is secreted and stored in the nervous system. In humans, the peptide exists in two forms: CGRP α (also known as α-CGRP or CGRP I) and CGRP β (also known as β-CGRP or CGRP II). CGRP can bind to the calcitonin receptor-like receptor (CALCRL) and receptor activity-modifying protein (RAMP1). In some embodiments, sensory neurons expressing CGRP are located in the DRG. In some embodiments, sensory neurons expressing CGRP release CGRP protein, which can affect inflammation by causing vasodilation and increased vascular permeability, leading to vascular leakage (i.e., extravasation of plasma proteins) and swelling. CGRP can also activate immune cells, such as mast cells. This leads to a phenomenon called neurogenic inflammation.

[0220] By "expression," we mean that the relevant gene is transcribed by the cell and optionally translated, and then transported to the correct location within the cell (such as the cell surface) or secreted from the cell.

[0221] Those skilled in the art can use methods known in the art to determine whether a sensory neuron expresses TrkA, GFRa3, TrpV1, and / or CGRP. Examples include in situ hybridization, RNA sequencing, immunostaining, reporter gene strains, and optogenetics.

[0222] Type I interferon inhibitors

[0223] In one embodiment, type I interferon inhibitors reduce type I interferon signaling in patients.

[0224] It should be understood that when administered to patients, type I interferon inhibitors can reverse enhanced type I interferon signaling. Changes in type I interferon signaling can be detected using the methods discussed herein.

[0225] In some embodiments, type I interferon inhibitors:

[0226] -Block or reduce intracellular signal transduction of type I interferon in the patient's body;

[0227] -Prevent or reduce the level of type I interferon in the patient's body;

[0228] -Prevent or reduce the activation of type I interferon receptors in the patient's body;

[0229] -Prevent or reduce the expression of one or more type I interferon-stimulated genes in the patient's body; and / or

[0230] - Induces and / or increases the expression of one or more type I interferon suppressor genes in the patient's body.

[0231] Those skilled in the art can assess the ability of type I interferon inhibitors to reduce type I interferon signaling in patients by in vitro or in vivo assays. For in vitro assays, type I interferon inhibitors can be applied to cells. In one embodiment, an in vitro method for screening type I interferon inhibitors suitable for treating or preventing pain associated with rheumatoid arthritis in patients may include: i) applying the inhibitor to sensory neurons with enhanced type I interferon signaling; and ii) detecting a reduction in type I interferon signaling.

[0232] For in vivo assays, type I interferon inhibitors can be administered to patients. This article discusses methods for detecting intracellular signal transduction of type I interferon, type I interferon levels, activation of type I interferon receptors, expression of type I interferon-stimulated genes, and expression of type I interferon-inhibiting genes.

[0233] When we say "interferon type I inhibitor blockade", we mean that interferon type I inhibitors can block (i) enhanced intracellular signaling of interferon type I in the patient, (ii) elevated levels of interferon type I in the patient, (iii) enhanced activation of interferon type I receptors in the patient, and / or (iv) increased expression of one or more interferon type I-stimulated genes in the patient.

[0234] When we say "reduction of type I interferon inhibitors", we mean that type I interferon inhibitors can reduce (i) enhanced intracellular signaling of type I interferon in patients, (ii) elevated levels of type I interferon in patients, (iii) enhanced activation of type I interferon receptors in patients, and / or (iv) increased expression of one or more type I interferon-stimulated genes in patients.

[0235] When we say "type I interferon inhibitors induce the expression of one or more type I interferon-suppressing genes in patients", we mean that type I interferon inhibitors can "turn on" or "remove the inhibition" of the expression of one or more type I interferon-suppressing genes in patients.

[0236] When we say that "type I interferon inhibitors increase the expression of one or more type I interferon suppressor genes in patients," we mean that type I interferon inhibitors can increase the expression of one or more type I interferon suppressor genes that are reduced in patients.

[0237] Preferably, the type I interferon inhibitor is selected from the group consisting of: interferon α / β receptor α chain (IFNAR1) inhibitors, interferon α / β receptor subunit 2 (IFNAR2) inhibitors, tyrosine kinase 2 (TYK2) inhibitors, type I interferon neutralizers, MAP kinase-interacting serine / threonine protein kinase (“MNK”) inhibitors (such as MNK1 and / or MNK2 inhibitors), and eukaryotic translation initiation factor 4E (eIF4E) inhibitors.

[0238] The term "type I interferon neutralizer" means that the agent can neutralize, counteract, inhibit, or block one or more type I interferons.

[0239] Suitable type I interferon inhibitors can be selected from the group including: small molecules, biological agents (such as antibodies, antibody mimics, decoy receptors, receptor bodies, vaccines).

[0240] The term "small molecule" as we use it refers to low molecular weight organic compounds. The term "biologic" as we use it refers to biological agents such as proteins and / or oligopeptides or polypeptides, enzymes, antibodies, their antibody moieties, vaccines, antibody mimics, or combinations thereof. Such antibodies may be monoclonal antibodies and can be prepared using methods known in the art. Other polyclonal or chimeric antibody formulations may also be used.

[0241] "Antibody mimic" refers to a drug that mimics an antibody (e.g., an affinity agent or other substance).

[0242] When we say "its antibody portion", we mean antibody fragments (e.g., nanobodies).

[0243] It should be understood that neutralization can be achieved by antibodies, their antibody moieties (such as rontalizumab, sifalimumab, or S95021), or interferon decoy receptors binding to type I interferons (such as interferon α and / or interferon β), thereby blocking interferon receptor binding. Neutralization can also be achieved by inducing active immunity (endogenous antibodies) against type I interferons (such as interferon α and / or interferon β) using vaccine-based methods (such as interferon α receptor agonists (IFN-K)).

[0244] IFNAR1 inhibitors

[0245] In one embodiment, the type I interferon receptor is composed of an IFNAR1 subunit and an IFNAR2 subunit.

[0246] IFNAR1 is also known as CRF2-1, IFN-R-1, IFN-α / β receptor 1, IFN α / β receptor 1, α-type antiviral protein, β-type antiviral protein, cytokine receptor class II member 1, cytokine receptor family 2 member 1, interferon (α, β, and ω) receptor 1, interferon receptor 1, interferon α / β receptor α chain, interferon β receptor 1, and type I interferon receptor 1. In humans, IFNAR1 is encoded by the IFNAR1 gene. This receptor is a membrane protein that forms one of the two chains of the receptor targeting interferon α and interferon β.

[0247] IFNAR2 is also known as IFN-α / β receptor 2, IFN α / β receptor subunit 2, human interferon α / β receptor, interferon (α, β, and ω) receptor 2, interferon α binding protein, interferon receptor, interferon α / β receptor β chain, and type I interferon receptor 2. In humans, IFNAR2 is encoded by the IFNAR2 gene. This receptor is a membrane protein that forms the other strand of the two chains that act as receptors for interferon α and interferon β.

[0248] Unbound by theory, IFNAR1 inhibitors and IFNAR2 inhibitors may have extracellular inhibitory effects (such as by inhibiting the binding of receptors to type 1 interferon) and / or intracellular inhibitory effects (such as by inhibiting activated downstream signaling of IFNAR1 or IFNAR2).

[0249] In some embodiments, type I interferon inhibitors can inhibit both IFNAR1 and IFNAR2. In some embodiments, IFNAR2 inhibitors are IFNAR2a inhibitors, IFNAR2b inhibitors, and / or IFNAR2c inhibitors.

[0250] Examples of IFNAR1 inhibitors include: anifrolumab (AstraZeneca), a human monoclonal antibody against IFNAR1 (DrugBank accession number: DB11976); and MAR1-5A3 (InVivoMAb anti-mouse IFNAR1, BioXCell), a monoclonal antibody that reacts with mouse IFNAR1.

[0251] TYK2 inhibitors

[0252] It should be understood that in humans, TYK2 is encoded by the TYK2 gene. This protein is a member of the tyrosine kinase family and associates with the IFNAR receptor. Upon binding, TYK2 phosphorylates the receptor unit, thereby activating downstream signaling.

[0253] Unbound by theory, TYK2 inhibitors can exert their effects by inhibiting association with IFNAR receptors and / or phosphorylation of these receptors, or by any other means, inhibiting downstream signaling of TYK2 activated by type I interferon.

[0254] Examples of TYK2 inhibitors include: deucravacitinib (also known as Sotyktu), an allosteric tyrosine kinase 2 (TYK2) inhibitor (Bristol Myers Squibb); brepocitinib and PF-06826647 (also known as ropsacitinib) (Pfizer Inc.); NDI-034858, NDI-031232, NDI-031301, and NDI-031407 (Nimbus Therapeutics); ESK-001 (Alumis); VTX-958 (Ventyx Biosciences); and ICP-488 (InnoCare Pharma). TYK2 inhibitors described in WO-2022175745 and WO-2022136914 (Sudo Biosciences); TYK2 inhibitors described in WO-2022104206, WO-2022011338 and WO-2022011337 (Neuron23); TYK2 inhibitors described in WO-2013125543 and WO-2013146963 (Takeda); TYK2 inhibitors described in WO-2019178079 and WO-2010010190 (AbbVie). Sareum Ltd. (Indonesia, Inc.) describes the TYK2 inhibitors in EP2634185B1, WO-2015032423, WO-2018073438, WO-2021204762, and WO-2020074461.

[0255] MNK inhibitors

[0256] It should be understood that in humans, MNK1 and MNK2 are encoded by the MKNK1 and MKNK2 genes, respectively. These proteins are members of the serine-threonine kinase family, and MNK activation is associated with the activation of the IFNAR receptor. Upon receptor binding, TYK2 phosphorylates the receptor unit, thereby activating downstream signaling and leading to the activation of MNK kinases.

[0257] Unbound by theory, MNK inhibitors can exert their effects by inhibiting MNK activity on downstream substrates or by inhibiting downstream signaling of type I interferon in any other way.

[0258] Those skilled in the art should be familiar with MNK inhibitors and / or able to identify such inhibitors.

[0259] Examples of MNK inhibitors include those described in the following literature, all of which, along with related publications, are incorporated herein by reference:

[0260] - MNK inhibitors (eFFECTOR Therapeutics) as described in WO2019079369, WO2015200481, WO2018152117, WO2017075412, WO2017075394, WO2017087808, WO2020086713, US2019152988, US2019330216, US2017266185, US2018085368, US2018085368, US2018228803, US11083727, US2019275039, and US2017266185;

[0261] - MNK inhibitors as described in WO2023278686, WO2023014943 and WO2022006331 (4E Therapeutics).

[0262] -As described in WO2013174744, WO2012163942, WO2014118226, WO2014048894, WO2013174735, WO2015181104, WO2015181063, WO2018134335, WO2017081003, WO2014118229, WO2014118135, WO2014076162, WO20 MNK inhibitors in WO2015104254, WO2015004024, WO2015074986, WO2014128093, WO2014048869, WO2013034570, WO2012156367, WO2016102427, WO2016096721, and WO2018134148 (Bayer Schering Pharma AG);

[0263] - MNK inhibitors (LifeArc) as described in WO2017085483 and WO2017085484, as well as CN108495855, EP3377501 and JP2018534314;

[0264] - MNK inhibitors as described in CN116425750 (Nuowosida Pharmaceutical Co., Ltd).

[0265] - MNK inhibitors, such as ETC-7114 and ETC-206 (the latter also known as tinodasertib, available at MedChem Express) and related compounds as described in WO2013147711, WO2014088519, WO2019013703, and WO2015050505 (Agency For Science Technology & Research Bioprocessing Technology Institute, Singapore).

[0266] - MNK inhibitors as described in CN110903286 (Shenyang Pharmaceutical University).

[0267] - As described in WO2007147874, MNK inhibitors (Swedish Orphan Biovitrum AB);

[0268] - As described in WO2007115822, WO2006136402, WO2008006547, and WO2007059905, the MNK inhibitor (Evotec (Goettingen) AG);

[0269] - MNK inhibitors as described in WO2013087581, WO2013034570, WO2012163942, WO2012175591, WO2013041634, and WO2013144189 (Bayer Intellectual Property GmbH).

[0270] - MNK inhibitors (Boehringer Ingelheim Pharma GmbH & Co KG) as described in WO2015169677, WO2015091156, WO2006066937, WO2014206922, WO2011104340, WO2015082324, WO2010023181, WO2011104338, WO2013149909, WO2011104334, WO2006066937, and US2015361055.

[0271] - MNK inhibitors as described in CN103417545 (Taicang Shengzhou Biotechnology Co., Ltd.).

[0272] - MNK inhibitors as described in WO2020155842 (Novostar Pharmaceuticals Ltd).

[0273] - As described in WO2020115072, MNK inhibitors (Instituto Ramon y Cajal de Investigacion Sanitaria);

[0274] - Such as the MNK inhibitors described in US2018244654 and WO2017075367 (Northwestern University).

[0275] - MNK inhibitors as described in WO2020233716, CN111978317, CN111978318 (Shanghai Daoshang Biology Tech Co., Ltd.).

[0276] - MNK inhibitors as described in WO2020108619 (Shanghai De Novo Pharmatech Co Ltd).

[0277] - MNK inhibitors as described in WO2017165908 and WO2023093700 (South Australian Health and Medical Research Institute and Ocean University of China).

[0278] - As described in WO2017068064, MNK inhibitors (Ryvu Therapeutics);

[0279] - As described in WO2010055072, MNK inhibitors (Friedrich Miescher Institute for Biomedical Research);

[0280] - MNK inhibitors as described in WO2018228275 (Beijing InnoCare Pharma Tech Co Ltd).

[0281] - As described in WO2021127589, MNK inhibitors (The Children's Hospital of Philadelphia);

[0282] - MNK inhibitors as described in WO2016081589 and WO2021127438 (University of Maryland).

[0283] - MNK inhibitors as described in WO2016128465 (Basilea Pharmaceutica Ltd, Allschwil).

[0284] - MNK inhibitors as described in WO2023168381 (University of Maryland).

[0285] - Such as the MNK inhibitors described in WO2021005183 (Centro de Investigacion Biomedicaen Red and Institut Quimic de Sarria and Vall d'Hebron Institut de Recerca);

[0286] - As described in US2020197400, MNK inhibitors (New York University).

[0287] - Such as the MNK inhibitors described in WO2022237682 (Jumbo Drug Bank Ltd); and

[0288] - MNK inhibitors as described in WO2022038563 (Hepagene Therapeutics (HK) Ltd).

[0289] In a preferred embodiment, the type I interferon inhibitor is an MNK inhibitor (such as an MNK1 and / or MNK2 inhibitor). Preferably, the MNK inhibitor is a small molecule, or an antibody or a portion thereof. Preferably, the MNK inhibitor is selected from the group consisting of: eFT508 (also known as tomivosertib); 4ET-03-053; BAY1143269; ETC-1907206 (also known as ETC-206 (AUM 001) and tenofostatin); and derivatives of the above compounds.

[0290] eFT508 (manufacturer: MedChemExpress, Selleck Chemicals) (described in WO2015200481 and WO2020086713) has the following formula:

[0291]

[0292] The formula for 4ET-03-053 (described in WO2023278686) is:

[0293]

[0294] The other MNK inhibitors described in WO2023278686 are:

[0295]

[0296]

[0297] Further preferred MNK inhibitors include the following formulas and their derivatives (described in WO2023278686):

[0298]

[0299]

[0300]

[0301]

[0302] Further preferred MNK inhibitors include 4ET-01-21 of the following formula and their derivatives (described in WO2022006331):

[0303]

[0304] The formula for BAY-1143269 (which is compound 806820 in WO2013034570) is:

[0305]

[0306] ETC-1907206 (also known as tenoxetine, AUM001, or ETC206, and described in WO2013147711) has the following formula:

[0307]

[0308] In some embodiments, the MNK inhibitor is the MNK inhibitor described in the following literature: Li, Q. et al., Discovery of D25, a Potent and Selective MNK Inhibitor for Sepsis-Associated Acute Spleen Injury, J. Med. Chem. 2024, 67, 4, 3167-89, which is incorporated herein by reference. For example, in some embodiments, the MNK inhibitor is compound D25 as described by Li et al.:

[0309]

[0310] In some embodiments, the MNK inhibitor is compound 7g, compound 18, or forbazol C as described by Li et al.

[0311]

[0312] In some embodiments, the MNK inhibitor is DS12881479, which is described in the following literature: Matsui, Y. et al., A novel inhibitor stabilizes the inactive conformation of MAPK-interacting kinase 1, Acta Cryst. 2018, F74, 156-60:

[0313]

[0314] MNK inhibitors of structure I and structure II

[0315] In one respect, MNK inhibitors are compounds of structure (I):

[0316]

[0317] (I)

[0318] Or a pharmaceutically acceptable salt thereof, wherein R 1a R 1b and R 3 Each of these is as defined in this document.

[0319] On the other hand, MNK inhibitors are compounds of structure (II):

[0320]

[0321] (II)

[0322] Or a pharmaceutically acceptable salt thereof, wherein R 1a R 1b R 2 X, Y, and L are as defined in this article.

[0323] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure pertains. As used in this specification and claims, unless the context clearly indicates otherwise, the singular forms “a,” “an,” and “the” include the plural references.

[0324] The following definitions apply to structures (I) and (II) and their subgenera:

[0325] "Amino" refers to the -NH2 free radical.

[0326] "Carboxy" or "carboxyl" refers to the -CO2H free radical.

[0327] "Cyano" refers to the -CN free radical.

[0328] "Hydroxy" or "hydroxyl" refers to the -OH free radical.

[0329] "Nitro" refers to the -NO2 free radical.

[0330] "Oxyto" refers to the =O substituent.

[0331] "Thiol" refers to the -SH substituent.

[0332] "Thio" refers to the =S substituent.

[0333] "alkyl" refers to a saturated, straight-chain or branched hydrocarbon radical composed only of carbon and hydrogen atoms, having one to twelve carbon atoms (C1-C2). 12 The radical consists of an alkyl group, one to eight carbon atoms (C1-C8 alkyl), or one to six carbon atoms (C1-C6 alkyl), or any value within these ranges, such as C4-C6 alkyl, and is connected to the remainder of the molecule by a single bond (e.g., methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, etc.). The carbon number mentioned refers to both the carbon backbone and carbon branches, but excludes carbon atoms belonging to any substituent. Unless otherwise specifically stated in this specification, the alkyl group is optionally substituted.

[0334] "Alkenyl" refers to an unsaturated straight-chain or branched hydrocarbon radical composed only of carbon and hydrogen atoms. This radical contains one or more carbon-carbon double bonds and has two to twelve carbon atoms (C2-C2). 12 The free radical consists of an alkenyl group (C2-C8 alkenyl) or two to eight carbon atoms (C2-C6 alkenyl), or any value within these ranges, and is connected to the remainder of the molecule by a single bond (e.g., vinyl, propenyl, butenyl, pentenyl, pent-1,4-dienyl, etc.). The carbon number mentioned refers to both the carbon backbone and carbon branches, but excludes carbon atoms belonging to any substituent. Unless otherwise specified in the specification, the alkenyl group may optionally be substituted.

[0335] The term "alkynyl" refers to an unsaturated straight-chain or branched hydrocarbon radical having 2 to 12 carbon atoms (C2-C4). 12 The alkynyl group has two to nine carbon atoms (C2-C9 alkynyl) or two to six carbon atoms (C2-C6 alkynyl), or any value within these ranges, and has at least one carbon-carbon triple bond. Examples of alkynyl groups are freely selectable from the group consisting of: ethynyl, propynyl, but-1-alkynyl, but-2-alkynyl, etc. The number of carbon atoms mentioned refers to both the carbon backbone and carbon branches, but does not include carbon atoms belonging to any substituent. Unless otherwise specified in the specification, the alkynyl group is optionally substituted.

[0336] "Alkoxy" refers to the formula -OR a free radicals, of which R a It is an alkyl group as defined above, containing one to twelve carbon atoms (C1-C2). 12Alkoxy groups, consisting of one to eight carbon atoms (C1-C8 alkoxy groups) or one to six carbon atoms (C1-C6 alkoxy groups), or any values ​​within these ranges. Unless otherwise specifically stated in the specification, the alkoxy group may optionally be substituted.

[0337] "Amino" refers to the formula -NR a R b free radicals, of which R a It is H or C1-C6 alkyl, and R b It is a C1-C6 alkyl group as defined above. Unless otherwise stated, the C1-C6 alkyl portion of the amino group may optionally be substituted.

[0338] "Aminoalkylcycloalkyl" refers to the formula –R a R b NR c R d free radicals, of which R a R is a cycloalkyl group as defined herein. b It is a C1-C6 alkyl group, R c It is H or C1-C6 alkyl, and R d It is a C1-C6 alkyl group as defined above. Unless otherwise stated, the cycloalkyl group of the aminoalkyl group and each C1-C6 alkyl moiety are optionally substituted.

[0339] "Aromatic ring" refers to a cyclic planar molecule or a portion of a molecule with resonant rings (i.e., a free radical) that exhibits increased stability relative to other arrangements of atoms with the same atomic set. Typically, aromatic rings contain covalently bonded, coplanar atomic sets and include a plurality of even-numbered but not multiples of 4 π electrons (e.g., alternating double and single bonds) (i.e., 4n + 2 π electrons, where n = 0, 1, 2, 3, etc.). Aromatic rings include, but are not limited to, phenyl, naphthylmethionine, imidazolyl, pyrrolyl, pyridyl, pyrimidinyl, pyrazinyl, pyridoneyl, pyridazinyl, and pyrimidoneyl groups. Unless otherwise specified in the specification, "aromatic ring" includes all optionally substituted free radicals.

[0340] "Aryl" refers to a group containing 6 to 18 carbon atoms (e.g., 6 to 10 carbon atoms (C6-C5)). 10 A aryl group is a carbocyclic cyclic radical consisting of an aryl group and at least one carbocyclic aromatic ring. For the purposes of embodiments of this disclosure, the aryl group is a monocyclic, bicyclic, tricyclic, or tetracyclic cyclic system, which may include fused or bridged cyclic systems. Aryl groups include, but are not limited to, aryl radicals derived from acetane, acenaphthene, phenanthrene, anthracene, azulene, benzene, benzo[a], fluoranthene, s-[a]-[b]-[b]-[c ...

[0341] As used herein, "aryl" includes fused ring systems containing a non-aromatic moiety. For example, in some embodiments, the aryl group may have one of the following structures:

[0342] ; or .

[0343] Unless otherwise specified in the specification, the aryl group may optionally be substituted.

[0344] The term "aralkyl" or "aralkyl group" refers to the group – alkyl-aryl, wherein the alkyl group and aryl group are as defined herein. The aralkyl groups of this disclosure are optionally substituted. Examples of aralkyl groups include, for example, benzyl, 1-phenylethyl, 2-phenylethyl, 3-phenylpropyl, 2-phenylpropyl, fluorenemethyl, etc.

[0345] "Cyanoalkyl" means an alkyl group containing at least one cyano substituent. The -CN substituent may be located on a primary, secondary, or tertiary carbon. Unless otherwise specified in the specification, the cyanoalkyl group may optionally be substituted.

[0346] "Carbocyclic" or "carbon ring" refers to a ring system in which each ring atom is carbon.

[0347] "Cycloalkyl" refers to a non-aromatic monocyclic or polycyclic carbocyclic radical consisting only of carbon and hydrogen atoms. This radical may include fused or bridged ring systems and has three to fifteen ring carbon atoms (C3-C4). 15 cycloalkyl groups, with three to ten cyclic carbon atoms (C3-C4). 10 The free radical consists of a cycloalkyl group or a ring of three to eight carbon atoms (C3-C8 cycloalkyl), or any value within these ranges, such as three to four carbon atoms (C3-C4 cycloalkyl), and is saturated or partially unsaturated and connected to the rest of the molecule by a single bond. Monocyclic free radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic free radicals include, for example, adamantyl, norbornyl, decahydronaphthyl, 7,7-dimethyl-bicyclo[2.2.1]heptyl, etc. Unless otherwise specifically stated in this specification, the cycloalkyl group is optionally substituted.

[0348] "alkylcycloalkyl" refers to the formula –R a R b free radical groups, of which R a It is a cycloalkyl group and R b Alkyl groups as defined above. Unless otherwise specified in the specification, alkylcycloalkyl groups may optionally be substituted.

[0349] "Fused" means any ring structure described herein that is fused with another ring structure.

[0350] "Halogenated" refers to bromine, chlorination, fluorination, or iodination.

[0351] "Haloalkyl" refers to an alkyl radical as defined above, substituted with one or more halogenated radicals as defined above, such as trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, etc. Unless otherwise specifically stated in the specification, the haloalkyl group may optionally be substituted.

[0352] "Halocycloalkyl" refers to a cycloalkyl group as defined above, substituted with one or more halogenated radicals as defined above, such as trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, etc. Unless otherwise specified in the specification, the halocycloalkyl group may optionally be substituted.

[0353] "Halogenated alkyl cycloalkyl" refers to the formula –R a R b free radical groups, of which R a It is a cycloalkyl group and R b The alkyl halogroup is as defined above. Unless otherwise specified in the specification, the alkyl halogroup may optionally be substituted.

[0354] "Halogenated cycloalkyl alkyl" refers to the formula –R a R b free radical groups, of which R a It is an alkyl group and R b The alkyl group is a halocycloalkyl group as defined above. Unless otherwise specified in the specification, the halocycloalkyl group may optionally be substituted.

[0355] "Heterocyclic cycloalkyl" refers to the formula –R a R b free radical groups, of which R a It is a cycloalkyl group and R b The heterocyclic group is as described herein. Unless otherwise specified in the specification, the heterocyclic cycloalkyl group may optionally be substituted.

[0356] "Hydroxyalkyl" refers to an alkyl radical as defined above, which is substituted with one or more hydroxyl radicals. The hydroxyalkyl radical is attached to the main chain via an alkyl carbon atom. Unless otherwise specified in the specification, the hydroxyalkyl group may optionally be substituted.

[0357] "Heterocyclic group," "heterocyclic," or "heterocyclic" refers to a 3- to 18-membered, such as 3- to 10-membered or 3- to 8-membered, non-aromatic cyclic radical having one to ten cyclic carbon atoms (e.g., two to ten) and one to six cyclic heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. Unless otherwise specified in the specification, heterocyclic radicals are partially or fully saturated and are monocyclic, bicyclic, tricyclic, or tetracyclic ring systems, which may include fused, spirocyclic, and / or bridging ring systems. The nitrogen, carbon, and sulfur atoms in the heterocyclic radical are optionally oxidized, and the nitrogen atom may optionally be quaternized. Non-limiting examples of heterocyclic units having a single ring include: diacridinyl, acridinel, urazolyl, acridinel, pyrazolyl, imidazolyl, oxazolyl, isoxazolinyl, isoxazolyl, thiazolyl, isothiazolyl, isothiazolyl, isothiazolinyloxitiazolidinone, oxazollidinone, hydantoin, tetrahydrofuranyl, pyrrolidinyl, morpholinyl, piperazinyl, piperidinyl, dihydropyranyl, tetrahydropyranyl, piperidine-2-I (valeronamide), 2,3,4,5-tetrahydro-1H-acoxenyl, 2,3-dihydro-1H-indole, and 1,2,3,4-tetrahydro-quinoline. Non-limiting examples of heterocyclic units having two or more rings include: hexahydro-1H-pyrrolazinyl, 3a,4,5,6,7,7a-hexahydro-1Hbenzo[d]imidazolyl, 3a,4,5,6,7,7a-hexahydro-1H-indolyl, 1,2,3,4-tetrahydroquinolinyl, benzodihydropyranyl, isobenzodihydropyranyl, indololinyl, isoindololinyl, and decahydro-1H-cyclooctyl[b]pyrrolyl. As used herein, "heterocyclic group" includes fused ring systems comprising additional non-heterocyclic components. For example, in some embodiments, the heterocyclic group may have one of the following structures:

[0358] ; ; or .

[0359] Unless otherwise specified in the specification, the heterocyclic groups may optionally be substituted.

[0360] "Halogenated heterocyclic group" refers to a heterocyclic group containing at least one halogenated substituent. The halogenated substituent may be located on a primary, secondary, or tertiary carbon. Unless otherwise specified in the specification, the halogenated heterocyclic group may optionally be substituted.

[0361] "Halogenated heterocyclic alkyl" refers to the formula –R a R b free radical groups, of which R a It is an alkyl group and R b The alkyl group is a halogenated heterocyclic group as described herein. Unless otherwise specified in the specification, the alkyl group may optionally be substituted.

[0362] "Heterocyclic alkyl" refers to the formula –R a R b free radical groups, of which R a It is an alkyl group and R b The heterocyclic alkyl group is as described herein. Unless otherwise specified in the specification, the heterocyclic alkyl group may optionally be substituted.

[0363] "Heteroaryl" refers to a 5- to 18-membered (e.g., 5- to 6-membered) cyclic radical comprising one to thirteen ring carbon atoms, one to six ring heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. Heteroaryl radicals can be monocyclic, bicyclic, tricyclic, or tetracyclic systems, and may include fused or bridged ring systems; and the nitrogen, carbon, or sulfur atom in the heteroaryl radical may optionally be oxidized; the nitrogen atom may optionally be quaternized. Examples include, but are not limited to, acrylonitrile, acrylonitrile, benzimidazolyl, benzothiazolyl, benzoindolyl, benzodioxacyclopentenyl, benzofuranyl, benzooxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxacycloheptyl, 1,4-benzodioxyl, benzonaphthuryl, benzooxazolyl, benzodioxacyclopentenyl, benzodioxinyl, benzopyranyl, benzopyranoneyl, benzofuranyl, benzofuranoneyl, benzothiopheneyl (benzophenylthio), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazole, cenyl, dibenzofuranyl, dibenzophenylthio, furanyl, iso Thiazolyl, imidazolyl, indazole, indolyl, indazole, isoindolyl, indololinyl, isoindololinyl, isoquinolinyl, indazinyl, isoxazolyl, naphridinyl, oxadiazolyl, 2-oxoachexenyl, oxazolyl, 1-pyridinyl oxide, 1-pyrimidinyl oxide, 1-pyrazinyl oxide, 1-pyridazinyl oxide, 1-phenyl-1H-pyrroleyl, phenazinyl, phenothiazinyl, phenothiazinyl, phthalazinyl, pteridinyl, purine, pyrroleyl, pyrazolyl, pyridinyl, pyridinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and phenylthio (i.e., thiophene). As used herein, "heteroaryl" includes fused ring systems in which a heteroatom (e.g., oxygen, sulfur, nitrogen, etc.) is not part of the aryl moiety. For example, in some embodiments, a heteroaryl may have the following structure:

[0364]

[0365] Unless otherwise specifically stated in the specification, the heteroaryl groups may optionally be substituted.

[0366] Non-limiting examples of heteroaryl rings containing a single ring include: 1,2,3,4-tetrazolyl, [1,2,3]triazolyl, [1,2,4]triazolyl, triazinyl, thiazolyl, 1H-imidazolyl, oxazolyl, furanyl, thiophene, pyrimidinyl, 2-phenylpyrimidinyl, pyridinyl, 3-methylpyridinyl, and 4-dimethylaminopyridinyl. Non-limiting examples of heteroaryl rings containing two or more fused rings include: benzofuranyl, benzothiopheneyl, benzoxazolyl, benzothiazolyl, benzotriazolyl, cyclolinyl, naphridyl, phenanthridineyl, 7H-purinyl, 9H-purinyl, 6-amino-9H-purinyl, 5H-pyrrolo[3,2-d]pyrimidinyl, 7H-pyrrolo[2,3-d]pyrimidinyl, pyrido[2,3-d]pyrimidinyl, 2-phenylbenzo[d]thiazolyl, 1H-indolyl, 4,5,6,7-tetrahydro-1-H-indolyl, quinoxalinyl, 5-methylquinoxalinyl, quinazolinyl, quinolinyl, 8-hydroxy-quinolinyl, and isoquinolinyl.

[0367] A non-limiting example of a heteroaryl group as described above is a C1-C5 heteroaryl having 1 to 5 carbon ring atoms and at least one additional ring atom (preferably 1 to 4 additional ring atoms that are heteroatoms) independently selected from nitrogen (N), oxygen (O) or sulfur (S). Examples of C1-C5 heteroaryl groups include, but are not limited to, triazinyl, thiazolyl-2-yl, thiazolyl-4-yl, imidazole-1-yl, 1H-imidazolyl-2-yl, 1H-imidazolyl-4-yl, isoxazoline-5-yl, furan-2-yl, furan-3-yl, thiophene-2-yl, thiophene-4-yl, pyrimidin-2-yl, pyrimidin-4-yl, pyrimidin-5-yl, pyridin-2-yl, pyridin-3-yl, and pyridin-4-yl.

[0368] Unless otherwise specified, when two substituents together form a ring with a specified number of ring atoms (e.g., two R groups together with the nitrogen (N) to which they are attached form a ring with 3 to 7 ring members), the ring may have a carbon atom and optionally one or more (e.g., 1 to 3) other heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). The ring may be saturated or partially saturated and may optionally be substituted.

[0369] For the purposes of this disclosure, fused ring units containing a single heteroatom, as well as spirocyclic, bicyclic, and the like, will be considered to belong to the ring family corresponding to the heteroatom-containing ring. For example, 1,2,3,4-tetrahydroquinoline has the following formula:

[0370]

[0371] For the purposes of this disclosure, it is considered a heterocyclic unit. 6,7-Dihydro-5H-cyclopentanepyrimidine has the following formula:

[0372]

[0373] For the purposes of this disclosure, it is considered a heteroaryl unit. When the fused ring unit contains heteroatoms in both the saturated ring and the aryl ring, the aryl ring will dominate and determine the type of ring class. For example, 1,2,3,4-tetrahydro-[1,8]naphthidine has the following formula:

[0374]

[0375] For the purposes of this disclosure, it is considered to be a heteroaryl unit.

[0376] Whenever a term or any of its prefix roots appears in the name of a substituent, that name shall be interpreted to include the limitations provided herein. For example, whenever the term “alkyl” or “aryl” or any of its prefix roots appears in the name of a substituent (e.g., aralkyl, alkylamino), that name shall be interpreted to include the limitations given above for “alkyl” and “aryl”.

[0377] The term "substituted" is used throughout this specification. The term "substituted" is defined herein as a portion in which one or more hydrogen atoms are replaced by one or more (e.g., 1 to 10) substituents as defined below, whether acyclic or cyclic. Substituents are capable of replacing one or two hydrogen atoms in a single portion at a time. Additionally, these substituents can replace two hydrogen atoms on two adjacent carbons to form the substituent, a new portion, or a unit. For example, substituted units requiring a single hydrogen atom replacement include halogens, hydroxyl groups, etc. Replacement of two hydrogen atoms includes carbonyl groups, oxime groups, etc. Replacement of two hydrogen atoms from adjacent carbon atoms includes epoxy groups, etc. Throughout this specification, the term "substituted" is used to indicate that a portion is such that one or more hydrogen atoms in the hydrogen atom can be replaced by substituents. When a portion is described as "substituted," any number of hydrogen atoms can be replaced. For example, difluoromethyl is a substituted C1 alkyl group; trifluoromethyl is a substituted C1 alkyl group; 4-hydroxyphenyl is a substituted aromatic ring; (N,N-dimethyl-5-amino)octyl is a substituted C8 alkyl group; 3-guanidinopropyl is a substituted C3 alkyl group; and 2-carboxypyridyl is a substituted heteroaryl group.

[0378] The variable groups defined herein, such as alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, aryloxy, aryl, heterocyclic, and heteroaryl groups as defined herein, may be optionally substituted, whether used alone or as part of another group. Optionally substituted groups are indicated as follows.

[0379] The compounds of this disclosure (i.e., compounds of structure (I) or (II)) or their pharmaceutically acceptable salts may contain one or more geometrically asymmetric centers and thus may produce stereoisomers, such as enantiomers, diastereomers, and other stereoisomeric forms, which are defined according to absolute stereochemistry as (R)- or (S)-, or for amino acids as (D)- or (L)-. Therefore, the examples encompass all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)- or (D)- and (L)- isomers can be prepared using chiral synthons or chiral reagents or resolved using conventional techniques, such as chromatography and fractional crystallization. Conventional techniques for preparing / separating individual enantiomers involve chiral synthesis from suitable optically pure precursors or resolution of racemates (or racemates of salts or derivatives) using, for example, chiral high-performance liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other geometrically asymmetric centers, it is intended that these compounds include both E and Z geometric isomers, unless otherwise stated. Similarly, all tautomer forms are intended to be included.

[0380] Embodiments of this disclosure include all forms of rotational isomers and conformationally restricted states of the compounds of this disclosure. Transisomers are also included, which are stereoisomers resulting from hindered rotation around a single bond, wherein an energy difference due to steric strain or other contributors creates a rotation barrier sufficiently high to allow the separation of individual conformational isomers. For example, certain compounds of this disclosure may exist as mixtures of transisomers, or the presence of a single transisomer may be purified or enriched.

[0381] In some embodiments, the compound of structure (I) or (II) is a mixture of enantiomers or diastereomers. In other embodiments, the compound of structure (I) or (II) is essentially a single enantiomer or diastereomer.

[0382] "Tautomerism" refers to a proton shift from one atom of a molecule to another atom of the same molecule. Therefore, the embodiments include tautomers of the disclosed compounds.

[0383] In some embodiments, the MNK inhibitor has the following structure (Ia):

[0384]

[0385] (Ia)

[0386] Or its pharmaceutically acceptable salt, wherein:

[0387] R 1a and R1b Each is independently an alkyl group. In some embodiments, R 1a and R 1b They are the same. In some embodiments, R 1a and R 1b They are different. R 1a or R 1b It can be an alkyl group, such as methyl, ethyl, propyl, isopropyl, or tert-butyl. R 1a or R 1b The substituent groups can be the same alkyl group or different alkyl groups. For example, R 1a It can be a methyl group, while R 1b It can be an ethyl group. As another example, R... 1a It can be an isopropyl group, and R 1b It can be a tert-butyl group. Substituent R can be used. 1a or R 1b Any combination of alkyl groups.

[0388] In some embodiments, R 1a and R 1b The links are connected to form a ring-like portion. In some embodiments, the compound has the following structure (Ib):

[0389]

[0390] (Ib)

[0391] Or a pharmaceutically acceptable salt thereof, wherein: R 1a and R 1b They can be connected together to form ring A.

[0392] Structure (Ib), Substituent R 1a or R 1b Together, they can form a cyclic compound represented as cyclic moiety A. For example, cyclic moiety A of structure (Ib) may include a five-membered ring. Cyclic moiety A of structure (Ib) can be an unsubstituted cyclic compound. For example, cyclic moiety A can be an unsubstituted five-membered ring, such as cyclopentane. Alternatively, cyclic moiety A of structure (Ib) may have one or more alkyl substitutions. For example, alkyl substitutions on cyclic moiety A may include methyl, ethyl, propyl, isopropyl, cyclopropyl, or tert-butyl groups. The substituted position can be the 2-, 3-, 4-, or 5-position of cyclopentane. The degree of substitution can include monosubstituted, disubstituted, trisubstituted, or tetrasubstituted. For example, cyclic moiety A can be 2,2,5,5-tetramethylcyclopentane. Synthetic routes can be used to install different substitution modes on the cyclopentane ring. For example, cyclic moiety A can be 3,3,4,4-tetramethylcyclopentane.

[0393] Additionally, cyclic moiety A may have a fused ring. A portion of cyclic moiety A may include a fused benzene ring. For example, cyclic moiety A may include a benzene ring fused with a cyclopentyl or cyclohexyl ring. For example, a synthetic route for preparing a benzene-fused cyclohexyl compound may involve the use of 1-tetrahydronaphthone. Furthermore, cyclic moiety A may include a cyclopentyl or cyclohexyl ring fused with other cyclic structures.

[0394] Cyclic moiety A may include a six-membered ring. Cyclic moiety A may be an unsubstituted cyclic moiety. For example, cyclic moiety A may be an unsubstituted six-membered ring, such as cyclohexane. Additionally, cyclic moiety A may have one or more alkyl substitutions. For example, alkyl substitutions on cyclic moiety A may include methyl, ethyl, propyl, isopropyl, cyclopropyl, or tert-butyl groups. Cyclic moiety A may have one or more heteroatom-containing substituents, such as alcohols, sulfonamides, or carboxylic acids. The substituted position may be the 2-, 3-, 4-, 5-, or 6-position of cyclohexane. The degree of substitution may include monosubstituted, disubstituted, trisubstituted, or tetrasubstituted. For example, cyclic moiety A may be 3,5-dimethylcyclohexane. Synthetic routes can be used to install different substitution modes on the cyclohexane ring. For example, cyclic moiety A may be 2,3,4,5,6-pentamethylcyclohexane.

[0395] Cyclic moiety A may include a heterocyclic compound. A heterocyclic compound is a cyclic compound having atoms of at least two different elements, such as carbon and oxygen atoms. For example, cyclic moiety A may be tetrahydropyran. Tetrahydropyran includes one oxygen atom and five carbon atoms in a six-membered ring. The heterocyclic compound may be further substituted with different degrees of substitution via alkyl substituents or functional groups at different positions. It should be noted that although some structures shown in this disclosure include oxygen atoms in the cyclic compound, such structures are provided for illustrative purposes only. Synthetic routes may be used to mount different heteroatoms in the cyclic compound. For example, cyclic moiety A of structure (Ib) may include piperidine (nitrogen atom), phosphonate (phosphorus atom), silane (silicon atom), or thiane (sulfur atom).

[0396] Cyclic moiety A may be unsaturated. Unsaturated cyclic compounds may include aromatic cyclic compounds such as benzene, pyridine, diazine, oxazine, dioxin, or thiazine. Alternatively, cyclic moiety A may be saturated.

[0397] Cyclic moiety A may have one or more functional groups substituted. For example, the functional group may include a hydroxyl group, an amine, an amide, a carboxylic acid, an ether, or a sulfonamide. Thus, cyclic moiety A may include 4-hydroxycyclohexane, 4-carboxylic acidcyclohexane, 4-methoxycyclohexane, or 4-alkylsulfonamidecyclohexane. The substituted position may be 2-, 3-, 4-, 5-, or 6-position of cyclohexane. The degree of substitution may include mono, di, tri, tetra, or penta-substituted. One or more functional groups may be mounted on the heterocyclic compound at various substitution positions and degrees.

[0398] Substituent R in structures (Ia) and (Ib) 2 It may include nitrogen-containing functional groups. For example, substituent R 2 The nitrogen-containing functional groups may include amides, amidines, amines, amine oxides, azo compounds, carbamates, carbodiimides, enamines, aromatic heterocycles, non-aromatic heterocycles, hydrazones, isohydroxamic acids, imides, imides, nitriles, sulfonamides, or ureas. For example, aromatic heterocycles may include pyrrole, imidazole, pyrazole, thiazole, pyridine, pyridazine, pyrimidine, pyrazine, or triazine. Substituent R 2 The nitrogen-containing functional group may be unsubstituted or substituted. For example, pyridazine may be substituted with an amine group at the 3-position, as shown in 4ET-004-006 below. In another case, pyridazine may be substituted with an amide containing a cyclopropyl ring at the 3-position, as shown in 4ET-004-003 below. The degree and position of substitution on the nitrogen-containing functional group can vary. Substituent R 2 Nitrogen-containing functional groups can be generated via -C n H 2n - indicates an alkyl chain connection, where n is between zero and five. At this point, the substituent R... 2 The nitrogen-containing functional groups and the main chain structures (Ia) and (Ib) are separated by n carbon atoms.

[0399] Substituent R in structures (Ia) and (Ib) 2 It may include aromatic heterocycles. For example, in some embodiments, the substituent R 2 It may include a 4-aminopyrimidine moiety. In some specific embodiments, the compound is a compound with structure (Ic):

[0400]

[0401] (Ic)

[0402] Or a pharmaceutically acceptable salt thereof, wherein: R 3 It may include amines.

[0403] In some embodiments, the amine is a primary amine. In some embodiments, R 3 It is –NH2.

[0404] In some embodiments, R 3 It may include secondary amines. When the amine is a secondary amine, R 3 It may further include a functional group at one end. For example, the functional group may include a hydroxyl group, a sulfonamide, a carboxylic acid, an ester, an amine, an amide, a morpholine, a piperazine, or a thiomorpholine. The secondary amine and the functional group may be connected via a -C... n H 2n - indicates an alkyl chain linkage, where n is between one and five. Therefore, the substituent R... 3The secondary amine and its functional group can be separated by n carbon atoms. For example, a secondary amine linked to a hydroxyl group separated by carbon atoms forms an amino alcohol (HO-C2H4NH-), as shown in examples 4ET-02-001, 4ET-03-004, 4ET-03-007, and 4ET-03-011 below. As another example, a secondary amine linked to a sulfonamide group separated by two carbon atoms forms an aminosulfonamide (CH3SO2NHC2H4NH-), as shown in examples 4ET-02-004, 4ET-03-012, 4ET-03-013, and 4ET-03-014 below.

[0405] Substituent R 3 Amines can include tertiary amines. Substituent R 3 Tertiary amines can be cyclic. Substituent R 3 The cyclic tertiary amine can be part of a saturated five-membered ring or a six-membered ring. For example, the substituent R in a saturated five-membered ring 3 The cyclic tertiary amine can be pyrrolidine, imidazoline, or pyrazoleline. The substituent R in the saturated six-membered ring... 3 The cyclic tertiary amines can be piperidine or piperazine.

[0406] The tertiary amine may further include a functional group at one end. For example, the functional group may include a hydroxyl group, a sulfonamide, a carboxylic acid, an ester, an amide, an amine, a morpholine, a piperazine, or a thiomorpholine. The tertiary amine and the functional group may be connected via a -C... n H 2n - indicates an alkyl chain linkage, where n is between one and five. Therefore, the substituent R... 3 The tertiary amine and its functional groups can be separated by n carbon atoms.

[0407] Substituent R 3 Tertiary amines can be cyclic. Substituent R 3 Cyclic tertiary amines can be part of an unsaturated five-membered or six-membered ring. For example, the substituent R in an unsaturated five-membered ring 3 The cyclic tertiary amine can be pyrazole, imidazole, or oxazole. The substituent R in the unsaturated six-membered ring... 3 The cyclic tertiary amines can be pyridine, diazine, triazine or oxazine.

[0408] Substituent R 3 Amines may also include amide groups. Substituent R 3 The amide group may further include a functional group at one end. For example, the functional group may include hydroxyl, sulfonamide, carboxylic acid, ester, amine, amide, morpholine, piperazine, or thiomorpholine.

[0409] Substituent R 3 The amide and functional group can be connected via -C n H 2n- indicates an alkyl chain connection, where n is between zero and five. Therefore, the substituent R 3 The amide and functional group can be separated by n carbon atoms. For example, amides connected to a morpholine group via a methylene group form morpholine amides, as shown in Examples 4ET-02-007, 4ET-03-027, and 4ET-03-028 below. Amides connected to a morpholine group via two methylene groups form morpholine amides, as shown in Example 4ET-02-031 below. Substituent R 3 The amide can also be directly linked to one of the functional groups.

[0410] Substituent R 3 Amides can be directly linked to cyclic structures. For example, substituent R 3 The amide can be directly attached to cyclopropane. In this case, there is no carbon atom between the amide and cyclopropane. The amide group having a direct attachment to cyclopropane acts as a substituent R. 3 A portion of the structure includes the following 4ET-02-003, 4ET-02-009, 4ET-02-010, 4ET-02-011, 4ET-02-012, 4ET-02-016, 4ET-03-002, 4ET-03-009, 4ET-03-017, 4ET-03-019, 4ET-03-020, 4ET-03-023, 4ET-03-026, 4ET-03-034, and 4ET-04-003. Cyclopropanes may be unsubstituted or substituted with one or more functional groups. For example, substituted cyclopropanes may include fluorine, hydroxyl, hydroxymethylene, alkyl, carboxylic acid, amine, aminomethylene, ester, ether, amide, sulfonamide, morpholine, piperazine, or thiomorpholine groups linked to the cyclopropane ring. The functional group attached to cyclopropane can be substituted at the 1-, 2-, or 3-position. The functional group attached to cyclopropane may have an additional alkyl chain (-C) between the functional group and the cyclopropane. n H 2n -), where n is between zero and 5. When n equals zero, there is no methylene group between the functional group and the cyclopropane. Therefore, the functional group can be directly connected to the cyclopropane at the 1-, 2-, or 3-position. Similarly, when n equals one, there is a methylene group between the functional group and the cyclopropane. In this case, the functional group is one carbon atom away from the cyclopropane, which provides additional degrees of freedom for the structure. An amide group having a direct connection to the substituted cyclopropane is used as a substituent R. 3 A portion of the structure includes 4ET-02-009, 4ET-02-010, 4ET-02-011, 4ET-02-012, 4ET-02-016, 4ET-03-019, 4ET-03-020, 4ET-03-023, 4ET-03-026 and 4ET-03-034 below.

[0411] Substituent R 3 The amide can be directly attached to cyclobutane. In this case, there is no carbon atom between the amide and cyclobutane. The cyclobutane may further have functional groups. For example, the functional groups may include hydroxyl, alkyl, carboxylic acid, amine, ester, ether, amide, sulfonamide, morpholine, piperazine, or thiomorpholine. The substituted positions of the functional groups on the cyclobutane can be 1-, 2-, 3-, or 4-positions. The functional group may have an additional alkyl chain (C-) between it and the cyclobutane. n H 2n ), where n is between zero and 5.

[0412] Cyclic structures linked to amides via alkyl chains or directly to amides may include at least one heteroatom to form heterocyclic compounds. Heterocyclic compounds may include three-membered rings having one heteroatom or four-membered rings having one heteroatom. For example, a three-membered ring having one heteroatom may include azirropropane or ethylene oxide. As another example, a four-membered ring having one heteroatom may include azirrobutane or oxobutane. Azirrobutane directly linked to an amide is illustrated, for example, in 4ET-02-017 below. As described above, functional groups may be linked to heterocyclic compounds. For ethylene oxide (epoxides), the Sharpless epoxidation reaction can be used to generate chiral epoxides.

[0413] While the examples herein only have monosubstituted cyclic structures, such configurations are provided for illustrative purposes only. Embodiments of this disclosure also include bisubstituted cyclic structures. For example, a total of two amine groups may be attached to cyclopropane; the first amine group may be attached to the 1-position of cyclopropane, and the second amine group may be attached to the 2-position of cyclopropane.

[0414] Substituent R 3 The amide can be a reverse amide. The substituent R, which is directly linked to the structure (Ic), replaces the substituent R. 3 The nitrogen atom of the amide, the substituent R 3 The carbon atom of the amide can be attached to the structure (Ic). An example of a reverse amide attached to the structure (Ic) is shown in 4ET-03-024 below. This includes substituents R. 3The amide groups in the above-described embodiments of this disclosure can also be replaced with reverse amides. For example, the amide groups in examples such as 4ET-02-003, 4ET-02-009, 4ET-02-010, 4ET-02-011, 4ET-02-012, 4ET-02-016, 4ET-03-002, 4ET-03-009, 4ET-03-017, 4ET-03-019, 4ET-03-020, 4ET-03-023, 4ET-03-026, 4ET-03-034, 4ET-04-003, 4ET-02-007, 4ET-03-027, 4ET-03-028, and 4ET-02-031 can be replaced with reverse amides.

[0415] The structure (Ic) may be equipped with substituent R. 3 Amide analogues. For example, a thioamide group may be used instead of the amide group shown in 4ET-02-013 below. Similar to amide substituents, the thioamide group may be replaced by a reverse thioamide. In this case, the substituent R directly connected to structure (Ic) is replaced. 3 The nitrogen atom of the thioamide, the substituent R 3 The carbon atoms of the thioamide can be linked to the structure (Ic).

[0416] In addition, substituent R 3 Other amide analogs can be used in structure (Ic). For example, a urea group can be used instead of the amide group shown below in 4ET-02-015. As another example, a thiourea group can be used instead of the amide group. As a substituent R 3 Some of the amides, reverse amides, thioamides, reverse thioamides, ureas, and thioureas are interchangeable in the structure (Ic).

[0417] In some MNK inhibitors disclosed herein, the 4-aminopyrimidine moiety in structure (Ic) may be modified. The pyrimidine moiety shown in structure (Ia) or (Ib) and the parent structure are linked via an amine linker (-NH-) in structure (Ic). The amine linker may be extended. For example, the amine linker may include an additional alkyl chain (-C-) between the amine and the pyrimidine moiety. n H 2n -), where n is between one and five. For example, an additional carbon atom (n=1) can be added, such that the amine linker and pyrimidine are one carbon atom apart from the parent structure, as shown in 4ET-04-004, which gives structure (Ic) more structural flexibility via an additional degree of freedom. The one-carbon extension between the amine and pyrimidine moieties, i.e., the insertion of a methylene unit, provides the benzylpyrimidine moieties. As another example, the amine linker can include an additional alkyl chain (-C) between the amine and the parent structure as shown in structures (Ia) or (Ib). n H2n -), where n is between one and five. For example, an additional carbon atom (n = 1) can be added, as shown in 4ET-04-015, such that the amine link and the parent structure as shown in structures (Ia) or (Ib) are one carbon atom apart from the parent structure. The one-carbon extension between the amine and structures (Ia) or (Ib), i.e., the insertion of a methylene unit, provides the methylaminopyrimidine moiety. In this respect, methylene units can be added to both sides of the amine link in structure (Ic). The amine link extension with additional methylene units can be used in conjunction with any of the other variants of structures (Ia), (Ib), and (Ic) disclosed herein.

[0418] Additionally, the pyrimidine moiety in structure (Ic) can be modified to replace different unsaturated six-membered rings with two nitrogen-atom isomers, such as 1,2-diazine (pyridazine) or 1,4-diazine (pyrazine). For example, 1,2-diazine (pyridazine) can be used instead of 1,3-diazine (pyrimidine) in structure (Ic) shown in Examples 4ET-04-003 and 4ET-04-006 below. These modifications can be used in combination with any of the other variants of structures (Ia), (Ib) and (Ic) disclosed herein.

[0419] The pyrimidine in structure (Ic) can be replaced by a five-membered heterocyclic compound. A pyrimidine is a six-membered heterocyclic compound having two nitrogen atoms. Generally, five-membered heterocyclic compounds have different chemical and physical properties than six-membered heterocyclic compounds. Some MNK inhibitors disclosed herein can utilize this difference between five- and six-membered heterocyclic compounds. For example, a five-membered heterocyclic compound may include nitrogen and sulfur atoms. For example, a five-membered heterocyclic compound having N and S may include thiazoles, as shown in Example 4ET-04-001 below. As another example, a five-membered heterocyclic compound having S may include thiophene. A five-membered heterocyclic compound may include nitrogen and oxygen atoms. For example, a five-membered heterocyclic compound having N and O may include oxazoles or isoxazoles. In yet another example, a five-membered heterocyclic compound may include two nitrogen atoms. For example, a five-membered heterocyclic compound having two nitrogen atoms may include imidazoles or pyrazoles. These modifications may be used in combination with any of the other variations of structures (Ia), (Ib), and (Ic) disclosed herein.

[0420] As an example of how the various modifications disclosed herein can be combined with each other, an amine linker having an additional carbon atom can be attached to a pyridazine moiety, and the pyridazine moiety can be attached to a pyridone skeleton using an amine or sulfonamide. As another example, an amine linker having an additional carbon atom can be attached to a pyridazine moiety, and the pyridazine moiety can be directly attached to an amino group.

[0421] In some MNK inhibitors of this disclosure, the 4-aminopyrimidine moiety and the parent structure, such as the pyridone moiety in structure (Ic), may be linked via other nitrogen-containing linkers. The pyrimidine moiety shown in structures (Ia) or (Ib) and the parent structure are linked via an amine linker (-NH-) in structure (Ic). Examples of this disclosure can be configured to mount an amide group between the 4-aminopyrimidine moiety and the parent structure. This can be synthesized using starting materials containing an amide via Buchwald-Hartwig amination. For example, the resulting MNK inhibitor may include an amide as shown in Example 4ET-04-013 or a reverse amide as shown in Example 4ET-04-014 below between the 4-aminopyrimidine moiety and the parent structure.

[0422] Furthermore, embodiments of this disclosure can be configured to mount a sulfonamide group between the 4-aminopyrimidine moiety and the parent structure. This can be synthesized via Buchwald-Hartwig amination using starting materials containing a sulfonamide. Another approach involves using a sulfonyl chloride reagent or intermediate. For example, the resulting MNK inhibitor may include a sulfonamide as shown in Examples 4ET-04-010 and 4ET-04-011 or a reverse sulfonamide as shown in Example 4ET-04-012 below between the 4-aminopyrimidine moiety and the parent structure.

[0423] Additionally, embodiments of this disclosure can be configured to mount an ether group between the 4-aminopyrimidine moiety and the parent structure. This can be synthesized using an alcohol-containing starting material via Buchwald-Hartwig amination. Another approach involves using an alcohol-containing starting material in a Ullmannian coupling reaction.

[0424] Substituent R of structure (Ic) 1a or R 1b It can be an alkyl group, as discussed above in structure (Ia). Alternatively, the substituent R in structure (Ic) 1a or R 1b Together they can form cyclic compounds represented as ring structure A. A detailed discussion of ring structure A in structure (Ib) also applies to structure (Id):

[0425]

[0426] (Id)

[0427] Or a pharmaceutically acceptable salt thereof, wherein: R 3 It may include amines.

[0428] One embodiment provides an MNK inhibitor having the following structure (II):

[0429]

[0430] (II)

[0431] Or its pharmaceutically acceptable salt, wherein:

[0432] R 1a It is a C1-C6 alkyl or aryl group;

[0433] R 1b It is a C1-C6 alkyl or aryl group.

[0434] Or R 1a and R 1b They are linked together with the carbon atoms to form cycloalkyl, cycloalkenyl, heterocyclic, aryl, or heteroaryl groups;

[0435] R 2 For –NHR 3a –NHC(=O)R 3b –NHC(=S)R 3b Or –C(=O)R 3c ;

[0436] R 3a It is hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, each of which is optionally substituted by one or more substituents selected from the group consisting of: hydroxyl, C3-C6 cycloalkyl, -NHS(O)2CH3, heterocyclic, -C(=O)OH, -C(=O)N(R 3d )R 3d or -N(R) 3d )R 3d ;

[0437] R 3b It is a C1-C6 alkyl, C3-C6 cycloalkyl, or heterocyclic group, each of which is optionally substituted by one or more substituents selected from the group consisting of: hydroxyl, halogen, C1-C6 alkyl, C3-C6 cycloalkyl, -NHS(O)2CH3, -N(R 3d )R 3d Heterocyclic groups, -C(=O)OH, -C(=O)N(R) 3d )R 3d , -NHC(=O)CH3, -CH2C(=O)OH,

[0438] R 3c -N(R) 3d )R 3d Or heterocyclic group;

[0439] R 3d Each time it appears, it is independently hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl;

[0440] L is –NH– or –CH2NH–; and

[0441] X is N and Y is CH, or X is CH and Y is N.

[0442] In some embodiments, when R 1a and R 1b Both are –CH3 or when R 1a and R 1b When linked to form a 5- or 6-membered cycloalkyl or heterocyclic group, then R 2 It does not have the following structure:

[0443] –NH2 or .

[0444] In some embodiments, R 1a It is a C1-C6 alkyl group. In some embodiments, R 1a It is methyl. In some embodiments, R 1a 4-Aryl. In some embodiments, R 1a It is a phenyl group.

[0445] In some specific embodiments, R 1b It is a C1-C6 alkyl group. In some embodiments, R 1b methyl. In some embodiments, R 1a and R 1b Together with the carbon atoms to which they are attached, they form a cycloalkyl group. In more specific embodiments, the cycloalkyl group is cyclopentyl or cyclohexyl. In some embodiments, R 1a and R 1b Together with the carbon atoms to which they are attached, they form a cycloalkenyl group. In some embodiments, the cycloalkenyl group is cyclopentenyl, cyclohexenyl, or cycloheptenyl. In certain specific embodiments, R 1a and R 1b They are linked together with the carbon atoms to form heterocyclic groups. In some specific embodiments, R 1a and R 1b It is linked together with the carbon atoms to both of them to form an aryl group. In some embodiments, R 1a and R 1b They are linked together with the carbons to which they are attached to form heteroaryl groups.

[0446] In more specific embodiments, the compound has one of the following structures:

[0447] ; ; ; ; ; ; or ,

[0448] Or its pharmaceutically acceptable salt, wherein:

[0449] Indicates a double bond or a single bond;

[0450] R 4 Each time it appears, it is independently C1-C6 alkyl, C3-C6 cycloalkyl, halo, haloalkyl, hydroxyl, -NHS(O)2CH3 or -C(O)OH.

[0451] Or two Rs 4 They are linked together with the carbon atoms attached to both of them to form cycloalkyl groups;

[0452] W is either N or O;

[0453] Z is either C or O; and

[0454] n can be 0, 1, 2, 3, or 4.

[0455] In some embodiments, n is 0, 1, or 2. Only one position is depicted as a double bond, and the rest are single bonds. In some embodiments, the compound has the following structure:

[0456] or .

[0457] In some more specific embodiments, the compound has the following structure:

[0458] or .

[0459] In some embodiments, the compound has one of the following structures:

[0460] ; or .

[0461] In a more specific embodiment, R 2 For –NHR 3a In a more specific embodiment, R 2 A structure having one of the following structures:

[0462] -NH2; ; ; ; ; or .

[0463] In some embodiments, R 2 For –NHC(=O)R 3b In a more specific embodiment, R 2 A structure having one of the following structures:

[0464] ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; or .

[0465] In some embodiments, R 2 For –NHC(=S)R 3b In some embodiments, R 2 It has the following structure:

[0466] .

[0467] In some embodiments, R 2 For –C(=O)R 3c In some embodiments, R 2 A structure having one of the following structures:

[0468] -NH2; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; ; or .

[0469] In some specific embodiments, R 2 A structure having one of the following structures:

[0470] -NH2 or .

[0471] In some embodiments, X is CH and Y is N. In some embodiments, X is N and Y is CH. In some embodiments, L is –NH–. In more embodiments, L is –CH2NH–.

[0472] In some embodiments, R 3a It is a branched C1-C6 alkyl group. In some embodiments, R 3a It is isopropyl.

[0473] In the various embodiments, the compounds have one of the structures listed in Table 1 below, or a pharmaceutically acceptable salt thereof. The compounds in Table 1 are prepared as described in WO 2022006331 and / or by methods known in the art.

[0474] Table 1.

[0475]

[0476] MNK inhibitors of formula (I') and formula (IA):

[0477] In some embodiments, the MNK inhibitor is a compound of formula (I'): Formula (I')

[0478] Or its pharmaceutically acceptable salt, wherein:

[0479] R 1 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl;

[0480] R 2' Choose from the following groups: , , , , , , , , , , , , , , and ;

[0481] R 3' Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl;

[0482] R 1c and R 1d Together they form a 3- to 7-membered ring having 0 to 2 heteroatoms selected from the group consisting of: N, O, and S, wherein the 3- to 7-membered ring may be further optionally substituted by one or more substituents selected from the group consisting of: halogenated, oxo-substituted, C-substituted. 1-6 Alkyl, R 8 and –C(=O)OR 9 ;

[0483] Z 1 and Z 2 Each is an independent direct key or –{C(R) 4a (R) 4b )} p –Y 1 –; where p is 0, 1, 2, 3, 4 or 5, Y 1 For direct keys, –O– or –N(R) 8 )–;

[0484] R 4a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl); or two R 4a It connects with two adjacent carbons to form a direct bond;

[0485] R 4b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0486] R 5 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0487] R 6 Choose the group consisting of the following: hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0488] R 6a Choose from the group consisting of: -(CO)C1-6 alkyl, -(CO)C 3-7 Branched alkyl, -(CO)C1-6 hydroxyalkyl, , , , , , , , , and ;

[0489] q can be 1, 2, 3, 4, 5, or 6;

[0490] e is 1, 2, 3, 4, 5, or 6;

[0491] X 2 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, C 1-6 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 alkyl), N(C) 1-6 Alkyl)2, C 1-5 (COOH), C 1-6 (NHSO2Me);

[0492] X 3 Choose the group consisting of the following: hydrogen, halogens, C 1-5 Alkyl, C 3-7 Branched alkyl, C 1-5 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-5 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-5 Alkoxy, C 3-7 Branched alkoxy groups, C 1-5 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 alkyl), N(C) 1-6 Alkyl)2, COOH, C 1-5 (COOH), NHSO2Me, C 1-5 (NHSO2Me);

[0493] R 7 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0494] R 8 Choose the group consisting of the following items: C 1-6 Alkyl, C1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, CO(C) 1-6 Alkyl), CO(C) 3-7 Branched alkyl groups), SO2 (C 1-6 Alkyl groups and SO2 (C 3-7 Branched alkyl groups);

[0495] R 9 Choose the group consisting of the following items: hydrogen, C 1-6 Alkyl and aralkyl.

[0496] In a more specific embodiment, the MNK inhibitor is a pyridine-1,5-dione of formula (IA):

[0497]

[0498] Or its pharmaceutically acceptable salt, wherein:

[0499] Z 1 Choose from the following groups: and ;

[0500] R 1 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl;

[0501] R 2' Choose from the following groups: , , , , , , , , , , , , , , and ;

[0502] R 3' Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl;

[0503] R 4a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0504] R 4b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0505] R 4c Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0506] R 4d Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0507] R 4e For hydrogen, halogen, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Halogenated alkyl groups and C 3-7 Branched haloalkyl groups;

[0508] R 4f For hydrogen, halogen, C 1-6 Alkyl, C 3-7 Branched alkyl, C1-6 Halogenated alkyl groups and C 3-7 Branched haloalkyl groups;

[0509] R 1c and R 1d Together they form optionally substituted 3- to 7-membered rings, which optionally contain X. 1 Group;

[0510] X 1 Choose from the following groups: CF2, CHCO2R 12 , O, NH, NR 8 and SO2;

[0511] m is 0, 1, or 2;

[0512] n 1 It can be 1, 2, or 3;

[0513] R 5 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0514] R 6 Choose the group consisting of the following: hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0515] R 6a Choose from the group consisting of: -(CO)C1-6 alkyl, -(CO)C 3-7 Branched alkyl, -(CO)C1-6 hydroxyalkyl, , , , , , , , , and ;

[0516] q can be 1, 2, 3, 4, 5, or 6;

[0517] e is 1, 2, 3, 4, 5, or 6;

[0518] X 2Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, C 1-6 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 alkyl), N(C) 1-6 Alkyl)2, C 1-5 (COOH), C 1-6 (NHSO2Me);

[0519] X 3 Choose the group consisting of the following: hydrogen, halogens, C 1-5 Alkyl, C 3-7 Branched alkyl, C 1-5 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-5 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-5 Alkoxy, C 3-7 Branched alkoxy groups, C 1-5 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 alkyl), N(C) 1-6 Alkyl)2, COOH, C 1-5 (COOH), NHSO2Me, C 1-5 (NHSO2Me);

[0520] R 7 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0521] R 8 Choose the group consisting of the following items: C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C3-7 Branched alkoxy groups, CO(C) 1-6 Alkyl), CO(C) 3-7 Branched alkyl groups), SO2 (C 1-6 Alkyl groups and SO2 (C 3-7 Branched alkyl groups);

[0522] R 10 Choose the group consisting of the following items: hydrogen, C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, CO(C) 1-6 Alkyl), CO(C) 3-7 Branched alkyl groups), SO2 (C 1-6 Alkyl groups and SO2 (C 3-7 Branched alkyl groups);

[0523] R 11 Choose the group consisting of: hydrogen and C 1-6 alkyl;

[0524] R 12 Choose the group consisting of: hydrogen and methoxy C 1-6 alkyl.

[0525] The following definitions apply to formulas (I') and (IA) and their subgenuses:

[0526] As used in this article, the term "halogen" should refer to chlorine, bromine, fluorine, and iodine.

[0527] As used herein, unless otherwise specified, “alkyl” and / or “aliphatic”, whether used alone or as part of a substituent, refers to straight-chain and branched carbon chains having 1 to 20 carbon atoms or any number of carbon atoms within that range (e.g., 1 to 6 carbon atoms or 1 to 4 carbon atoms). The specified number of carbon atoms (e.g., C...) 1-6 The alkyl group should refer independently to the number of carbon atoms in the alkyl moiety or to the larger alkyl moiety containing alkyl substituents. Non-limiting examples of alkyl groups include methyl, ethyl, n-propyl, isopropyl, n-butyl, sec-butyl, isobutyl, tert-butyl, etc. Alkyl groups may optionally be substituted. Non-limiting examples of substituted alkyl groups include hydroxymethyl, chloromethyl, trifluoromethyl, aminomethyl, 1-chloroethyl, 2-hydroxyethyl, 1,2-difluoroethyl, 3-carboxypropyl, etc. In the presence of multiple alkyl groups (such as (C...), the alkyl group may be substituted. 1-6 In the substituents of alkyl(2amino), the alkyl groups can be the same or different.

[0528] As used herein, unless otherwise specified, "hydroxyalkyl" whether used alone or as part of a substituent refers to a straight-chain or branched carbon chain having 1 to 20 carbon atoms or any number of carbon atoms within that range (e.g., 1 to 6 carbon atoms or 1 to 4 carbon atoms), which also contains a hydroxyl substituent. The specified number of carbon atoms (e.g., C...) 1-6 The alkyl group should refer independently to the number of carbon atoms in the alkyl moiety or to the larger alkyl moiety containing alkyl substituents. Non-limiting examples of hydroxyalkyl groups include hydroxymethyl, hydroxyethyl, hydroxy-n-propyl, hydroxyisopropyl, hydroxy-n-butyl, hydroxy-sec-butyl, hydroxyisobutyl, etc. The hydroxyalkyl group may optionally be substituted. In the presence of multiple alkyl groups (such as (C...), the alkyl group may be...). 2-6 In the substituents of hydroxyalkyl(2amino), the hydroxyalkyl groups can be the same or different.

[0529] As used herein, the terms "alkenyl" and "alkynyl" groups, whether used alone or as part of a substituent, refer to straight-chain and branched carbon chains having two or more carbon atoms (preferably two to 20 carbon atoms), wherein the alkenyl chain has at least one double bond and the alkynyl chain has at least one triple bond. Alkenyl and alkynyl groups may optionally be substituted. Non-limiting examples of alkenyl groups include vinyl, 3-propenyl, 1-propenyl (also known as 2-methylvinyl), isopropenyl (also known as 2-methylvinyl-2-yl), buten-4-yl, etc. Non-limiting examples of substituted alkenyl groups include 2-chloroethenyl (also known as 2-chlorovinyl), 4-hydroxybuten-1-yl, 7-hydroxy-7-methyloct-4-en-2-yl, 7-hydroxy-7-methyloct-3,5-dien-2-yl, etc. Non-limiting examples of alkynyl groups include ethynyl, propynyl-2-ynyl (also known as propynyl), propynyl-1-yl, and 2-methyl-hexyl-4-yn-1-yl. Non-limiting examples of substituted alkynyl groups include 5-hydroxy-5-methylhexyl-3-ynyl, 6-hydroxy-6-methylheptyl-3-yn-2-yl, 5-hydroxy-5-ethylheptyl-3-ynyl, etc.

[0530] As used herein, “cycloalkyl”, whether used alone or as part of other groups, refers to a non-aromatic carbon-containing ring comprising cycloalkyl, alkenyl, and alkynyl groups, having, for example, 3 to 14 ring carbon atoms, preferably 3 to 7, 3 to 6, or even 3 to 4 ring carbon atoms, and optionally containing one or more (e.g., 1, 2, or 3) double or triple bonds. The cycloalkyl group can be monocyclic (e.g., cyclohexyl) or polycyclic (e.g., containing fused, bridged, and / or spirocyclic systems), wherein the carbon atoms are located inside or outside the ring system. Any suitable ring position of the cycloalkyl group can be covalently linked to a defined chemical structure. The cycloalkyl ring may optionally be substituted. Non-limiting examples of cycloalkyl groups include: cyclopropyl, 2-methyl-cyclopropyl, cyclopropenyl, cyclobutyl, 2,3-dihydroxycyclobutyl, cyclobutenyl, cyclopentyl, cyclopentenyl, cyclopentadienyl, cyclohexyl, cyclohexenyl, cycloheptyl, cyclooctyl, decahydronaphthyl, 2,5-dimethylcyclopentyl, 3,5-dichlorocyclohexyl, 4-hydroxycyclohexyl, 3,3,5-trimethylcyclohex-1-yl, octahydrocyclopentadienyl, octahydro-1H-indenyl, 3a,4,5,6,7,7a-hexahydro-3H-inden-4-yl, decahydroazinyl; bicyclo[6.2.0]decyl, decahydronaphthyl, and dodecahydro-1H-fluorenyl. The term "cycloalkyl" also includes carbocyclic rings, which are bicyclic hydrocarbon rings, and non-limiting examples include bicyclo[2.1.1]hexyl, bicyclo[2.2.1]heptyl, bicyclo[3.1.1]heptyl, 1,3-dimethyl[2.2.1]heptane-2-yl, bicyclo[2.2.2]octyl and bicyclo[3.3.3]undecyl.

[0531] "Haloalkyl" is intended to include both branched and straight-chain saturated aliphatic hydrocarbon groups having a specific number of carbon atoms and being substituted with one or more halogens. Haloalkyl groups include perhaloalkyl groups, wherein all hydrogen atoms of the alkyl group have been replaced by a halogen (e.g., -CF3, -CF2CF3). In addition to halogens, haloalkyl groups may optionally be substituted with one or more substituents. Examples of haloalkyl groups include, but are not limited to, fluoromethyl, dichloroethyl, trifluoromethyl, trichloromethyl, pentafluoroethyl, and pentachloroethyl groups.

[0532] The term "alkoxy" refers to an –O-alkyl group, wherein the alkyl group is as defined above. Alkoxy groups may optionally be substituted. The term C3-C6 cyclic alkoxy refers to a ring containing 3 to 6 carbon atoms and at least one oxygen atom (e.g., tetrahydrofuran, tetrahydro-2H-pyran). C3-C6 cyclic alkoxy groups may optionally be substituted.

[0533] The term "aryl," whether used alone or as part of other groups, is defined herein as an unsaturated aromatic monocyclic ring of 6 carbon atoms or an unsaturated aromatic polycyclic ring of 10 to 14 carbon atoms. The aryl ring can be, for example, a phenyl or naphthyl ring, each optionally substituted with one or more portions capable of replacing one or more hydrogen atoms. Non-limiting examples of aryl groups include: phenyl, naphth-1-yl, naphth-2-yl, 4-fluorophenyl, 2-hydroxyphenyl, 3-tolyl, 2-amino-4-fluorophenyl, 2-(N,N-diethylamino)phenyl, 2-cyanophenyl, 2,6-di-tert-butylphenyl, 3-methoxyphenyl, 8-hydroxynaphth-2-yl, 4,5-dimethoxynaphth-1-yl, and 6-cyano-naphth-1-yl. The aryl group also includes, for example, a phenyl or naphthyl ring fused with one or more saturated or partially saturated carbocyclic rings (e.g., bicyclic [4.2.0]octyl-1,3,5-trienyl, indanyl), which may be substituted at one or more carbon atoms of the aromatic ring and / or the saturated or partially saturated ring.

[0534] The term "aralkyl" or "aralkyl group" refers to the group – alkyl-aryl, wherein the alkyl group and aryl group are as defined herein. The aralkyl groups of this disclosure are optionally substituted. Examples of aralkyl groups include, for example, benzyl, 1-phenylethyl, 2-phenylethyl, 3-phenylpropyl, 2-phenylpropyl, fluorenemethyl, etc.

[0535] The terms “heterocyclic” and / or “heterocyclic” and / or “heterocyclic group”, whether used alone or as part of other groups, are defined herein as one or more rings having 3 to 20 atoms, wherein at least one atom in at least one ring is a heteroatom selected from nitrogen (N), oxygen (O), or sulfur (S), and further wherein the ring containing the heteroatom is non-aromatic. In heterocyclic groups comprising two or more fused rings, the ring without heteroatoms may be aryl (e.g., indolinyl, tetrahydroquinolinyl, benzodihydropyranyl). Exemplary heterocyclic groups have 3 to 14 ring atoms, wherein 1 to 5 are heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). One or more N or S atoms in the heterocyclic group may be oxidized. The heterocyclic group may optionally be substituted.

[0536] Non-limiting examples of heterocyclic units having a monocyclic structure include: diacridinyl, acridinel, urazolyl, acridinel, pyrazolyl, imidazolyl, oxazolyl, isoxazolinyl, isoxazolyl, thiazolyl, isothiazolyl, isothiazolyl, isothiazolinyloxitiazolidinone, oxazollidinone, hydantoin, tetrahydrofuranyl, pyrrolidinyl, morpholinyl, piperazinyl, piperidinyl, dihydropyranyl, tetrahydropyranyl, piperidin-2-one (valeronamide), 2,3,4,5-tetrahydro-1H-acoxenyl, 2,3-dihydro-1H-indole, and 1,2,3,4-tetrahydro-quinoline. Non-limiting examples of heterocyclic units having two or more rings include: hexahydro-1H-pyrrolazinyl, 3a,4,5,6,7,7a-hexahydro-1Hbenzo[d]imidazolyl, 3a,4,5,6,7,7a-hexahydro-1H-indolyl, 1,2,3,4-tetrahydroquinolinyl, benzodihydropyranyl, isobenzodihydropyranyl, indololinyl, isoindololinyl, and decahydro-1H-cyclooctyl[b]pyrroleyl.

[0537] The term "heteroaryl," whether used alone or as part of other groups, is defined herein as one or more rings having 5 to 20 atoms, wherein at least one atom in at least one ring is a heteroatom selected from nitrogen (N), oxygen (O), or sulfur (S), and further wherein at least one ring containing the heteroatom is aromatic. In heteroaryl groups comprising two or more fused rings, the ring without the heteroatom may be a carbocyclic ring (e.g., 6,7-dihydro-5H-cyclopentadiazine) or an aryl group (e.g., benzofuranyl, benzothiopheneyl, indolyl). Exemplary heteroaryl groups have 5 to 14 ring atoms and contain 1 to 5 cyclic heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). One or more N or S atoms in a heteroaryl group may be oxidized. Heteroaryl groups may be substituted. Non-limiting examples of heteroaryl rings containing a single ring include: 1,2,3,4-tetrazolyl, [1,2,3]triazolyl, [1,2,4]triazolyl, triazinyl, thiazolyl, 1H-imidazolyl, oxazolyl, furanyl, thiophene, pyrimidinyl, 2-phenylpyrimidinyl, pyridinyl, 3-methylpyridinyl, and 4-dimethylaminopyridinyl. Non-limiting examples of heteroaryl rings containing two or more fused rings include: benzofuranyl, benzothiopheneyl, benzoxazolyl, benzothiazolyl, benzotriazolyl, cyclolinyl, naphridyl, phenanthridineyl, 7H-purinyl, 9H-purinyl, 6-amino-9H-purinyl, 5H-pyrrolo[3,2-d]pyrimidinyl, 7H-pyrrolo[2,3-d]pyrimidinyl, pyrido[2,3-d]pyrimidinyl, 2-phenylbenzo[d]thiazolyl, 1H-indolyl, 4,5,6,7-tetrahydro-1-H-indolyl, quinoxalinyl, 5-methylquinoxalinyl, quinazolinyl, quinolinyl, 8-hydroxy-quinolinyl, and isoquinolinyl.

[0538] A non-limiting example of a heteroaryl group as described above is a C1-C5 heteroaryl having 1 to 5 carbon ring atoms and at least one additional ring atom (preferably 1 to 4 additional ring atoms that are heteroatoms) independently selected from nitrogen (N), oxygen (O) or sulfur (S). Examples of C1-C5 heteroaryl groups include, but are not limited to, triazinyl, thiazolyl-2-yl, thiazolyl-4-yl, imidazole-1-yl, 1H-imidazolyl-2-yl, 1H-imidazolyl-4-yl, isoxazoline-5-yl, furan-2-yl, furan-3-yl, thiophene-2-yl, thiophene-4-yl, pyrimidin-2-yl, pyrimidin-4-yl, pyrimidin-5-yl, pyridin-2-yl, pyridin-3-yl, and pyridin-4-yl.

[0539] Unless otherwise specified, when two substituents together form a ring with a specified number of ring atoms (e.g., two R groups together with the nitrogen (N) to which they are attached form a ring with 3 to 7 ring members), the ring may have a carbon atom and optionally one or more (e.g., 1 to 3) other heteroatoms independently selected from nitrogen (N), oxygen (O), or sulfur (S). The ring may be saturated or partially saturated and may optionally be substituted.

[0540] For the purposes of this disclosure, fused ring units containing a single heteroatom, as well as spirocyclic, bicyclic, and the like, will be considered to belong to the ring family corresponding to the heteroatom-containing ring. For example, 1,2,3,4-tetrahydroquinoline has the following formula:

[0541]

[0542] For the purposes of this disclosure, it is considered a heterocyclic unit. 6,7-Dihydro-5H-cyclopentanepyrimidine has the following formula:

[0543]

[0544] For the purposes of this disclosure, it is considered a heteroaryl unit. When the fused ring unit contains heteroatoms in both the saturated ring and the aryl ring, the aryl ring will dominate and determine the type of ring class. For example, 1,2,3,4-tetrahydro-[1,8]naphthidine has the following formula:

[0545]

[0546] For the purposes of this disclosure, it is considered to be a heteroaryl unit.

[0547] Whenever a term or any of its prefix roots appears in the name of a substituent, that name shall be interpreted to include the limitations provided herein. For example, whenever the term “alkyl” or “aryl” or any of its prefix roots appears in the name of a substituent (e.g., aralkyl, alkylamino), that name shall be interpreted to include the limitations given above for “alkyl” and “aryl”.

[0548] The term "substituted" is used throughout this specification. The term "substituted" is defined herein as a portion in which one or more hydrogen atoms are replaced by one or more (e.g., 1 to 10) substituents as defined below, whether acyclic or cyclic. Substituents are capable of replacing one or two hydrogen atoms in a single portion at a time. Additionally, these substituents can replace two hydrogen atoms on two adjacent carbons to form the substituent, a new portion, or a unit. For example, substituted units requiring a single hydrogen atom replacement include halogens, hydroxyl groups, etc. Replacement of two hydrogen atoms includes carbonyl groups, oxime groups, etc. Replacement of two hydrogen atoms from adjacent carbon atoms includes epoxy groups, etc. Throughout this specification, the term "substituted" is used to indicate that a portion is such that one or more hydrogen atoms in the hydrogen atom can be replaced by substituents. When a portion is described as "substituted," any number of hydrogen atoms can be replaced. For example, difluoromethyl is a substituted C1 alkyl group; trifluoromethyl is a substituted C1 alkyl group; 4-hydroxyphenyl is a substituted aromatic ring; (N,N-dimethyl-5-amino)octyl is a substituted C8 alkyl group; 3-guanidinopropyl is a substituted C3 alkyl group; and 2-carboxypyridyl is a substituted heteroaryl group.

[0549] The variable groups defined herein, such as alkyl, alkenyl, alkynyl, cycloalkyl, alkoxy, aryloxy, aryl, heterocyclic, and heteroaryl groups as defined herein, may be optionally substituted, whether used alone or as part of another group. Optionally substituted groups will be indicated as follows.

[0550] The following are non-limiting examples of substituents that can replace hydrogen atoms in a portion of the hydrogen atom: halogens (chlorine (Cl), bromine (Br), fluorine (F), and iodine (I)), –CN, –NO2, oxo (=O), –OR x –SR x –N(R) x )2、–NR x C(O)R x –SO2R x –SO2OR x –SO2N(R x )2、–C(O)R x –C(O)OR x –C(O)N(R) x 2. C 1-6 Alkyl, C1-6 Haloalkyl, C 1-6 Alkoxy, C 2-8 alkenyl, C 2-8 alkynyl group, C 3-14 Cycloalkyl, aryl, heterocyclic, or heteroaryl, wherein each of the alkyl, haloalkyl, alkenyl, alkynyl, cycloalkyl, aryl, heterocyclic, and heteroaryl groups is optionally independently selected from halogen, –CN, –NO2, oxo, and R. x One to ten (e.g., one to six or one to four) groups are substituted; wherein R x Each time it appears, it is independently hydrogen, –OR x+1 –SR x +1 –C(O)R x+1 –C(O)OR x+1 –C(O)N(R) x+1 )2、–SO2R x+1 -S(O)2OR x+1 –N(R) x+1 )2、–NR x+1 C(O)R x+1 C 1-6 Alkyl, C 1-6 Haloalkyl, C 2-8 alkenyl, C 2-8 alkynyl, cycloalkyl (e.g., C 3-6 cycloalkyl), aryl, heterocyclic or heteroaryl, or two R x The units, together with one or more atoms bonded to them, form optionally substituted carbocyclic or heterocyclic rings, wherein the carbocyclic or heterocyclic rings have 3 to 7 ring atoms; wherein R x+1 Each time it appears, it is independently hydrogen or C. 1-6 Alkyl, C 1-6 Haloalkyl, C 2-8 alkenyl, C 2-8 alkynyl, cycloalkyl (e.g., C 3-6 cycloalkyl), aryl, heterocyclic or heteroaryl, or two R x+1 The units, together with one or more atoms bonded to them, form optionally substituted carbon rings or heterocycles, wherein the carbon rings or heterocycles preferably have 3 to 7 ring atoms.

[0551] In some embodiments, the substituent is selected from:

[0552] i)–OR x+2 For example, –OH, –OCH3, –OCH2CH3, –OCH2CH2CH3;

[0553] ii)–C(O)R x+2For example, –COCH3, –COCH2CH3, –COCH2CH2CH3;

[0554] iii)–C(O)OR x+2 For example, –CO2CH3, –CO2CH2CH3, –CO2CH2CH2CH3;

[0555] iv)–C(O)N(R x+2 )2; for example, –CONH2, –CONHCH3, –CON(CH3)2;

[0556] v)–N(R x+2 )2; for example, –NH2, –NHCH3, –N(CH3)2, –NH(CH2CH3);

[0557] vi) Halogens, –F, –Cl, –Br and –I;

[0558] vii)–CH e X g Where X is a halogen, m is 0 to 2, e+g = 3; for example, –CH2F, –CHF2, –CF3, –CCl3 or –CBr3;

[0559] viii)–SO2R x+2 For example, –SO2H; –SO2CH3; –SO2C6H5;

[0560] ix) C1-C6 straight-chain, branched, or cyclic alkyl groups;

[0561] x) cyano;

[0562] xi) Nitro;

[0563] xii)N(R x+2 )C(O)R x+2 ;

[0564] xiii) Oxygenation (=O);

[0565] xiv) heterocyclic groups; and

[0566] xv) heteroaryl.

[0567] Each R x+2 Independently hydrogen, optionally substituted C1-C6 straight-chain or branched alkyl (e.g., optionally substituted C1-C4 straight-chain or branched alkyl) or optionally substituted C3-C6 cycloalkyl (e.g., optionally substituted C3-C4 cycloalkyl); or both. Rx+2 The units can together form rings containing 3 to 7 ring atoms. In some respects, each R x+2Independently hydrogen, optionally halogenated C1-C6 straight-chain or branched alkyl, C3-C6 cycloalkyl or C3-C6 cycloalkyl.

[0568] The compounds described herein may contain asymmetric atoms (also known as chiral centers), and some compounds may contain one or more asymmetric atoms or centers, thus producing optical isomers (enantiomers) and diastereomers. The teachings of this invention and the compounds disclosed herein include such enantiomers and diastereomers, as well as racemic and resolved, enantiomerically pure R and S stereoisomers, other mixtures of R and S stereoisomers, and their pharmaceutically acceptable salts. Optical isomers can be obtained in pure form by standard procedures known to those skilled in the art, including but not limited to diastereomer salt formation, kinetic resolution, and asymmetric synthesis. The teachings of this invention also cover cis and trans isomers of compounds containing alkenyl moieties (e.g., alkenes and imines). It should also be understood that the teachings of this invention cover all possible positional isomers and mixtures thereof, which can be obtained in pure form by standard separation procedures known to those skilled in the art, including but not limited to column chromatography, thin-layer chromatography, and high-performance liquid chromatography.

[0569] In some embodiments, the MNK inhibitor of the present invention is a pyridine-1,5-dione having formula (I'):

[0570] Formula (I')

[0571] Or its pharmaceutically acceptable salt, wherein:

[0572] R 1 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl;

[0573] R 2' Choose from the following groups: , , , , , , , , , , , , , , and ;

[0574] R 3' Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl;

[0575] R 1c and R 1d Together they form a 3- to 7-membered ring having 0 to 2 heteroatoms selected from the group consisting of: N, O, and S, wherein the 3- to 7-membered ring may be further optionally substituted by one or more substituents selected from the group consisting of: halogenated, oxo-substituted, C-substituted. 1-6 Alkyl, R 8 and –C(=O)OR 9 ;

[0576] Z 1 and Z 2 Each is an independent direct key or –{C(R) 4a (R) 4b )} p –Y 1 –; where p is 0, 1, 2, 3, 4 or 5, Y 1 For direct keys, –O– or –N(R) 8 )–;

[0577] R 4a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl); or two R 4a It connects with two adjacent carbons to form a direct bond;

[0578] R 4b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0579] R 5 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0580] R 6 Choose the group consisting of the following: hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0581] R 6a Choose from the group consisting of: -(CO)C1-6 alkyl, -(CO)C 3-7 Branched alkyl, -(CO)C1-6 hydroxyalkyl, , , , , , , , , and ;

[0582] q can be 1, 2, 3, 4, 5, or 6;

[0583] e is 1, 2, 3, 4, 5, or 6;

[0584] X 2 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, C 1-6 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 alkyl), N(C) 1-6 Alkyl)2, C 1-5 (COOH), C 1-6 (NHSO2Me);

[0585] X 3 Choose the group consisting of the following: hydrogen, halogens, C 1-5 Alkyl, C 3-7 Branched alkyl, C 1-5 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-5 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-5 Alkoxy, C 3-7 Branched alkoxy groups, C 1-5 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 alkyl), N(C) 1-6 Alkyl)2, COOH, C 1-5 (COOH), NHSO2Me, C 1-5 (NHSO2Me);

[0586] R 7 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0587] R 8 Choose the group consisting of the following items: C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, CO(C) 1-6 Alkyl), CO(C) 3-7 Branched alkyl groups), SO2 (C 1-6 Alkyl groups and SO2 (C 3-7 Branched alkyl groups);

[0588] R 9 Choose the group consisting of the following items: hydrogen, C 1-6 Alkyl and aralkyl.

[0589] In more specific embodiments, compounds exhibiting MNK inhibition have the following structures, represented by formula (IA):

[0590]

[0591] Or its pharmaceutically acceptable salt, wherein:

[0592] Z 1 Choose from the following groups: and ;

[0593] R 1 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl;

[0594] R 2'Choose from the following groups: , , , , , , , , , , , , , , and ;

[0595] R 3' Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl;

[0596] R 4a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0597] R 4b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0598] R 4c Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0599] R 4d Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl);

[0600] R 4e For hydrogen, halogen, C 1-6Alkyl, C 3-7 Branched alkyl, C 1-6 Halogenated alkyl groups and C 3-7 Branched haloalkyl groups;

[0601] R 4f For hydrogen, halogen, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Halogenated alkyl groups and C 3-7 Branched haloalkyl groups;

[0602] R 1c and R 1d Together they form optionally substituted 3- to 7-membered rings, which optionally contain X as part of the ring. 1 Group;

[0603] X 1 Choose from the following groups: –C(F)2–, –CH(CO2R) 12 )–, –O–, –NH–, –N(R 8 )– and –S(=O)2–;

[0604] m is 0, 1, or 2;

[0605] n 1 It can be 1, 2, or 3;

[0606] R 5 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0607] R 6 Choose the group consisting of the following: hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0608] R 6a Choose from the group consisting of: -(CO)C1-6 alkyl, -(CO)C 3-7 Branched alkyl, -(CO)C1-6 hydroxyalkyl, , , , , , , , , and ;

[0609] q can be 1, 2, 3, 4, 5, or 6;

[0610] e is 1, 2, 3, 4, 5, or 6;

[0611] X 2 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, C 1-6 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 alkyl), N(C) 1-6 Alkyl)2, C 1-5 (COOH), C 1-6 (NHSO2Me);

[0612] X 3 Choose the group consisting of the following: hydrogen, halogens, C 1-5 Alkyl, C 3-7 Branched alkyl, C 1-5 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-5 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-5 Alkoxy, C 3-7 Branched alkoxy group. C 1-5 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups. NH2, NH(C) 1-6 alkyl), N(C) 1-6 Alkyl)2, COOH, C 1-5 (COOH), NHSO2Me, C 1-5 (NHSO2Me);

[0613] R 7 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups;

[0614] R 8 Choose the group consisting of the following items: C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, CO(C) 1-6 Alkyl), CO(C) 3-7 Branched alkyl groups), SO2 (C 1-6 Alkyl groups and SO2 (C 3-7 Branched alkyl groups);

[0615] R 10 Choose the group consisting of the following items: hydrogen; C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, CO(C) 1-6 Alkyl), CO(C) 3-7 Branched alkyl groups), SO2 (C 1-6 Alkyl groups and SO2 (C 3.7 Branched alkyl groups).

[0616] R 11 Choose the group consisting of: hydrogen and C 1-6 alkyl;

[0617] R 12 Choose the group consisting of: hydrogen and methoxy C 1-6 alkyl.

[0618] In more specific embodiments, the compounds disclosed herein include compounds having formula (IIA):

[0619]

[0620] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c n 1 Z 1 R 5 R 6 and R7 As defined in this article.

[0621] In more specific embodiments, the compounds disclosed herein include compounds having formula (III):

[0622]

[0623] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c n 1 Z 1 and R 6 As defined in this article.

[0624] In more specific embodiments, the compounds disclosed herein include compounds having formula (IV):

[0625]

[0626] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c n 1 Z 1 and R 6 As defined in this article.

[0627] In more specific embodiments, the compounds disclosed herein include compounds having formula (V):

[0628]

[0629] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c n 1 Z 1 and R 6 As defined in this article.

[0630] In more specific embodiments, the compounds disclosed herein include compounds having formula (VI):

[0631]

[0632] Or its pharmaceutically acceptable salt, wherein:

[0633] R 1 R 2' R 3' R 4d R 4c n 1 and Z 1 As defined in this article;

[0634] R 8a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0635] R 8b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0636] R 8c Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0637] R 8d Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0638] R 9a Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy and C 3-7 Branched alkoxy groups;

[0639] R 9b Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy and C 3-7 Branched alkoxy groups;

[0640] R 9a and R 9b Together they form arbitrarily substituted 3 to 7-membered rings;

[0641] q is 1, 2, or 3; and

[0642] z can be 0, 1, or 2.

[0643] In more specific embodiments, the compounds disclosed herein include compounds having formula (VII):

[0644]

[0645] Or its pharmaceutically acceptable salt, wherein:

[0646] R 1 R 2' R 3' R 4d R 4c Z 1 X 1 and n 1 As defined in this article;

[0647] R 8a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0648] R 8b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0649] R 8c Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0650] R 8d Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0651] q is 1, 2, or 3; and

[0652] z can be 0, 1, or 2.

[0653] In more specific embodiments, the compounds disclosed herein include compounds having formula (VIII):

[0654]

[0655] Or its pharmaceutically acceptable salt, wherein:

[0656] R 1 R 3' R 4d R 4c Z 1 R 5 R 6 R 7 and n 1 As defined in this article;

[0657] R 8a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0658] R 8b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0659] R 8c Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0660] R 8d Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0661] R 9a Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0662] R 9b Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0663] q is 1, 2, or 3; and

[0664] z can be 0, 1, or 2.

[0665] In more specific embodiments, the compounds disclosed herein include compounds having formula (IX):

[0666]

[0667] Or its pharmaceutically acceptable salt.1 R 3' R 4d R 4c Z 1 R 6 R 8a R 8b R 8c R 8d n 1 And z as defined in this article.

[0668] In more specific embodiments, the compounds disclosed herein include compounds having formula (X):

[0669]

[0670] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c Z 1 R 6 R 8a R 8b R 8c R 8d R 9a R 9b n 1 And z as defined in this article.

[0671] In more specific embodiments, the compounds disclosed herein include compounds having formula (XI):

[0672]

[0673] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c Z 1 R 6 R 8a R 8b R 8c R 8d R 9a R 9b n 1 And z as defined in this article.

[0674] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XII):

[0675]

[0676] Or its pharmaceutically acceptable salt, wherein:

[0677] R 1 R 3’ R 4d R 4c Z 1 R 5 R 6 R 7 X 1 and n 1 As defined in this article;

[0678] R 8a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0679] R 8b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0680] R 8c Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0681] R 8d Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, hydroxyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHSO2 (C 1-6 Alkyl) and NHSO2 (C 3-7 Branched alkyl groups);

[0682] q is 1, 2, or 3; and

[0683] z can be 0, 1, or 2.

[0684] In more specific embodiments, the compounds disclosed herein include compounds having formula (XIII):

[0685]

[0686] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c Z 1 R 6 R 8a R 8b R 8c R 8d X 1 n 1 And z as defined in this article.

[0687] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XIV):

[0688]

[0689] Or its pharmaceutically acceptable salt. 1 R 3' R4d R 4c Z 1 R 6 R 8a R 8b R 8c R 8d X 1 n 1 And z as defined in this article.

[0690] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XV):

[0691]

[0692] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c Z 1 R 6 R 8a R 8b R 8c R 8d X 1 n 1 And z as defined in this article.

[0693] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XVI):

[0694]

[0695] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c R 4e R 4f R 5 R 6 R 7 and n 1 As defined in this article.

[0696] The compounds disclosed herein include compounds having the formula (XV):

[0697]

[0698] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R4c R 4e R 4f R 6 and n 1 As defined in this article.

[0699] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XVI):

[0700]

[0701] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c R 4e R 4f R 6 and n 1 As defined in this article.

[0702] In more specific embodiments, the compounds disclosed herein include compounds having formula (XVII):

[0703]

[0704] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c R 4e R 4f R 6 and n 1 As defined in this article.

[0705] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XVIII):

[0706]

[0707] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4a R 4b R 4d R 4c R 5 R 6 R 7 m and n 1 As defined in this article.

[0708] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XIX):

[0709]

[0710] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c R 4a R 4b R 6 m and n 1 As defined in this article.

[0711] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XX):

[0712]

[0713] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c R 4a R 4b R 6 m and n 1 As defined in this article.

[0714] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XX):

[0715]

[0716] Or its pharmaceutically acceptable salt. 1c R 1d R 1 R 3' R 4d R 4c R 4a R 4b R 6 m and n 1 As defined in this article.

[0717] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXI):

[0718]

[0719] Or its pharmaceutically acceptable salt.1 R 2' R 3' R 4d R 4c R 4e R 4f R 8a R 8b R 8c R 8d R 9a R 9b n 1 q and z are as defined in this article.

[0720] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXII):

[0721]

[0722] Or its pharmaceutically acceptable salt. 1 R 2' R 3' R 4d R 4c R 4e R 4f R 8a R 8b R 8c R 8d R 9a R 9b m, n 1 q and z are as defined in this article.

[0723] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXIII):

[0724]

[0725] Or its pharmaceutically acceptable salt. 1 R 2' R 3' R 4d R 4c R 4e R 4f R 8a R 8b R 8c R 8d X 1 n 1 q and z are as defined in this article.

[0726] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXIV):

[0727]

[0728] Or its pharmaceutically acceptable salt. 1 R 2' R 3' R 4d R 4c R 4e R 4f R 8a R 8b R 8c R 8d X 1 m, n 1 q and z are as defined in this article.

[0729] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXV):

[0730]

[0731] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4e R 4f R 5 R 6 R 7 R 8a R 8b R 8c R 8d R 9a R 9b n 1 q and z are as defined in this article.

[0732] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXVI):

[0733]

[0734] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4e R 4f R 6 R 8a R 8b R 8c R 8d R 9a R 9b n 1 q and z are as defined in this article.

[0735] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXVII):

[0736]

[0737] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4e R 4f R 6 R 8a R 8b R 8c R 8d R 9a R 9b n 1 q and z are as defined in this article.

[0738] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXVIII):

[0739]

[0740] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4e R 4f R 6 R 8a R 8b R 8c R 8d R 9a R 9b n 1 q and z are as defined in this article.

[0741] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXIX):

[0742]

[0743] Or its pharmaceutically acceptable salt. 1 R 3' R 4a R 4b R 4d R 4c R 5 R 6 R 7 R 8a R8b R 8c R 8d R 9a R 9b m, n 1 q and z are as defined in this article.

[0744] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXX):

[0745]

[0746] Or its pharmaceutically acceptable salt. 1 R 3' R 4a R 4b R 4d R 4c R 6 R 8a R 8b R 8c R 8d R 9a R 9b m, n 1 q and z are as defined in this article.

[0747] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXXI):

[0748]

[0749] Or its pharmaceutically acceptable salt. 1 R 3' R 4a R 4b R 4d R 4c R 6 R 8a R 8b R 8c R 8d R 9a R 9b m, n 1 q and z are as defined in this article.

[0750] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXXII):

[0751]

[0752] Or its pharmaceutically acceptable salt. 1 R 3' R 4a R4b R 4d R 4c R 6 R 8a R 8b R 8c R 8d R 9a R 9b m, n 1 q and z are as defined in this article.

[0753] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXXIII):

[0754]

[0755] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4e R 4f R 5 R 6 R 7 R 8a R 8b R 8c R 8d X 1 n 1 q and z are as defined in this article.

[0756] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXXIV):

[0757]

[0758] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4e R 4f R 6 R 8a R 8b R 8c R 8d X 1 n 1 q and z are as defined in this article.

[0759] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXXV):

[0760]

[0761] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4e R 4f R 6 R 8a R 8b R 8c R 8d X 1 n 1 q and z are as defined in this article.

[0762] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXXVI):

[0763]

[0764] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4a R 4b R 5 R 6 R 7 R 8a R 8b R 8c R 8d X 1 m, n 1 q and z are as defined in this article.

[0765] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXXVII):

[0766]

[0767] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4a R 4b R 6 R 8a R 8b R 8c R 8d X 1 m, n 1 q and z are as defined in this article.

[0768] In more specific embodiments, the compounds disclosed herein include compounds having the formula (XXXVIII):

[0769]

[0770] Or its pharmaceutically acceptable salt. 1 R 3' R 4d R 4c R 4a R 4b R 6 R 8a R 8b R 8c R 8d X 1 m, n 1 q and z are as defined in this article.

[0771] In more specific embodiments, the compounds disclosed herein include compounds having formulas (XXXVIIII) to (LI):

[0772] , , , , , , , , , , ,

[0773] Or its pharmaceutically acceptable salt.

[0774] In some embodiments, Z 1 for In some embodiments, Z 1 for .

[0775] In some embodiments, R 1 It is hydrogen. In some embodiments, R is... 1 It is a halogen. In some embodiments, R 1 C 1-6 Alkyl group. In some embodiments, R 1 C 3-7 Branched alkyl groups. In some embodiments, R 1 C 1-6 Haloalkyl. In some embodiments, R 1 C 3-7 Branched haloalkyl groups. In some embodiments, R 1 C 1-6Hydroxyalkyl. In some embodiments, R 1 C 3-7 Branched hydroxyalkyl group. In some embodiments, R 1 It is cyano. In some embodiments, R 1 C 1-6 Alkyl group. In some embodiments, R 1 C 3-7 Branched alkoxy groups. In some embodiments, R 1 hydroxyl group. In some embodiments, R... 1 C 3-6 Cycloalkyl. In some embodiments, R 1 C 3-6 cycloalkyl groups, which are substituted with one substituent selected from the group consisting of: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl. In some embodiments, R 1 C 3-6 Cycloalkyl groups, which are substituted with two substituents selected from the group consisting of: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl. In some embodiments, R 1 C 3-6 Cycloalkyl groups, which are substituted with three substituents selected from the group consisting of: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl.

[0776] In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for In some embodiments, R 2' for .

[0777] In some embodiments, R 3' It is hydrogen. In some embodiments, R is... 3' It is a halogen. In some embodiments, R 3' C 1-6 Alkyl group. In some embodiments, R 3' C 3-7 Branched alkyl groups. In some embodiments, R 3' C 1-6 Haloalkyl. In some embodiments, R 3' C 3-7 Branched haloalkyl groups. In some embodiments, R 3' C 1-6 Hydroxyalkyl. In some embodiments, R 3' C 3-7 Branched hydroxyalkyl group. In some embodiments, R 3' It is cyano. In some embodiments, R 3' C 1-6 Alkyl group. In some embodiments, R 3' C 3-7 Branched alkoxy groups. In some embodiments, R 3' hydroxyl group. In some embodiments, R... 3' C 3-6 Cycloalkyl. In some embodiments, R 3' C 3-6 cycloalkyl groups, which are substituted with one substituent selected from the group consisting of: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl. In some embodiments, R 3' C 3-6 Cycloalkyl groups, which are substituted with two substituents selected from the group consisting of: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl. In some embodiments, R 3' C 3-6Cycloalkyl groups, which are substituted with three substituents selected from the group consisting of: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl.

[0778] In some embodiments, R 4a It is hydrogen. In some embodiments, R is... 4a It is a halogen. In some embodiments, R 4a C 1-6 Alkyl group. In some embodiments, R 4a C 3-7 Branched alkyl groups. In some embodiments, R 4a C 1-6 Haloalkyl. In some embodiments, R 4a C 3-7 Branched haloalkyl groups. In some embodiments, R 4a hydroxyl group. In some embodiments, R... 4a C 1-6 Alkyl group. In some embodiments, R 4a C 3-7 Branched alkoxy groups. In some embodiments, R 4a For NHCO(C 1-6 Alkyl). In some embodiments, R 4a For NHCO(C 3-7 Branched alkyl groups). In some embodiments, R 4a For NHCO(C 3-7 cycloalkyl). In some embodiments, R 4a For NHSO2(C 1-6 Alkyl). In some embodiments, R 4a For NHSO2(C 3-7 Branched alkyl groups). In some embodiments, R 4a NHSO2(C 3-7 (cycloalkyl).

[0779] In some embodiments, R 4b It is hydrogen. In some embodiments, R is... 4b It is a halogen. In some embodiments, R 4b C 1-6 Alkyl group. In some embodiments, R 4b C 3-7 Branched alkyl groups. In some embodiments, R 4b C 1-6 Haloalkyl. In some embodiments, R 4b C 3-7 Branched haloalkyl groups. In some embodiments, R 4b hydroxyl group. In some embodiments, R...4b C 1-6 Alkyl group. In some embodiments, R 4b C 3-7 Branched alkoxy groups. In some embodiments, R 4b For NHCO(C 1-6 Alkyl). In some embodiments, R 4b For NHCO(C 3-7 Branched alkyl groups). In some embodiments, R 4b For NHCO(C 3-7 cycloalkyl). In some embodiments, R 4b For NHSO2(C 1-6 Alkyl). In some embodiments, R 4b For NHSO2(C 3-7 Branched alkyl groups). In some embodiments, R 4b For NHSO2(C 3-7 (cycloalkyl).

[0780] In some embodiments, R 4c It is hydrogen. In some embodiments, R is... 4c It is a halogen. In some embodiments, R 4c C 1-6 Alkyl group. In some embodiments, R 4c C 3-7 Branched alkyl groups. In some embodiments, R 4c C 1-6 Haloalkyl. In some embodiments, R 4c C 3-7 Branched haloalkyl groups. In some embodiments, R 4c hydroxyl group. In some embodiments, R... 4c C 1-6 Alkyl group. In some embodiments, R 4c C 3-7 Branched alkoxy groups. In some embodiments, R 4c For NHCO(C 1-6 Alkyl). In some embodiments, R 4c For NHCO(C 3-7 Branched alkyl groups). In some embodiments, R 4c For NHCO(C 3-7 cycloalkyl). In some embodiments, R 4c For NHSO2(C 1-6 Alkyl). In some embodiments, R 4c For NHSO2(C 3-7 Branched alkyl groups). In some embodiments, R 4c For NHSO2(C 3-7 (cycloalkyl).

[0781] In some embodiments, R 4d It is hydrogen. In some embodiments, R is... 4d It is a halogen. In some embodiments, R 4d C 1-6 Alkyl group. In some embodiments, R 4d C 3-7 Branched alkyl groups. In some embodiments, R 4d C 1-6 Haloalkyl. In some embodiments, R 4d C 3-7 Branched haloalkyl groups. In some embodiments, R 4d hydroxyl group. In some embodiments, R... 4d C 1-6 Alkyl group. In some embodiments, R 4d C 3-7 Branched alkoxy groups. In some embodiments, R 4d For NHCO(C 1-6 Alkyl). In some embodiments, R 4d For NHCO(C 3-7 Branched alkyl groups). In some embodiments, R 4d For NHCO(C 3-7 cycloalkyl). In some embodiments, R 4d For NHSO2(C 1-6 Alkyl). In some embodiments, R 4d For NHSO2(C 3-7 Branched alkyl groups). In some embodiments, R 4d For NHSO2(C 3-7 (cycloalkyl).

[0782] In some embodiments, R 4e It is hydrogen. In some embodiments, R is... 4e It is a halogen. In some embodiments, R 4e C 1-6 Alkyl group. In some embodiments, R 4e C 3-7 Branched alkyl groups. In some embodiments, R 4e C 1-6 Haloalkyl. In some embodiments, R 4e C 3-7 Branched haloalkyl groups.

[0783] In some embodiments, R 4f It is hydrogen. In some embodiments, R is... 4f It is a halogen. In some embodiments, R 4f C 1-6Alkyl group. In some embodiments, R 4f C 3-7 Branched alkyl groups. In some embodiments, R 4f C 1-6 Haloalkyl. In some embodiments, R 4f C 3-7 Branched haloalkyl groups.

[0784] In some embodiments, R 1c and R 1d Together they form an optionally substituted 3-membered ring. In some embodiments, R 1c and R 1d Together they form an optionally substituted 4-membered ring. In some embodiments, R 1c and R 1d Together they form an optionally substituted 5-membered ring. In some embodiments, R 1c and R 1d Together they form an optionally substituted 6-membered ring. In some embodiments, R 1c and R 1d Together they form an optionally substituted 7-membered ring. In some embodiments, R 1c and R 1d Together they form a mixture containing X 1 The group is optionally substituted into a 3-membered ring. In some embodiments, R 1c and R 1d Together they form a mixture containing X 1 The group is optionally substituted into a 4-membered ring. In some embodiments, R 1c and R 1d Together they form a mixture containing X 1 The group is optionally substituted into a 5-membered ring. In some embodiments, R 1c and R 1d Together they form a mixture containing X 1 The group is optionally substituted with a 6-membered ring. In some embodiments, R 1c and R 1d Together they form a mixture containing X 1 A 7-membered ring with optional substitution of the group.

[0785] In some embodiments, X 1 For CF2. In some embodiments, X 1 CHCO2R 12 In some embodiments, X 1 It is O. In some embodiments, X 1 For NH. In some embodiments, X 1 For NR 8 In some embodiments, X 1 It is SO2.

[0786] In some embodiments, m is 0. In some embodiments, m is 1. In some embodiments, m is 2.

[0787] In some embodiments, n 1 The value is 1. In some embodiments, n 1 The value is 2. In some embodiments, n 1 The value is 3.

[0788] In some embodiments, R 5 It is hydrogen. In some embodiments, R is... 5 It is a halogen. In some embodiments, R 5 C 1-6 Alkyl group. In some embodiments, R 5 C 3-7 Branched alkyl groups. In some embodiments, R 5 C 1-6 Haloalkyl. In some embodiments, R 5 C 3-7 Branched haloalkyl groups. In some embodiments, R 5 C 1-6 Alkyl group. In some embodiments, R 5 C 3-7 Branched alkoxy groups. In some embodiments, R 5 It is a hydroxyl group.

[0789] In some embodiments, R 6 It is hydrogen. In some embodiments, R is... 6 For NH2. In some embodiments, R 6 For NHR 6a In some embodiments, R 6 For example, NHCH2CH2OH. In some embodiments, R 6 The form is NHCH2CH2NHSO2Me. In some embodiments, R 6 C 1-6 Alkyl group. In some embodiments, R 6 C 3-7 Branched alkoxy groups. In some embodiments, R 6 It is a hydroxyl group.

[0790] In some embodiments, R 6a It is –(CO)C1-6 alkyl. In some embodiments, R 6a –(CO)C 3-7 Branched alkyl groups. In some embodiments, R 6a It is –(CO)C1-6 hydroxyalkyl. In some embodiments, R 6a for In some embodiments, R6a for In some embodiments, R 6a for In some embodiments, R 6a for In some embodiments, R 6a for In some embodiments, R 6a for In some embodiments, R 6a for In some embodiments, R 6a for In some embodiments, R 6a for In some embodiments, R 6a for .

[0791] In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3. In some embodiments, q is 4. In some embodiments, q is 5. In some embodiments, q is 6.

[0792] In some embodiments, e is 1. In some embodiments, e is 2. In some embodiments, e is 3. In some embodiments, e is 4. In some embodiments, e is 5. In some embodiments, e is 6.

[0793] In some embodiments, X 2 It is hydrogen. In some embodiments, X is... 2 It is a halogen. In some embodiments, X 2 C 1-6 Alkyl group. In some embodiments, X 2 C 3-7 Branched alkyl groups. In some embodiments, X 2 C 1-6 Haloalkyl. In some embodiments, X 2 C 3-7 Branched haloalkyl groups. In some embodiments, X 2 It is a hydroxyl group. In some embodiments, X... 2 C 1-6 Hydroxyalkyl. In some embodiments, X 2 C 3-7 Branched hydroxyalkyl group. In some embodiments, X 2 C 1-6 Alkyl groups. In some embodiments, X 2 C 3-7 Branched alkoxy groups. In some embodiments, X 2 C 1-6Haloalkoxy group. In some embodiments, X 2 C 3-7 Branched haloalkoxy groups. In some embodiments, X 2 For example, X is NH2. In some embodiments, X... 2 For NH(C) 1-6 Alkyl). In some embodiments, X 2 For N(C) 1-6 Alkyl)2. In some embodiments, X 2 C 1-5 (COOH). In some embodiments, X 2 C 1-6 (NHSO2Me).

[0794] In some embodiments, X 3 It is hydrogen. In some embodiments, X is... 3 It is a halogen. In some embodiments, X 3 C 1-5 Alkyl group. In some embodiments, X 3 C 3-7 Branched alkyl groups. In some embodiments, X 3 C 1-5 Haloalkyl. In some embodiments, X 3 C 3-7 Branched haloalkyl groups. In some embodiments, X 3 It is a hydroxyl group. In some embodiments, X... 3 C 1-5 Hydroxyalkyl. In some embodiments, X 3 C 3-7 Branched hydroxyalkyl group. In some embodiments, X 3 C 1-5 Alkyl groups. In some embodiments, X 3 C 3-7 Branched alkoxy groups. In some embodiments, X 3 C 1-5 Haloalkoxy group. In some embodiments, X 3 C 3-7 Branched haloalkoxy groups. In some embodiments, X 3 For example, X is NH2. In some embodiments, X... 3 For NH(C) 1-6 Alkyl). In some embodiments, X 3 For N(C) 1-6 Alkyl)2. In some embodiments, X 3 For COOH. In some embodiments, X 3 C 1-5 (COOH). In some embodiments, X 3For NHSO2Me. In some embodiments, X 3 C 1-5 (NHSO2Me).

[0795] In some embodiments, R 7 It is hydrogen. In some embodiments, R is... 7 It is a halogen. In some embodiments, R 7 C 1-6 Alkyl group. In some embodiments, R 7 C 3-7 Branched alkyl groups. In some embodiments, R 7 C 1-6 Haloalkyl. In some embodiments, R 7 C 3-7 Branched haloalkyl groups. In some embodiments, R 7 C 1-6 Alkyl group. In some embodiments, R 7 C 3-7 Branched alkoxy groups. In some embodiments, R 7 It is a hydroxyl group.

[0796] In some embodiments, R 8 C 1-6 Alkyl group. In some embodiments, R 8 C 1-6 Haloalkyl. In some embodiments, R 8 C 3-7 Branched haloalkyl groups. In some embodiments, R 8 C 1-6 Hydroxyalkyl. In some embodiments, R 8 C 3-7 Branched hydroxyalkyl group. In some embodiments, R 8 C 1-6 Alkyl group. In some embodiments, R 8 C 3-7 Branched alkoxy groups. In some embodiments, R 8 CO(C) 1-6 Alkyl). In some embodiments, R 8 CO(C) 3-7 Branched alkyl groups). In some embodiments, R 8 SO2(C 1-6 Alkyl). In some embodiments, R 8 SO2(C 3.7 Branched alkyl groups).

[0797] In some embodiments, R 8a It is hydrogen. In some embodiments, R is... 8a It is a halogen. In some embodiments, R8a C 1-6 Alkyl group. In some embodiments, R 8a C 3-7 Branched alkyl groups. In some embodiments, R 8a C 1-6 Haloalkyl. In some embodiments, R 8a C 3-7 Branched haloalkyl groups. In some embodiments, R 8a C 1-6 Hydroxyalkyl. In some embodiments, R 8a C 3-7 Branched hydroxyalkyl group. In some embodiments, R 8a hydroxyl group. In some embodiments, R... 8a C 1-6 Alkyl group. In some embodiments, R 8a C 3-7 Branched alkoxy groups. In some embodiments, R 8a For NHCO(C 1-6 Alkyl). In some embodiments, R 8a For NHCO(C 3-7 Branched alkyl groups). In some embodiments, R 8a For NHSO2(C 1-6 Alkyl). In some embodiments, R 8a For NHSO2(C 3-7 Branched alkyl groups).

[0798] In some embodiments, R 8b It is hydrogen. In some embodiments, R is... 8b It is a halogen. In some embodiments, R 8b C 1-6 Alkyl group. In some embodiments, R 8b C 3-7 Branched alkyl groups. In some embodiments, R 8b C 1-6 Haloalkyl. In some embodiments, R 8b C 3-7 Branched haloalkyl groups. In some embodiments, R 8b C 1-6 Hydroxyalkyl. In some embodiments, R 8b C 3-7 Branched hydroxyalkyl group. In some embodiments, R 8b hydroxyl group. In some embodiments, R... 8b C 1-6 Alkyl group. In some embodiments, R 8b C 3-7 Branched alkoxy groups. In some embodiments, R 8bFor NHCO(C 1-6 Alkyl). In some embodiments, R 8b For NHCO(C 3-7 Branched alkyl groups). In some embodiments, R 8b For NHSO2(C 1-6 Alkyl). In some embodiments, R 8b For NHSO2(C 3-7 Branched alkyl groups).

[0799] In some embodiments, R 8c It is hydrogen. In some embodiments, R is... 8c It is a halogen. In some embodiments, R 8c C 1-6 Alkyl group. In some embodiments, R 8c C 3-7 Branched alkyl groups. In some embodiments, R 8c C 1-6 Haloalkyl. In some embodiments, R 8c C 3-7 Branched haloalkyl groups. In some embodiments, R 8c C 1-6 Hydroxyalkyl. In some embodiments, R 8c C 3-7 Branched hydroxyalkyl group. In some embodiments, R 8c It is a hydroxyl group.

[0800] In some embodiments, R 8c C 1-6 Alkyl group. In some embodiments, R 8c C 3-7 Branched alkoxy groups. In some embodiments, R 8c For NHCO(C 1-6 Alkyl). In some embodiments, R 8c For NHCO(C 3-7 Branched alkyl groups). In some embodiments, R 8c For NHSO2(C 1-6 Alkyl). In some embodiments, R 8c For NHSO2(C 3-7 Branched alkyl groups).

[0801] In some embodiments, R 8d It is hydrogen. In some embodiments, R is... 8d It is a halogen. In some embodiments, R 8d C 1-6 Alkyl group. In some embodiments, R 8d C 3-7 Branched alkyl groups. In some embodiments, R8d C 1-6 Haloalkyl. In some embodiments, R 8d C 3-7 Branched haloalkyl groups. In some embodiments, R 8d C 1-6 Hydroxyalkyl. In some embodiments, R 8d C 3-7 Branched hydroxyalkyl group. In some embodiments, R 8d hydroxyl group. In some embodiments, R... 8d C 1-6 Alkyl group. In some embodiments, R 8d C 3-7 Branched alkoxy groups. In some embodiments, R 8d For NHCO(C 1-6 Alkyl). In some embodiments, R 8d For NHCO(C 3-7 Branched alkyl groups). In some embodiments, R 8d For NHSO2(C 1-6 Alkyl). In some embodiments, R 8d For NHSO2(C 3-7 Branched alkyl groups).

[0802] In some embodiments, R 9a It is hydrogen. In some embodiments, R is... 9a It is a halogen. In some embodiments, R 9a C 1-6 Alkyl group. In some embodiments, R 9a C 3-7 Branched alkyl groups. In some embodiments, R 9a C 1-6 Haloalkyl. In some embodiments, R 9a C 3-7 Branched haloalkyl groups. In some embodiments, R 9a C 1-6 Hydroxyalkyl. In some embodiments, R 9a C 3-7 Branched hydroxyalkyl group. In some embodiments, R 9a hydroxyl group. In some embodiments, R... 9a C 1-6 Alkyl group. In some embodiments, R 9a C 3-7 Branched alkoxy groups.

[0803] In some embodiments, R 9b It is hydrogen. In some embodiments, R is... 9b It is a halogen. In some embodiments, R 9b C1-6 Alkyl group. In some embodiments, R 9b C 3-7 Branched alkyl groups. In some embodiments, R 9b C 1-6 Haloalkyl. In some embodiments, R 9b C 3-7 Branched haloalkyl groups. In some embodiments, R 9b C 1-6 Hydroxyalkyl. In some embodiments, R 9b C 3-7 Branched hydroxyalkyl group. In some embodiments, R 9b hydroxyl group. In some embodiments, R... 9b C 1-6 Alkyl group. In some embodiments, R 9b C 3-7 Branched alkoxy groups.

[0804] In some embodiments, R 9a and R 9b Together they form a 3-membered ring. In some embodiments, R 9a and R 9b Together they form a 4-membered ring. In some embodiments, R 9a and R 9b Together they form a 5-membered ring. In some embodiments, R 9a and R 9b Together they form a 6-membered ring. In some embodiments, R 9a and R 9b Together they form a 7-membered ring. In some embodiments, R 9a and R 9b Together they form an optionally substituted 3-membered ring. In some embodiments, R 9a and R 9b Together they form an optionally substituted 4-membered ring. In some embodiments, R 9a and R 9b Together they form an optionally substituted 5-membered ring. In some embodiments, R 9a and R 9b Together they form an optionally substituted 6-membered ring. In some embodiments, R 9a and R 9b Together they form a 7-membered ring that can be arbitrarily substituted.

[0805] In some embodiments, q is 1. In some embodiments, q is 2. In some embodiments, q is 3.

[0806] In some embodiments, z is 0. In some embodiments, z is 1. In some embodiments, z is 2.

[0807] In some embodiments, R 10 It is hydrogen. In some embodiments, R is... 10 C 1-6 Alkyl group. In some embodiments, R 10 C 1-6 Haloalkyl. In some embodiments, R 10 C 3-7 Branched haloalkyl groups. In some embodiments, R 10 C 1-6 Hydroxyalkyl. In some embodiments, R 10 C 1-6 Alkyl group. In some embodiments, R 10 C 3-7 Branched alkoxy groups. In some embodiments, R 10 CO(C) 1-6 Alkyl). In some embodiments, R 10 CO(C) 3-7 Branched alkyl groups). In some embodiments, R 10 SO2(C 1-6 Alkyl). In some embodiments, R 10 SO2(C 3.7 Branched alkyl groups).

[0808] In some embodiments, R 11 It is hydrogen. In some embodiments, R is... 11 C 1-6 alkyl.

[0809] In some embodiments, R 12 It is hydrogen. In some embodiments, R is... 12 C 1-6 alkyl.

[0810] In some embodiments, the compounds or substructures of formulas (IA) and (I') do not include N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide; and / or 3-((6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2″-H-dispiro[cyclopropane-1,1'-cyclohexane-4',3″-imidazo[1,5-a]pyridine]-6″-yl)amino)pyrimidin-4-yl)amino)propionic acid).

[0811] The MNK inhibitors disclosed herein include compounds having the formula (LII) or pharmaceutically acceptable salt forms thereof:

[0812]

[0813] Where m and n 1 R 3' and R 2' As defined above.

[0814] Table 2 lists R 2' R 3' m and n 1 Examples, but not limited to, are given.

[0815] Table 2.

[0816]

[0817] The MNK inhibitors disclosed herein include compounds having the formula (LIII) or pharmaceutically acceptable salt forms thereof:

[0818]

[0819] Where R 3' R 2' n 1 Unrestricted instances of m are defined in Table 3 below in this paper.

[0820] Table 3.

[0821]

[0822] The MNK inhibitors disclosed herein include compounds having the formula (LIV) or pharmaceutically acceptable salt forms thereof:

[0823]

[0824] Where R 3' R 4f and n 1 Non-restrictive instances are defined in Table 4 below in this paper.

[0825] Table 4.

[0826]

[0827] In some embodiments, the MNK inhibitor is a compound selected from the following:

[0828] N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-3',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide;

[0829] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-bispiro[cyclopropane-1,1'-cyclohexane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0830] N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide;

[0831] N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclopropane-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide;

[0832] N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclobutane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide;

[0833] 6''-((6-(cyclopropanecarbamoyl)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclopropane-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1-carboxylic acid benzyl ester;

[0834] 6''-((6-(cyclopropanecarbamoyl)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclobutane-3,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1-carboxylic acid tert-butyl ester;

[0835] N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclobutane-3,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide;

[0836] 6''-((6-((2-hydroxyethyl)amino)pyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0837] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-bispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0838] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclopropane-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1-carboxylic acid benzyl ester;

[0839] 1-(aminomethyl)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropane-1-carboxamide;

[0840] (1R,5S,6r)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-3-azabicyclo[3.1.0]hexane-6-carboxamide;

[0841] N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-2-azaspiro[3.3]heptane-6-carboxamide;

[0842] 2-Methyl-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-2-azaspiro[3.3]heptane-6-carboxamide;

[0843] (1R,5S,6r)-3-methyl-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-3-azabicyclo[3.1.0]hexane-6-carboxamide;

[0844] N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-1-(methanesulfonamide methyl)cyclopropane-1-carboxamide;

[0845] 1-((dimethylamino)methyl)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropane-1-carboxamide;

[0846] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0847] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[azacyclopropane-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0848] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-bispiro[cyclopropane-1,1'-cyclopentane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0849] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopentane-1,1'-cyclopentane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0850] 6''-((6-aminopyrimidin-4-yl)amino)-3,3-difluoro-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0851] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopentane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0852] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0853] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclohexane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0854] 6''-((6-(cyclopropanecarbamoyl)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-2-carboxylic acid ethyl ester;

[0855] (6''-((6-(cyclopropanecarbamoyl)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-2-yl)tert-butyl carbamate;

[0856] N-(6-((2,2''-difluoro-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide;

[0857] 6''-((6-aminopyrimidin-4-yl)amino)-2,2-difluoro-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0858] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cycloheptane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione;

[0859] 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-bispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-2'-ene-1'',5''-dione;

[0860] Or its pharmaceutically acceptable salt.

[0861] MNK inhibitors of formula (IB)

[0862] In some embodiments, the MNK inhibitor is a compound of formula (IB):

[0863]

[0864] (IB)

[0865] Or its pharmaceutically acceptable salt, wherein:

[0866] W 1 and W 2 It can be independently O, S or N-OR', where R' is a lower alkyl group;

[0867] Y is ‒N(R) 5” )‒, -O-, -S-, -C(O)-, -S=O, -S(O)2- or ‒CHR 9 ‒;

[0868] R 1” It is hydrogen, a lower alkyl, cycloalkyl or heterocyclic group, wherein any lower alkyl, cycloalkyl or heterocyclic group is optionally substituted with 1, 2 or 3 J groups;

[0869] n 2 It can be 1, 2, or 3;

[0870] R 2” and R 3” Each is independently hydrogen, alkyl, alkenyl, alkynyl, aryl, arylalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclic or heterocyclic alkylene, wherein any alkyl, aryl, arylalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclic or heterocyclic alkylene is optionally substituted with 1, 2 or 3 J groups;

[0871] Or R 2” and R 3”Together with the carbon atoms to which they are attached, they form cycloalkyl or heterocyclic groups, wherein any cycloalkyl or heterocyclic group is optionally substituted with one, two or three J groups;

[0872] R 4a” and R 4b” Each can be independently hydrogen, halogen, hydroxyl, thiol, hydroxyalkylene, cyano, alkyl, alkoxy, acyl, thioalkyl, alkenyl, alkynyl, cycloalkyl, aryl, or heterocyclic.

[0873] R 5” It is hydrogen, cyano, or a lower alkyl group;

[0874] Or R 5” and R 8 Together with the atoms they are attached to, they form fused heterocyclic groups that are optionally substituted with 1, 2 or 3 J groups;

[0875] R 6” R 7” and R 8 Each of the following groups is independently hydrogen, hydroxyl, halogen, cyano, amino, alkyl, alkenyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkyleneyl, alkylamino, alkylcarbonylamino, cycloalkylcarbonylamino, cycloalkylamino, heterocyclic amino, heteroaryl, or heterocyclic, and any of the amino, alkyl, alkenyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkyleneyl, amino, alkylamino, alkylcarbonylamino, cycloalkylcarbonylamino, cycloalkylamino, heterocyclic amino, heteroaryl, or heterocyclic groups may optionally be substituted with one, two, or three J groups;

[0876] Or R 7” and R 8 Together with the atoms to which they are attached, they form fused heterocyclic or heteroaryl groups optionally substituted with one, two, or three J groups;

[0877] J is ‒SH, -SR 9 -S(O)R 9 -S(O)2R 9 -S(O)NH2, -S(O)NR 9 R 9 -NH2, -NR 9 R 9 -COOH, -C(O)OR 9 -C(O)R 9 -C(O)-NH2, -C(O)-NR 9 R 9 , hydroxyl, cyano, halogen, acetyl, alkyl, lower alkyl, alkenyl, alkynyl, alkoxy, haloalkyl, thioalkyl, cyanide, alkylamino, NH2-C(O)-alkylene, NR 9R 9 -C(O)-alkylene, -CHR 9 -C(O)-lower alkyl, -C(O)-lower alkyl, alkylcarbonylamino, cycloalkyl, cycloalkylalkylene, cycloalkyleneyl, cycloalkylcarbonylamino, cycloalkylamino, -CHR 9 -C(O)-cycloalkyl, -C(O)-cycloalkyl, -CHR 9 -C(O)-aryl, -CHR 9 -Aryl, -C(O)-Aryl, -CHR 9 -C(O)-heterocyclic alkyl, -C(O)-heterocyclic alkyl, heterocyclic amino, or heterocyclic group; or any two J groups bonded to the same carbon or heteroatom may together form an oxo group; and

[0878] R 9 It can be hydrogen, a lower alkyl group, or -OH.

[0879] The following definitions apply to formula (IB) and its subgenus:

[0880] "Amino" refers to the -NH2 substituent.

[0881] "Amino carbonyl" refers to the C(O)NH2 substituent.

[0882] "Carboxyl group" refers to the CO2H substituent.

[0883] "Carbonyl" refers to a C(O)- or C(=O)- group.

[0884] "Cyano" refers to the C≡N substituent.

[0885] "Cyanidene" refers to the -(alkylenene)C≡N substituent.

[0886] "Acetyl" refers to the C(O)CH3 substituent.

[0887] "Hydroxy" or "hydroxyl" refers to the -OH substituent.

[0888] "Hydroxyalkylene" refers to the -(alkylene)OH substituent.

[0889] "Oxyto" refers to the oxygen in the O-substituent.

[0890] "Thio" or "thiol" refers to the SH substituent.

[0891] "alkyl" refers to a saturated straight-chain or branched hydrocarbon radical composed only of carbon and hydrogen atoms, having one to twelve carbon atoms (C1-C2). 12An alkyl group is a radical consisting of one to eight carbon atoms (C1-C8 alkyl) or one to six carbon atoms (C1-C6 alkyl), and the radical is attached to the rest of the molecule by a single bond. Examples of alkyl groups include methyl, ethyl, n-propyl, 1-methylethyl (isopropyl), n-butyl, n-pentyl, 1,1-dimethylethyl (tert-butyl), 3-methylhexyl, 2-methylhexyl, etc.

[0892] "Lower alkyl" has the same meaning as alkyl as defined above, but has one to four carbon atoms (C1-C4 alkyl).

[0893] "Alkenyl" refers to an unsaturated alkyl group that has at least one double bond and two to twelve carbon atoms (C2-C4). 12 The alkenyl group consists of two to eight carbon atoms (C2-C8 alkenyl) or two to six carbon atoms (C2-C6 alkenyl), and is connected to the rest of the molecule by a single bond. Examples of alkenyl groups include vinyl, propenyl, butenyl, pentenyl, hexenyl, etc.

[0894] "Alkynyl" refers to an unsaturated alkyl group that has at least one triple bond and two to twelve carbon atoms (C2-C4). 12 alkynyl group), two to ten carbon atoms (C2-C) 10 The alkynyl group consists of two to eight carbon atoms (C2-C6 alkynyl) or two to six carbon atoms (C2-C6 alkynyl), and the group is connected to the rest of the molecule by a single bond. Examples of alkynyl groups include ethynyl, propynyl, butynyl, pentynyl, hexynyl, etc.

[0895] "alkylene" or "alkylene chain" refers to a straight-chain or branched divalent hydrocarbon (alkyl) chain consisting only of carbon and hydrogen, where the rest of the molecule is attached to a free radical group. Alkylenes can have one to twelve carbon atoms, such as methylene, ethylene, propylene, n-butene, etc. The alkylene chain is attached to the rest of the molecule by a single or double bond. The attachment point between the alkylene chain and the rest of the molecule can be one carbon or any two carbons within the chain. "Optionally substituted alkylene" refers to an alkylene or a substituted alkylene.

[0896] "Alkenyl" refers to a divalent olefin. Examples of alkenyl groups include, but are not limited to, vinylidene (-CH=CH-) and all its stereoisomers and conformational isomers. "Substituted alkenyl" refers to a divalent substituted olefin. "Optionally substituted alkenyl" refers to an alkenyl group or a substituted alkenyl group.

[0897] "Imyynyl" refers to a divalent alkyne. Examples of ynyl groups include, but are not limited to, ethynylene and propynylene. "Substituted ynyl" refers to a divalent alkyne that has been substituted.

[0898] "Alkoxy" refers to the formula -ORa free radicals, of which R a An alkyl group having the specified number of carbon atoms as defined above. Examples of alkoxy groups include, but are not limited to, -O-methyl (methoxy), -O-ethyl (ethoxy), -O-propyl (propoxy), -O-isopropyl (isopropoxy), etc.

[0899] "Acyl" refers to the formula ‒C(O)R a free radicals, of which R a It is an alkyl group having a specified number of carbon atoms.

[0900] "alkylamino" refers to the formula -NHR a or -NR a R a free radicals, where each R a Independently refers to an alkyl group having the specified number of carbon atoms as defined above.

[0901] "Cycloalkylamino" refers to the formula -NHR a free radicals, of which R a It is a cycloalkyl radical as defined in this article.

[0902] "alkylcarbonylamino" refers to the formula ‒NHC(O)R a free radicals, of which R a It is an alkyl radical having the specified number of carbon atoms as defined above.

[0903] "Cycloalkylcarbonylamino" refers to the formula -NHC(O)R a free radicals, of which R a It is a cycloalkyl radical as defined above.

[0904] "alkylaminocarbonyl" refers to the formula -C(O)NHR a or -C(O)NR a R a free radicals, where each R a Independently, it is an alkyl radical having a specified number of carbon atoms as defined above.

[0905] "Cycloalkylaminocarbonyl" refers to the formula -C(O)NHR a free radicals, of which R a It is a cycloalkyl radical as defined in this article.

[0906] "Aryl" refers to a hydrocarbon cyclic radical comprising hydrogen, 6 to 18 carbon atoms, and at least one aromatic ring. Exemplary aryl radicals are hydrocarbon cyclic radicals comprising hydrogen, 6 to 9 carbon atoms, and at least one aromatic ring; hydrocarbon cyclic radicals comprising hydrogen, 9 to 12 carbon atoms, and at least one aromatic ring; hydrocarbon cyclic radicals comprising hydrogen, 12 to 15 carbon atoms, and at least one aromatic ring; or hydrocarbon cyclic radicals comprising hydrogen, 15 to 18 carbon atoms, and at least one aromatic ring. For the purposes of this invention, aryl radicals can be monocyclic, bicyclic, tricyclic, or tetracyclic ring systems, which may include fused or bridged ring systems. Aryl radicals include, but are not limited to, aryl radicals derived from anthracene, acenaphthene, phenanthrene, anthracene, azulene, benzene, benzo[a], fluorene, as-indole, s-indole, indene, indene, naphthalene, phenanthracene, heptamethrin, pyrene, and benzo[a]phenanthrene. "Optionally substituted aryl" refers to an aryl group or a substituted aryl group.

[0907] "Aromatic" means divalent aryl, and "substituted aryl" refers to divalent substituted aryl.

[0908] "Arane" or "aranediene" are used interchangeably and refer to the formula -R b -R c free radicals, of which R b For alkylene chains as defined herein, and R c It is one or more aryl radicals as defined herein, such as benzyl, diphenylmethyl, etc.

[0909] "Cycloalkyl" refers to a stable non-aromatic monocyclic or polycyclic hydrocarbon radical consisting only of carbon and hydrogen atoms. This radical may include fused or bridged ring systems and has three to fifteen carbon atoms, preferably three to ten, three to nine, three to eight, three to seven, three to six, three to five, a four-carbon ring, or a three-carbon ring. The cycloalkyl ring may be saturated or unsaturated and is connected to the rest of the molecule by a single bond. Monocyclic radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic radicals include, for example, adamantyl, norbornyl, decahydronaphthyl, 7,7-dimethyl-bicyclo[2.2.1]heptyl, etc.

[0910] "Cycloalkylene" or "cycloalkylalkyl" are used interchangeably and refer to the formula -RbR e The free radical, wherein Rb is an alkylene chain as defined herein, and R e It is a cycloalkyl radical as defined herein. In some embodiments, R bFurther substitution with cycloalkyl groups results in a cycloalkylalkylene group comprising two cycloalkyl moieties. Cyclopropylalkylene and cyclobutylalkylene are exemplary cycloalkylalkylene groups, each comprising at least one cyclopropyl group or at least one cyclobutyl group.

[0911] "Fused" refers to any ring structure fused with the existing ring structure in the compounds of this invention. When the fused ring is a heterocyclic or heteroaryl ring, any carbon atom in the existing ring structure that is part of the fused heterocyclic or heteroaryl ring may be replaced by a nitrogen atom.

[0912] "Halogen" or "halogen" refers to bromine, chlorine, fluorine, or iodine.

[0913] "Haloalkyl" refers to an alkyl radical having a specified number of carbon atoms as defined herein, wherein one or more hydrogen atoms of the alkyl group are substituted with a halogen (haloradical) as defined above. The halogen atoms may be the same or different. Exemplary haloalkyl groups are trifluoromethyl, difluoromethyl, trichloromethyl, 2,2,2-trifluoroethyl, 1,2-difluoroethyl, 3-bromo-2-fluoropropyl, 1,2-dibromoethyl, etc.

[0914] "Heterocyclic group," "heterocycle," or "heterocycle" refers to a stable 3- to 18-membered saturated or unsaturated free radical composed of two to twelve carbon atoms and one to six heteroatoms, such as one to five heteroatoms, one to four heteroatoms, one to three heteroatoms, or one to two heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. Exemplary heterocycles include, but are not limited to, stable 3- to 15-membered saturated or unsaturated free radicals, stable 3- to 12-membered saturated or unsaturated free radicals, stable 3- to 9-membered saturated or unsaturated free radicals, stable 8-membered saturated or unsaturated free radicals, stable 7-membered saturated or unsaturated free radicals, stable 6-membered saturated or unsaturated free radicals, or stable 5-membered saturated or unsaturated free radicals.

[0915] Unless otherwise specified in the specification, the heterocyclic radical can be a monocyclic, bicyclic, tricyclic, or tetracyclic system, which may include fused or bridged ring systems; and the nitrogen, carbon, or sulfur atom in the heterocyclic radical may optionally be oxidized; the nitrogen atom may optionally be quaternized; and the heterocyclic radical may be partially or fully saturated. Examples of non-aromatic heterocyclic radicals include, but are not limited to, azacyclic butyl, dioxopentyl, thienyl[1,3]dithiaalkyl, decahydroisoquinolinyl, imidazolinyl, imidazoalkyl, isothiazolyl, isoxazolyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopiperylyl, oxazolyl, piperidinyl, piperazinyl, 4-piperidinoneyl, pyrrolylyl, pyrazolylyl, quininecycloyl, thiazoalkyl, tetrahydrofuranyl, cyclothioethanel, trithiaalkyl, tetrahydropyranyl, thiomorpholinyl, thiozamorpholinyl, 1-oxo-thiomorpholinyl, and 1,1-dioxo-thiomorpholinyl. Heterocyclic groups include heteroaryl groups as defined herein, and examples of aromatic heterocyclic groups are listed in the definition of heteroaryl groups below.

[0916] "Heterocyclic alkyl" or "heterocyclic alkylene" refers to formula -R b R f free radicals, of which R b It is an alkylene chain as defined herein, and R f It is a heterocyclic radical as defined above, and if the heterocyclic radical is a nitrogen-containing heterocyclic radical, the heterocyclic radical may be attached to an alkyl radical at the nitrogen atom.

[0917] "Heteroaryl" or "heteroarylene" refers to a 5- to 14-membered ring radical comprising a hydrogen atom, one to thirteen carbon atoms, one to six heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur, and at least one aromatic ring. For the purposes of this invention, the heteroaryl radical can be a stable 5- to 12-membered ring, a stable 5- to 10-membered ring, a stable 5- to 9-membered ring, a stable 5- to 8-membered ring, a stable 5- to 7-membered ring, or a stable 6-membered ring, comprising at least one heteroatom, at least two heteroatoms, at least three heteroatoms, at least four heteroatoms, at least five heteroatoms, or at least six heteroatoms. The heteroaryl radical can be a monocyclic, bicyclic, tricyclic, or tetracyclic system, which may include fused or bridged ring systems; and the nitrogen, carbon, or sulfur atom in the heteroaryl radical may optionally be oxidized; the nitrogen atom may optionally be quaternized. The heteroatom may be a member of an aromatic ring or a non-aromatic ring, provided that at least one ring in the heteroaryl radical is an aromatic ring. Examples include, but are not limited to, acrylonitrile, benzimidazolyl, benzothiazolyl, benzoindolyl, benzodioxacyclopentenyl, benzofuranyl, benzooxazolyl, benzothiazolyl, benzothiadiazolyl, benzo[b][1,4]dioxacycloheptyl, 1,4-benzodioxyl, benzonaphthuryl, benzooxazolyl, benzodioxacyclopentenyl, benzodioxinyl, benzopyranyl, benzopyranoneyl, benzofuranyl, benzofuranoneyl, benzothiopheneyl (benzophenylthio), benzotriazolyl, benzo[4,6]imidazo[1,2-a]pyridyl, carbazoleyl, cenyl, dibenzofuranyl, dibenzophenylthio, furanyl, furanoneyl, isothiazolyl Imidazolyl, indazole, indolyl, indazole, isoindolyl, indololinyl, isoindololinyl, isoquinolinyl, indazinyl, isoxazolyl, naphridinyl, oxadiazolyl, 2-oxoachenginyl, oxazolyl, ethylene oxide, 1-pyridinyl oxide, 1-pyrimidinyl oxide, 1-pyrazinyl oxide, 1-pyridazinyl oxide, 1-phenyl-1H-pyrroleyl, phenazinyl, phenothiazinyl, phenothiazinyl, phthalazinyl, pteridinyl, purine, pyrroleyl, pyrazolyl, pyridinyl, pyridinyl, pyrazinyl, pyrimidinyl, pyridazinyl, quinazolinyl, quinoxalinyl, quininecycloyl, isoquinolinyl, tetrahydroquinolinyl, thiazolyl, thiadiazolyl, triazolyl, tetrazolyl, triazinyl, and phenylthio (i.e., thiophene).

[0918] "Heteroarylalkyl" or "heteroarylalkylene" refers to formula -R b R g free radicals, of which R b It is an alkylene chain as defined above, and R g It is a heteroaryl free radical as defined above.

[0919] "Thioalkyl" refers to the formula -SR a free radicals, of which R aAn alkyl radical as defined above contains one to twelve carbon atoms, at least one to ten carbon atoms, at least one to eight carbon atoms, at least one to six carbon atoms, or at least one to four carbon atoms.

[0920] "Heterocyclic amino" refers to formula ‒NHR f free radicals, of which R f It is a heterocyclic radical as defined in this paper.

[0921] "Thione" refers to the =S group attached to a carbon atom of a saturated or unsaturated (C3-C8) cyclic or (C1-C8) acyclic moiety.

[0922] "Syranoxide" refers to the -S(O)- group, in which a sulfur atom is covalently bonded to two carbon atoms.

[0923] "Sulfone" refers to the ‒S(O)2- group, in which hexavalent sulfur is connected to each of the two oxygen atoms through a double bond, and further connected to the two carbon atoms through a single covalent bond.

[0924] The term "oxime" refers to C(R) a )=N-OR a Free radicals, where R a It is a hydrogen, lower alkyl, alkylene, or aryl group, as defined above.

[0925] The compounds disclosed herein can exist in various isomeric forms, as well as in one or more tautomeric forms, including both single tautomers and mixtures of tautomers. The term "isomer" is intended to cover all isomeric forms of the compounds of the present invention, including tautomeric forms of the compounds.

[0926] Some of the compounds described herein may have an asymmetric center and thus exist in different enantiomers and diastereomers. The compounds of this disclosure may be in the form of optical isomers or diastereomers. Therefore, this disclosure covers the compounds of this disclosure as described herein and their uses therein, in the form of optical isomers, diastereomers, and mixtures thereof (including racemic mixtures). Optical isomers of the compounds of this disclosure can be obtained by known techniques (such as asymmetric synthesis, chiral chromatography) or by chemical separation of stereoisomers using optically active resolving agents.

[0927] In some embodiments, the MNK inhibitor is a compound selected from Table 5 or a pharmaceutically acceptable salt thereof.

[0928] Table 5.

[0929]

[0930] Compositions and methods

[0931] In another aspect, the present invention provides a pharmaceutical composition comprising a type I interferon inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in patients and / or a combination of one or more therapeutic agents for treating rheumatoid arthritis with a pharmaceutically acceptable carrier, diluent or excipient.

[0932] For example, in a preferred embodiment, the present invention provides a pharmaceutical composition comprising an MNK inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in patients and / or a combination of one or more therapeutic agents for treating rheumatoid arthritis with a pharmaceutically acceptable carrier, diluent, or excipient. The MNK inhibitor may be a small molecule, an antibody, or a portion thereof; but preferably selected from the group consisting of: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

[0933] The term "therapeutic agent for treating RA-associated pain in a patient" as used herein means a known and / or clinically approved therapeutic agent, a therapeutic agent in clinical trials, or a therapeutic agent under development for or to be used for treating RA-associated pain. In one embodiment, the therapeutic agent for treating RA-associated pain in a patient is any of the pain treatments listed herein.

[0934] Unbound by conventional wisdom, type I interferon inhibitors can complement treatments used to treat RA-associated pain in patients. As discussed in this article, currently approved pain management methods have numerous drawbacks and side effects, and therefore, combination therapy with type I interferon inhibitors may be helpful for RA-associated pain.

[0935] The term "therapeutic agents for RA" as used here refers to known and / or clinically approved therapeutic agents, therapeutic agents in clinical trials, or therapeutic agents under development for or intended for the treatment or prevention of RA. A therapeutic agent is considered effective for treating RA when a patient enters a state of inactive RA inflammatory disease and / or remission.

[0936] Treatment agents used to treat RA may include, but are not limited to, "classic" DMARDs such as methotrexate (also known as amethopterin), leflunomide, hydroxychloroquine, and / or sulfasalazine. It should be understood that RA patients are often given a combination of these drugs as initial treatment. If RA cannot be controlled with classic DMARDs, methotrexate is often administered in combination with "biological" DMARDs such as abatacept (Orencia), adalimumab (Humira), anakinra (Kineret), certolizumab (Cimzia), etanercept (Enbrel), golimumab (Simponi), infliximab (Remicade), rituximab (Rituxan), sarilumab (Kevzara), tocilizumab (Actemra), or combinations thereof. In addition, if both "classical" and "biological" DMARDs are ineffective, "targeted synthetic" DMARDs can be used. Such "targeted synthetic" DMARDs may include Janus kinase (JAK) inhibitors, such as baricitinib (Olumiant), tofacitinib (Xeljanz), upadacitinib (Rinvoq), or combinations thereof.

[0937] Unbound by conventional wisdom, type I interferon inhibitors can complement therapeutic agents used to treat rheumatoid arthritis (RA). As discussed here, many therapeutic agents for RA are ineffective or suboptimal in treating the pain component of RA, although they are effective in treating the inflammatory component. Therefore, type I interferon inhibitors can be used in combination with therapeutic agents for RA to manage both pain and inflammatory disease activity simultaneously.

[0938] The pharmaceutical compositions according to the invention can be administered together with suitable pharmaceutically acceptable carriers, excipients, and other agents incorporated into the formulation to provide improved transfer, delivery, tolerability, etc.

[0939] Our use of "pharmaceutical acceptable" includes formulations that are sterile and pyrogen-free. Suitable pharmaceutically acceptable carriers, excipients, or diluents are well known in the pharmaceutical field. A pharmaceutically acceptable carrier, excipient, or diluent must be "acceptable," meaning it is compatible with the pharmaceutical preparations of this invention and harmless to its recipient. Typically, a pharmaceutically acceptable carrier, excipient, or diluent would be sterile and pyrogen-free water or physiological saline; however, other pharmaceutically acceptable carriers, excipients, or diluents may be used.

[0940] Suitable pharmaceutically acceptable carrier, excipient, or diluent materials that can be used in the compositions of the present invention include the following related materials that, under normal storage conditions, are suitably combined for (and / or approved for) pharmaceutical use and / or delivery, and are able to maintain their physical and / or chemical integrity, and / or do not affect the physical and / or chemical integrity of any active ingredient and / or any other component that may be present in the composition.

[0941] The term "pharmaceutically acceptable carrier" also includes excipients or stabilizers that are non-toxic to cells or mammals exposed to them at the doses and concentrations used. Typically, pharmaceutically acceptable carriers are pH-buffered aqueous solutions. Examples of pharmaceutically acceptable carriers include buffers such as phosphates, citrates, and other organic acids; antioxidants, including ascorbic acid and methionine; preservatives (such as octadecyl dimethyl benzyl ammonium chloride; hexamethyl ammonium chloride; benzalkonium chloride, benzyl chloride; phenol, butanol, or benzyl alcohol; alkyl esters of parabens, such as methylparaben or propylparaben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) peptides; and proteins such as serum albumin, gelatin, or immunoglobulins. Hydrophilic polymers, such as polyvinylpyrrolidone; amino acids, such as glycine, glutamine, asparagine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates, including glucose, mannose, or dextrin; chelating agents, such as EDTA; sugars, such as sucrose, mannitol, trehalose, or sorbitol; salt-forming counterions, such as sodium; metal complexes (e.g., zinc-protein complexes); and / or nonionic surfactants, such as TWEEN™, polyethylene glycol (PEG), and PLURONICS™ or polyethylene glycol (PEG).

[0942] The term "diluent" as used here refers to a pharmaceutically acceptable (i.e., safe and non-toxic for individual (such as human) administration) diluent that can be used to prepare liquid formulations (such as lyophilized and reconstituted formulations). Exemplary diluents include sterile water, water for injection with antimicrobial properties (BWFI), pH buffer solutions (e.g., phosphate-buffered saline), sterile saline solutions, Ringer's solution, or dextran solution. In alternative embodiments, the diluent may comprise an aqueous solution of salts and / or buffers.

[0943] In another aspect, the present invention provides pharmaceutical compositions for treating or preventing pain associated with rheumatoid arthritis in patients, as defined herein. In a preferred embodiment of this aspect of the invention, the pharmaceutical composition is a pharmaceutical composition comprising an MNK inhibitor, such as an inhibitor selected from the group consisting of: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

[0944] In another aspect, the present invention provides the use of a pharmaceutical composition as defined herein in the manufacture of a medicament for treating or preventing pain associated with rheumatoid arthritis in patients. In a preferred embodiment of this aspect of the invention, the pharmaceutical composition is a pharmaceutical composition comprising an MNK inhibitor, such as an inhibitor selected from the group consisting of: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

[0945] In another aspect, the present invention provides a method for treating or preventing pain associated with rheumatoid arthritis in a patient, the method comprising the step of administering a pharmaceutical composition as defined herein to the patient. In a preferred embodiment of this aspect of the invention, the pharmaceutical composition is a pharmaceutical composition comprising an MNK inhibitor, such as an inhibitor selected from the group consisting of: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

[0946] It should be understood that the various delivery systems that can be used to administer the drug composition will be those defined for administering type I interferon inhibitors to patients.

[0947] Clinicians may determine the most suitable administration regimen for a patient based on factors such as the patient's weight, age, sex, diagnosis or prognosis, and the half-life of the therapeutic molecule being administered. However, it is often appropriate to treat the patient with a single or multiple doses of an effective amount of a type I interferon inhibitor or a pharmaceutical composition according to the aspects of this document. In the case of multiple administrations, administration may be performed at frequencies such as once, twice, three times, four times, or more per day, week, or month, and may continue for a period of time necessary and effective in treating or preventing RA-related pain in the patient, thereby achieving a beneficial therapeutic or preventative effect. For example, treatment may continue for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 days or more, weeks, months, or years, or even for the remainder of the patient's life. In the case of using type I interferon inhibitors, the most common practice is to administer once a week, or once or twice a month, and continue as long as clinical benefit is desired.

[0948] This also includes methods for treating or preventing RA-related pain in a patient, as well as methods for treating or preventing RA itself, comprising the step of administering a pharmaceutical composition as defined herein to the patient. This would allow for the simultaneous management of disease and pain using a pharmaceutical composition as defined herein. In a preferred embodiment of this aspect of the invention, the pharmaceutical composition is a pharmaceutical composition comprising an MNK inhibitor, such as an inhibitor selected from: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

[0949] In another aspect, the present invention provides a kit comprising a type I interferon inhibitor and one or more therapeutic agents for treating rheumatoid arthritis. In a preferred embodiment of this aspect of the invention, the type I interferon inhibitor is an MNK inhibitor, such as an inhibitor selected from the group consisting of: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

[0950] In another aspect, the present invention provides a method for identifying patients with pain associated with rheumatoid arthritis who require treatment with type I interferon inhibitors, the method comprising the following steps:

[0951] (a) Provide test samples from patients with pain associated with rheumatoid arthritis;

[0952] (b) Determine the level of type I interferon signal transduction in the test sample; and

[0953] (c) As determined in step (b), the patient is identified as a patient who requires treatment with a type I interferon inhibitor.

[0954] When we say "patients who need treatment with type I interferon inhibitors," we mean patients who may benefit from type I interferon inhibitor therapy. For example, in an individual with RA, such a type I interferon inhibitor will improve their health condition (e.g., by reducing or stopping pain symptoms). In another embodiment, such type I interferon inhibitor therapy will reduce the likelihood that a patient will begin to experience pain before they have already developed it.

[0955] The term "test sample" includes any biological sample from a patient for testing in the methods and uses of the present invention. It should be understood that a test sample may comprise one or more tissues, cells, and / or biological fluids (e.g., blood, skin, synovium, synovial fluid, sensory ganglia, serum, plasma, serum plasma, urine, saliva, intestinal cells, biopsy samples (such as muscle biopsy samples), feces) taken from a patient (such as those isolated from the patient).

[0956] It should also be understood that the methods and uses of the present invention can be performed using tissues, cells, and / or biological fluids (when present within an individual). Therefore, the detection methods of the present invention can be used to detect viral infection in test samples both in vitro and in vivo. Preferably, the test sample is serum plasma, which has preferably been isolated from an individual.

[0957] The "level of type I interferon signaling" we refer to includes intracellular type I interferon signaling, the level of type I interferon, activation of type I interferon receptors, expression of type I interferon-stimulated genes, and expression of type I interferon-repressed genes. This article discusses the methods used to determine these levels.

[0958] One method for stratifying patients diagnosed with SLE uses the level of type I interferon signaling in test samples to predict the risk of (i) a higher risk of disease severity and (ii) a risk of developing lupus nephritis. The DxCollect® microacquisition device (from DxTerity®) measures the relative expression of four messenger RNAs (mRNAs) of the type I interferon response gene via PCR and capillary electrophoresis. The patient's interferon status is then classified as high (above -0.5) or low / normal (equal to or below -0.5). In some embodiments, this microacquisition device can be used to identify patients with RA-associated pain who require treatment with type I interferon inhibitors.

[0959] Preferably, the method defined herein further includes the step of administering a type I interferon inhibitor to the patient. In a preferred embodiment of this aspect of the invention, the type I interferon inhibitor is an MNK inhibitor, such as an inhibitor selected from the group consisting of: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

[0960] In another aspect, the present invention provides a type I interferon inhibitor, or use, or method, or composition or kit for use, which is substantially as described herein with reference to the appended specification, examples, drawings and / or claims.

[0961] In the claims and / or specification, when used in conjunction with the term “comprising,” the use of the word “a / an” may mean “one,” but is also consistent with “one or more,” “at least one,” and “one or more than one.”

[0962] These and other embodiments of the invention will be better understood and appreciated when considered in conjunction with the foregoing description and the accompanying drawings. However, it should be understood that while the foregoing description illustrates various embodiments of the invention and their numerous specific details, it is given by way of illustration rather than limitation. Many substitutions, modifications, additions, and / or rearrangements can be made within the scope of the invention without departing from its spirit, and the invention encompasses all such substitutions, modifications, additions, and / or rearrangements.

[0963] The enumeration or discussion of obviously previously disclosed documents in this specification is not necessarily an admission that such documents are part of the prior art or common general knowledge.

[0964] Exemplary embodiments

[0965] The following examples are not limiting, but are examples of certain aspects of this disclosure:

[0966] 1. A type I interferon inhibitor for the treatment or prevention of pain associated with rheumatoid arthritis in patients.

[0967] 2. Use of type I interferon inhibitors in the preparation of medicaments for the treatment or prevention of pain associated with rheumatoid arthritis in patients.

[0968] 3. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, the method comprising the step of administering a type I interferon inhibitor to the patient.

[0969] 4. The type I interferon inhibitor, or use or method of use according to any one of Examples 1 to 3, wherein the pain is functional pain, such as inflammatory joint pain.

[0970] 5. The type I interferon inhibitor, or use or method of use according to any one of Examples 1 to 3, wherein the pain is not inflammatory pain.

[0971] 6. The type I interferon inhibitor, or use or method of use, provided according to any of the foregoing embodiments, wherein the pain is not neuropathic pain or neuroplastic pain.

[0972] 7. The type I interferon inhibitor, or use or method of use, provided according to any of the foregoing embodiments, wherein the pain is chronic pain; for example, pain that has lasted for three months or longer, six months or longer, twelve months or longer.

[0973] 8. The type I interferon inhibitor, or use or method of use according to any of the foregoing embodiments, wherein the pain is selected from one or more of the following: pain hypersensitivity; touch-induced pain; hyperalgesia; arthralgia.

[0974] 9. The type I interferon inhibitor, or use or method of use, according to any of the foregoing embodiments, wherein the pain is associated with and / or caused by:

[0975] - Systemic inflammation; and / or

[0976] - Local inflammation; and / or

[0977] - Clinical inflammation.

[0978] 10. The type I interferon inhibitor, or use or method of use, provided according to any of the foregoing embodiments, wherein the pain is not associated with and / or caused by inflammatory disease activity of rheumatoid arthritis.

[0979] 11. The type I interferon inhibitor, or use or method of use according to any of the foregoing embodiments, wherein the pain is located in the affected joint and / or the contralateral part of the affected joint and / or the cephalic part of the affected joint and / or the caudal part of the affected joint.

[0980] 12. The type I interferon inhibitor, or use or method, provided for use according to any of the foregoing embodiments, wherein the type I interferon inhibitor does not prevent or treat inflammatory diseases with enhanced type I interferon signaling.

[0981] 13. The type I interferon inhibitor, or its use or method, provided according to any of the foregoing embodiments, wherein:

[0982] -The pain is accompanied by inflammation of the disease; and / or

[0983] - The pain persists after the inflammation of the disease subsides.

[0984] 14. The type I interferon inhibitor, or use or method of use according to any of the foregoing embodiments, wherein the patient has received or is receiving pain treatment, but the pain persists and / or recurs and / or progresses.

[0985] 15. The type I interferon inhibitor, or use or method of use, as described in Example 14, wherein the pain treatment is selected from the group consisting of: nonsteroidal anti-inflammatory drugs (NSAIDs), such as celecoxib, diclofenac, etoricoxib, ibuprofen, naproxen; steroids, such as corticosteroids, glucocorticoids; acetaminophen; opioids, such as codeine, dextropropoxyphene, tramadol; antidepressants, such as tricyclic antidepressants; anticonvulsants; or combinations thereof.

[0986] 16. The type I interferon inhibitor, or use or method of use according to any of the foregoing embodiments, wherein the pain is associated with and / or caused by enhanced type I interferon signaling in the patient.

[0987] 17. The type I interferon inhibitor, or use or method, according to Example 16, wherein enhanced type I interferon signaling comprises:

[0988] - Enhanced intracellular signal transduction of type I interferon in the patient's body;

[0989] - The patient's elevated levels of type I interferon;

[0990] - Enhanced activation of type I interferon receptors in the patient's body;

[0991] - Increased expression of one or more type I interferon-stimulated genes in the patient's body; and / or

[0992] - The patient's body exhibits reduced expression of one or more type I interferon-suppressing genes.

[0993] 18. The type I interferon inhibitor, or use or method of use according to any of the foregoing embodiments, wherein the type I interferon is selected from the group consisting of: interferon α; interferon β.

[0994] 19. The type I interferon inhibitor, or use or method of use according to any of the foregoing embodiments, wherein the pain is associated with an increase in the number and / or enhanced activity of one or more active sensory neurons in the patient; preferably associated with an increase in the number and / or enhanced activity of one or more active nociceptors in the patient.

[0995] 20. The type I interferon inhibitor, or use or method, according to Example 19, wherein the sensory neurons of the patient are TrkA-expressing sensory neurons; preferably, nociceptors expressing TrkA.

[0996] 21. The type I interferon inhibitor, or its use or method, according to Example 19 or 20, wherein the sensory neurons of the patient are sensory neurons expressing GFRa3; preferably, nociceptors expressing GFRa3.

[0997] 22. The type I interferon inhibitor, or its use or method, according to any of the foregoing embodiments, wherein the type I interferon inhibitor:

[0998] -Block or reduce intracellular signal transduction of type I interferon in the patient's body;

[0999] -Prevent or reduce the level of type I interferon in the patient's body;

[1000] -Prevent or reduce the activation of type I interferon receptors in the patient's body;

[1001] -Prevent or reduce the expression of one or more type I interferon-stimulated genes in the patient; and / or

[1002] - Induce and / or increase the expression of one or more type I interferon suppressor genes in the patient.

[1003] 23. The type I interferon inhibitor, or use or method, provided according to any of the foregoing embodiments, wherein the type I interferon inhibitor is selected from the group consisting of: IFNAR1 inhibitors, IFNAR2 inhibitors, TYK2 inhibitors, type I interferon neutralizers, MNK inhibitors (such as MNK1 and / or MNK2 inhibitors), and eukaryotic translation initiation factor 4E (eIF4E) inhibitors.

[1004] 24. The type I interferon inhibitor, or use or method, provided according to any of the foregoing embodiments, wherein the type I interferon inhibitor is selected from the group consisting of: small molecules, antibodies, antibody portions thereof, antibody mimics, decoy receptors, receptor bodies, and vaccines.

[1005] 25. The type I interferon inhibitor, or use or method, provided according to any of the foregoing embodiments, wherein the type I interferon inhibitor is selected from the group consisting of: deuterocelexitinib, anifrutumab, NDI-034858, NDI-031232, NDI-031301, NDI-031407, ESK-001, VTX-958, ICP-488, roxatinib, and GLPG3667.

[1006] 26. The type I interferon inhibitor, or use or method thereof, according to any one of Examples 1 to 24, wherein the type I interferon inhibitor is an MNK inhibitor, such as an MNK1 and / or MNK2 inhibitor.

[1007] 27. The type I interferon inhibitor for use, or the use or method thereof, as claimed in claim 26, wherein the MNK inhibitor is selected from the group consisting of: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

[1008] 28. A pharmaceutical composition comprising a type I interferon inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in patients and / or a combination of one or more therapeutic agents for treating rheumatoid arthritis with a pharmaceutically acceptable carrier, diluent or excipient.

[1009] 29. The pharmaceutical composition according to Example 28, used for the treatment or prevention of pain associated with rheumatoid arthritis in patients.

[1010] 30. Use of the pharmaceutical composition according to Example 28 in the preparation of a medicament for treating or preventing pain associated with rheumatoid arthritis in patients.

[1011] 31. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, the method comprising the step of administering to the patient the pharmaceutical composition according to Example 28.

[1012] 32. A kit comprising a type I interferon inhibitor and one or more therapeutic agents for treating rheumatoid arthritis.

[1013] 33. A method for identifying patients with pain associated with rheumatoid arthritis who require treatment with a type I interferon inhibitor, the method comprising the steps of:

[1014] (a) Provide test samples from patients with pain associated with rheumatoid arthritis;

[1015] (b) Determine the level of type I interferon signal transduction in the test sample; and

[1016] (c) As determined in step (b), the patient is identified as a patient requiring treatment with a type I interferon inhibitor.

[1017] 34. The method according to Example 33, further comprising the step of administering a type I interferon inhibitor to the patient.

[1018] 35. A type I interferon inhibitor, or use, or method, or composition or kit for use, which is substantially as described herein with reference to the accompanying specifications, examples, figures and / or embodiments.

[1019] Example

[1020] Example 1

[1021] Example 1: Materials and Methods

[1022] 1.1 Animals

[1023] All experiments were conducted in accordance with protocols approved by the Stockholm Ethical Committee for Animal Experiments (Stockholms Norra Djurförsöksetiska Nämnd, Sweden, 9702-2018 and 10406-2020). Animals had free access to food and water and were housed under a 12-hour light / dark cycle. Wild-type C57BL / 6N mice (adult, 8 to 9 weeks old) were ordered from Charles River (Scanbur AB). Wnt1Cre (JAX #003829), Vglut3Cre (JAX #028534), Gfra3CreERT2 (JAX #029489), Rosa26RtdTomato (Ai14, JAX #007914), Rosa26RChR2-EYFP (Ai32, JAX #012569), and Rosa26RArchT-EGFP (Ai40D, JAX #021188) were ordered from The Jackson Laboratory. SstCre (generous donation from Jens Hjerling-Leffler, JAX #013044). MrgprDCre was ordered from Mutant Mouse Resource & Research Centers (MMRRC_036118), and TrkACreERT2 mice were bred in the laboratory as previously described (Furlan et al., 2016). All strains were backcrossed with C57BL / 6N wild-type mice for at least three generations before being used for breeding. The resulting strains from the following crosses were: Wnt1Cre, TrKACreERT2, SstCre, Vglut3Cre, Gfra3CreERT2, and MrgprDCre mice were crossed with R26TOM and R26CHR2 for characterization; crossed with R26CHR2 for gain-of-function behavior experiments; and TrkACreERT2 and Gfra3CreERT2 mice were crossed with R26ArchT for loss-of-function behavior experiments.The following hybridization lines are: Wnt1Cre / +;R26RTOM / + (abbreviated as Wnt1TOM), Wnt1Cre / +;R26RChR2 / + (abbreviated as Wnt1ChR2), TrkACreERT2 / +;R26RChR2 / ChR2 (abbreviated as TrkAChR2), TrkACreERT2 / +;R26RArchT / ArchT (abbreviated as TrkAArchT), MrgprDCre / +;R26RTOM / + (abbreviated as MrgprDTOM), MrgprDCre / +;R26RChR2 / + (abbreviated as MrgprDChR2). SstCre / +;R26RTOM / + (abbreviated as SstTOM), SstCre / +;R26RChR2 / + (abbreviated as SstChR2), Vglut3Cre / +;R26RTOM / + (abbreviated as Vglut3TOM), Vglut3Cre / +;R26RChR2 / + (abbreviated as SstChR2), Gfra3CreERT2 / CreERT2;R26RChR2 / ChR2 (abbreviated as Gfra3ChR2), Gfra3CreERT2 / CreERT2;R26RArchT / ArchT (abbreviated as Gfra3ArchT).

[1024] For TrkACreERT2 and Gfra3CreERT2 mice, tamoxifen (Sigma, T5648) was dissolved in corn oil (Sigma, 8267) at a concentration of 20 mg / ml and delivered to P14 pups via intraperitoneal injection (ip) (single injection), followed by delivery to adult mice over two consecutive days (140 mg / kg for both pups and adults). Control group mice also received tamoxifen injections.

[1025] 1.2 Antibody-induced arthritis model

[1026] Arthritis was induced by intravenous injection of a 6 mg cartilage antibody mixture (Cab) containing four arthrogenic monoclonal antibodies (ACC1: CII antibody against citrullinated C1 epitopes; M2139: type II collagen antibody; L10D9: type XI collagen antibody; 15A: anti-cartilage oligomeric matrix protein antibody) on day 0, followed by intraperitoneal injection of 25 μg lipopolysaccharide (LPS, 055:B5, Sigma) on day 5 (Li et al., 2020). Control mice received 150 μl of saline intravenously (iv) on day 0 and 100 μl of saline or 25 μg LPS intraperitoneally (ip) on day 5.

[1027] The development of arthritis was examined at different time points using an arthritis score. In short, each inflamed (swollen and red) toe was scored 1 point, and moderate inflammation was scored 2.5 points if the dorsal side of the claw or wrist / ankle joint was inflamed, and severe inflammation was scored 5 points, so each mouse's limbs were scored up to 15 points, for a total of 60 points (Bas et al., 2012).

[1028] 1.3 Photoinduced response

[1029] Channel rhodopsin 2 (ChR2) was activated using a flexible fiber bundle monitored by a power controller (DC2200, Thorlabs), and claw withdrawal reflexes were induced using pulsed lasers (470 nm, 10 Hz, 50 ms on / off) applied to the toe surface of the hind paw in increasing intensity. Wnt1Cre-ChR2, TrkACreERT2-ChR2, SstCre-ChR2, Vglut3Cre-ChR2, Gfra3CreERT2-ChR2, and MrgprDCre-ChR2 mice were acclimatized to a grid floor for 1 hour and subjected to 20-second tests, alternating between the left and right hind paws at intervals of at least 10 minutes.

[1030] For excitatory optogenetics, the light threshold was defined as the minimum light power required to elicit a claw withdrawal response (for reflex) or nociceptive behaviors (such as claw flicking, claw lifting, licking, and protection (for coping)) in a hind paw. The percentage of mice exhibiting a claw withdrawal response in different strains was reported. In all experiments, subthreshold light stimulation (0.2% lower than the threshold) was applied concurrently with the following tests.

[1031] 1.4 Behavioral Testing

[1032] For the sensorimotor test, mice were acclimatized to the test environment twice prior to baseline assessment. After two baseline recordings on different days, animals were randomly assigned to a saline control group, an LPS control group, and an arthritis group. Mechanosensitivity was determined by assessing claw withdrawal using von Frey cilia (Stoelting), applying the up-and-down method described previously (Presley et al., 1994). A series of logarithmically incremental stiffnesses of 0.04, 0.07, 0.16, 0.4, 0.6, 1.0, and 2.0 (g) were applied to the toe surface of the hind paw and held for 3 seconds. A 2g threshold was set to avoid tissue damage. Rapid claw withdrawal was considered a positive response. The 50% probability claw withdrawal threshold (the strength of the von Frey cilia that an animal responds to 50% of stimuli) was calculated.

[1033] To assess thermal sensitivity, a radiant heat source (IITC, Woodland Hills, CA, USA) was directed at the toe surface of the hind paw through a glass surface. In short, mice were placed in an acrylic glass enclosure with a glass surface. The thermally damaging stimulus was delivered from a projected light bulb beneath the glass surface, and the stimulus was delivered to one hind paw at a time. Latency was defined as the time required for the paw to exhibit rapid withdrawal. Each hind paw was tested three times, and the mean withdrawal latency was calculated.

[1034] To quantify pain response: Mechanical stimulation response: A 2.0 g von Frith needle was applied to both hind paws, and response events (paw flicking, paw lifting / protection, or licking) were measured; Cold-touch induced pain was detected by applying a drop of acetone to both hind paws, and the mice's response to acetone was recorded for 45 seconds, and response events were calculated; Mechanical hyperalgesia (pin prick) was also tested using a safety pin (23G needle, BD), and response behaviors were recorded. Data from both hind paws are expressed as medians with interquartile ranges.

[1035] For the functional acquisition study, different pain-like behavioral tests were performed against mechanical and thermal stimuli before measuring the light threshold; the light threshold was then determined as the minimum light power required to elicit either claw withdrawal (reflex) or a nociceptive defensive response (coping) in one of the claws. Subthreshold light stimulation was then applied simultaneously with sensory stimulation: the claw withdrawal reflex subthreshold was defined for the von Frey test and Hargreaves test, while the coping subthreshold was defined for the 2g von Frey test, acetone test, and needle prick test.

[1036] In littermate control mice (Wnt1) Cre / + ;TrkACre ERT2 / + ChR2 + / - In mice, optogenetic activation did not induce stimulus-associated responses, neither paw retraction nor paw flicking behavior. All strains in the three lines exhibited mechanosensitive and cold hypersensitive; however, control mice showed no difference in sensitivity to mechanical or thermal stimuli compared to the combination with blue LEDs (data not shown).

[1037] 1.4 Suppressive optogenetics

[1038] To test the effect of inhibiting the TrkA and Gfra3 populations, mechanosensitivity and thermosensitivity were assessed before and after stimulation with yellow light (563 nm, 30 min for TrkACreERT2-ArchT mice, 45 min for Gfra3CreERT2-ArchT mice). A lab-made yellow LED panel (wavelength: 563 nm; 0.44 mWatt / mm²) was applied beneath the test floor. For mechanosensitivity, after 1 hour of adaptation on the grid floor, the tarsal surfaces of the hind paws were stimulated with a series of calibrated monofilaments (Staltine, Illinois, USA) at increasing forces (0.07 g, 0.16 g, 0.4 g, 0.6 g, 1.0 g, 1.4 g, and 2.0 g). Each filament was applied five times to both hind paws. The percentage of animals exhibiting a claw withdrawal response was reported.

[1039] 1.5 Preparation of Single-Cell Suspension

[1040] DRGs of the cervical and lumbar vertebrae were collected from C57BL / 6N mice (8 to 10 weeks old, Charles River, Sweden) and placed in 6 cm culture dishes containing DPBS (Sigma) on ice. Two male mice were included in each suspension experiment. The following single-cell suspensions were prepared according to our previous protocol, but with modifications (Haring et al., 2020). In short, DRG was cut 1 to 2 times in 2 mL of papain (25 units / mL, Worthington Biochemical), and then digested in a 37°C incubator with a mixture of papain / collagenase / dispersase digestive enzymes (papain, 25 units / mL, 4 mL; DNase I, 55 units / mL, 0.5 mL, Worthington Biochemical; and collagenase and dispersase 20 mg / mL, 800 μl, Worthington Biochemical), and then ground up and down 10 times every 10 minutes using glass Pasteur pipettes (pre-coated with 0.5% BSA) of decreasing diameter. The cell suspension was filtered through a 30 µm cell filter (CellTrics, Sysmex) and washed with an additional 1.5 mL of ACSF (modified ACSF: 87 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 26 mM NaHCO3, 75 mM sucrose, 20 mM glucose, 0.5 mM CaCl2, 4 mM MgSO4) and 0.5 mL of DPBS. Cells were centrifuged (300 g, 6 min, 4 °C) to settle and resuspended in 1.5 mL of cold ACSF and 0.5 mL of DPBS. The cell suspension was carefully loaded onto an equal volume of OptiPrep density gradient medium (Sigma) and centrifuged at 700 g for 10 min at 4 °C. The cell pellet was resuspended in 3 mL of cold ACSF. Dead cells were stained with SYTOX Blue (Invitrogen, Thermo Fisher Scientific). Live SYTOX Blue-negative cells were then sorted using a Fluorescence Activated Cell Sorting (FACS) system (BD FACSAria Fusion / BD FACSAria III) at 4°C. Cells were concentrated by centrifugation (300 g, 5 min, 4°C) and resuspended in an appropriate volume (approximately 1000 cells / µl) of ACSF solution.

[1041] 1.6 Single-cell gene expression 3' sequencing

[1042] Sorted cells were loaded onto a 10' Chromium chip G using the v3 or v3.1 kit (10' Genomics) to generate single-cell droplets. The target cell recovery rate was set at 5000 cells for neuronal atlas construction or SNI samples, while samples from captured viable populations were targeted at 1000 cells. Reverse transcription, cDNA amplification, and library construction were performed according to the user guide provided by the manufacturer. The mixed libraries were sequenced on an Illumina NovaSeq 6000 sequencing platform based on an SP-100 flow cell at the National Genomics Infrastructure (SciLifeLab), with sequencing at 91 bp to the 3' end (5' to 3') of the mRNA. The raw sequencing data was demultiplexed, converted to fastq format, and aligned with the mouse reference gene mm10 (modified with dsRed2-WPRE) using STAR alignment software to generate a gene-cell matrix.

[1043] 1.7 Single-cell RNA sequencing data analysis

[1044] R (v.4.1.1) of Seurat (v.4.1.0) was used for the primary scRNA-seq analysis. Individual count matrices created by CellRanger (v.5.0.1) were merged into a single Seurat object, and all cells with counts exceeding 20% ​​of mitochondrial-derived genes were discarded. A threshold of over 2000 detected genes was set for the raw data. This data was integrated using Harmony (v.0.1.0) and clustered using the default algorithm in Seurat. Proposed neuronal clusters were identified using the neuronal marker gene Rbfox3. Non-neuronal clusters were extracted, integrated, and clustered from the control samples, and cell labels were assigned based on gene markers from the literature (Yim et al., 2022). The labels (Seurat) were then transferred to all remaining non-neuronal data using the non-neuronal control data. Subsequently, all remaining raw data with >999 detected genes were integrated, clustered, and assigned labels from the raw data. All neurons from this secondary data were discarded to ensure that only high-quality neurons were used for the final analysis. Then, the primary dataset (>2000 detected genes) and the secondary dataset (>999 detected genes) were merged to produce a complete working dataset. A more refined identity for immune cells in the data was assigned using a peripheral neural immune cell atlas (Yim et al., 2022). To this end, a classifier based on mixture discriminant analysis (mda) (scPred, v.1.9.2) was built using these data, and the model was used to learn cell type labels for immune cells in the current data. All cells with a predicted score below 0.55 were discarded. For neurons, all cells labeled as neurons were extracted from the complete working dataset, clustered, and all cells with an Rbfox3 normalized count less than 0.5 and an Apoe normalized count greater than 2 were removed using an iterative clustering step. Then, as before, a classifier was built using the data from Zeisel et al. (with annotations from Usoskin et al.), and the model was used to learn cell type labels for the neuron data, again discarding unassigned neurons as described above. For pseudo-batch DE analysis, neuron types were grouped together, and the data at each time point after RA induction were compared with the control (t0) using the Wilcoxon rank-sum test with the Seurat function FindMarkers and the adj.p.val critical value set to 1x10⁻²⁰. DE genes for each cell type were defined similarly between each RA time point and the control. Co-regulated gene modules in the dataset were identified using Fcoex (v.1.10.0). To reduce computational load, a randomized cell set (25%) from each cell type time point pair was sampled. Fcoex was run on the first 200 genes, targeting a specific time point.The resulting set of modules was further filtered to include only differentially expressed genes and modules consisting of at least 10 genes. A module score was calculated and scaled to between 0 and 1. Gene enrichment analysis for gene modules was performed using enrichR (v.3.0) with the “GO_Biological_Process_2021” database. For perturbation analysis (Augur v.1.0.0), all genes located on the Y chromosome and non-protein-coding genes were first discarded. Following this, the analysis was run, comparing each time point to a control for each neuron type. A minimum of 20 cells per type / time point was used by default; therefore, comparisons were not performed for some neuron types at each time point.

[1045] The gene expression matrix was imported into R (4.1.0) and analyzed using Seurat (4.0.6) with a standard workflow (Satijalab). To construct a spinal cord neuron atlas, individual cells with fewer than 2,000 genes or a mitochondrial gene percentage exceeding 20% ​​were filtered out of the dataset. Raw counts were normalized using the global scaling normalization method "LogNomalize," which normalizes the feature expression measurement for each cell to the total expression level, multiplies it by a scaling factor of 10,000, and performs a natural logarithmic transformation (log1p) on the result. Highly variable features (default 2,000 features) were identified using the FindVariableFeatures() function for subsequent analysis. Counts were centered and scaled for each gene. The influence of the total UMI and the percentage of mitochondrial genes per cell was eliminated using a linear model in the Scaledata() function. The top 50 principal components (PCs) were retrieved using the RunPCA() function with default parameters. The JackStraw() and ElbowPlot() functions were combined to determine the dimensionality of the dataset for subsequent clustering. Clustering was performed using the FindClusters() function with a shared nearest neighbor (SNN) modularity optimization technique (Louvain algorithm by default). To avoid potential over-clustering, a method was chosen where cells are clustered from the highest separation by adjusting dimensionality and resolution, followed by merging of transcriptionally highly similar clusters or clusters with mixed separation functions. Non-neuronal cells were filtered out. Ultimately, 27 clusters were generated for the spinal cord neuron atlas, with dimensionality reduction = "pca", dimensionality = 1:25, and resolution = 0.5. The cell clusters were visualized using the non-linear dimensionality reduction technique UMAP. Cluster-specific marker genes were identified using the FindAllMarkers() function. The Wilcoxon rank-sum test was chosen to identify differentially expressed genes that increased at least 0.25 from the fold change threshold. Specific gene markers, including classic and novel marker genes, were selected from the list of differentially expressed genes for cell clusters used for unbiased classification.

[1046] For non-neuronal cells from SNI and control samples, individual cells with fewer than 1,000 genes, fewer than 4,000 UMIs, or a proportion of mitochondrial genes exceeding 10% were filtered out from the dataset (protein-coding genes only). The same procedure was applied, with the dimension (1:5) and resolution (0.4) adjusted for oligodendrocytes and microglia.

[1047] 1.8 Type I IFN signal conduction blocking

[1048] Mice injected with cartilage antibody (Cab) received either a neutralizing monoclonal antibody against IFNAR1 (1 mg / mouse, intraperitoneal injection, BioXCell) or an isotype mouse IgG1 antibody (1 mg / mouse, intraperitoneal injection, BioXCell) 1 hour before arthritis induction (day 0) and on days 22 and 45 after Cab injection. Mechanosensitivity was tested at 12 hours (day 0.5), 36 hours (day 1.5), 60 hours (day 2.5), and 84 hours (day 3.5) after IFNAR1 or isotype injection (n = 3–5). Starting on day 13 after Cab injection in C57Bl / 6N mice, the Tyk2 inhibitor (deuterium-celexitinib / MBS-986165, MCE) was administered orally for 9 days twice daily (15 mg / kg, dissolved in a 5:5:90 EtOH:TPGS:PEG300 solution) (Burke et al., 2019). Two hours after morning injection of either the Tyk2 inhibitor or the mediator (EtOH:TPGS:PEG300, 5:5:90 ratio), mechanosensitivity of the von Frei withdrawal threshold and 2 g von Frei response behavior were measured (n=6).

[1049] 1.9 Endo S treatment of antibodies

[1050] For Fc N-glycan cleavage, a mixture of GST-fused endoglucosidase S (Endo S) expressed by *E. coli* and cartilage antibody was incubated at 37°C for 1 hour at a ratio of 1:1000 (w / w). All antibodies were purified using a Protein G GraviTrap column (VWR) according to the manufacturer's instructions.

[1051] 1.10 Detection of cytokines in serum

[1052] Mice were deeply anesthetized with sodium pentobarbital (60 mg / kg), and blood was collected via the heart. After standing at room temperature for 30 minutes, the blood samples were centrifuged at 1000 g at 4°C, and serum samples were separated from the supernatant and stored at -80°C until subsequent testing. The levels of interferon α (IFNα), interferon β (IFNβ), and 32 other cytokines in serum were detected by ELISA using the IFNα / IFNβ 2-Plex Mouse ProcartaPlex™ assay kit (Thermo Fisher Scientific) and the Mouse ProcartaPlex™ assay kit (Thermo Fisher Scientific).

[1053] 1.11 Gene expression in arthritis DRGs (SYBR green qPCR)

[1054] Total RNA was extracted from mouse cervical and lumbar DRGs using TRIzol reagent (Thermo Fisher Scientific) and a vibratory beater (Argos Technologies), and cDNA was generated from 500 ng of RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems), as previously described (Zhang et al., 2018). Quantitative PCR (qPCR) reactions were performed using SYBR Green Master Mix (Thermo Fisher Scientific) on a QuantStudio 5 system (Applied Biosystems). The primer pairs used in this study are listed below: Ifna (pan-primer, forward: CCTGAGAA / GAGAAGAAACACAGCC; reverse: GGCTCTCCAGAC / TTTCTGCTCTG); Ifnb (forward: AGGGCGGACTTCAAGATC; reverse: CTCATTCCACCCAGTGCT); Gapdh (forward: AACTTTGGCATTGTGGAAGG; reverse: ACACATTGGGGGTAGGAACA). Samples were collected at different time points after antibody injection: 1 hour, 12 hours, 3 days, 33 days, and 63 days, with 4 mice in each group. Untreated C57BL / 6N mice (n=8) served as the control group. All assays were performed three times independently with replicates, and transcript levels were compared by CT (2... -DDCt The method is compared to Gapdh for analysis.

[1055] 1.12 Immunohistochemistry and Western Blotting

[1056] Mice were deeply anesthetized with sodium pentobarbital (60 mg / kg) and perfused with 20 ml of pre-warmed (37°C) physiological saline via the heart, followed by perfusion with 20 ml of pre-warmed 4% paraformaldehyde (containing 0.2% picric acid, dissolved in 0.16 M phosphate buffer, pH 7.2 to 7.4) and 50 ml of cold fixative. L4 / L5 DRG tissues were dissected and post-fixed for 90 minutes at 4°C in the same fixative. After cryoprotection for 48 hours in 10% sucrose containing 0.1 M phosphate buffer (containing 0.01% sodium azide (VWR International) and 0.02% bacitracin (Sigma)), tissues were embedded in OCT (HistoLab), frozen with liquid carbon dioxide, and sectioned at a thickness of 12 µm on a CryoStar NX70 cryostat (Thermo Fisher Scientific).

[1057] The mounted sections were dried at room temperature for at least 30 minutes and then incubated at 4°C in a humidified chamber with a dediluent in phosphate-buffered saline (PBS) containing 0.2% (w / v) BSA (Sigma) and 0.3% Triton X-100 (Sigma) for 48 hours. Immunoreactive imaging was performed using the TSA Plus kit (PerkinElmer) as described above. For double labeling, sections of mouse and human ganglia stained with LPA1 using the TSA Plus kit were washed with PBS and incubated with CGRP antibody (1:1000) at 4°C in a humidified chamber for 48 hours. After washing, CGRP staining was performed by incubation at room temperature for 90 minutes with secondary antibody IgG (H+L) conjugated with carbonyl cyanine 3 (Cy3, 1:150, Jackson ImmunoResearch Laboratories). For IB4 staining, slides were rinsed in PBS for 20 minutes and incubated with IB4 (1:400) from lectin I (GSA I) (2.5 g / ml; Vector Laboratories, Burlingame, CA), followed by overnight incubation with goat anti-GSA I antiserum (1:2,000; Vector Laboratories). Finally, sections wer...

Claims

1. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, the method comprising the step of administering a type I interferon inhibitor to the patient.

2. The method of claim 1, wherein the pain is functional pain, such as inflammatory joint pain.

3. The method according to claim 1, wherein the pain is not inflammatory pain.

4. The method according to any of the preceding claims, wherein the pain is not neuropathic pain or neuroplastic pain.

5. The method according to any of the preceding claims, wherein the pain is chronic pain; for example, pain lasting for three months or longer, six months or longer, twelve months or longer.

6. The method according to any of the preceding claims, wherein the pain is one or more selected from the group consisting of: pain hypersensitivity; touch-induced pain; hyperalgesia; and arthralgia.

7. The method according to any preceding claim, wherein the pain is associated with and / or caused by: - Systemic inflammation; and / or - Local inflammation; and / or - Clinical inflammation.

8. The method according to any of the preceding claims, wherein the pain is not associated with and / or caused by inflammatory activity of rheumatoid arthritis.

9. The method according to any of the preceding claims, wherein the pain is located at the affected joint and / or the contralateral part of the affected joint and / or the cephalic part of the affected joint and / or the caudal part of the affected joint.

10. The method according to any of the preceding claims, wherein the type I interferon inhibitor does not prevent or treat inflammatory diseases with enhanced type I interferon signaling.

11. The method according to any of the preceding claims, wherein: -The pain is accompanied by inflammation of the disease; and / or - The pain persists after the inflammation of the disease subsides.

12. The method according to any of the preceding claims, wherein the patient has received or is receiving pain treatment, but the pain persists and / or recurs and / or progresses.

13. The method of claim 12, wherein the pain treatment is selected from the group consisting of: nonsteroidal anti-inflammatory drugs (NSAIDs), such as celecoxib, diclofenac, etoricoxib, ibuprofen, naproxen; steroids, such as corticosteroids, glucocorticoids; acetaminophen; opioids, such as codeine, dextropropoxyphene, tramadol; antidepressants, such as tricyclic antidepressants; anticonvulsants; or combinations thereof.

14. The method according to any of the preceding claims, wherein the pain is associated with and / or caused by enhanced type I interferon signaling in the patient's body.

15. The method of claim 14, wherein the enhanced type I interferon signal transduction comprises: - Enhanced intracellular signal transduction of type I interferon in the patient's body; - The patient's elevated levels of type I interferon; - Enhanced activation of type I interferon receptors in the patient's body; - Increased expression of one or more type I interferon-stimulated genes in the patient's body; And / or - The patient's body exhibits reduced expression of one or more type I interferon-suppressing genes.

16. The method according to any of the preceding claims, wherein the type I interferon is selected from the group consisting of: interferon α; interferon β.

17. The method according to any preceding claim, wherein the pain is associated with an increase in the number and / or enhanced activity of one or more active sensory neurons in the patient; preferably associated with an increase in the number and / or enhanced activity of one or more active nociceptors in the patient.

18. The method of claim 17, wherein the sensory neurons of the patient are sensory neurons expressing TrkA; preferably, nociceptors expressing TrkA.

19. The method according to claim 17 or 18, wherein the sensory neurons of the patient are sensory neurons expressing GFRa3; preferably, nociceptors expressing GFRa3.

20. The method according to any preceding claim, wherein the type I interferon inhibitor: -Block or reduce intracellular signal transduction of type I interferon in the patient's body; -Prevent or reduce the level of type I interferon in the patient's body; -Prevent or reduce the activation of type I interferon receptors in the patient's body; -Prevent or reduce the expression of one or more type I interferon-stimulated genes in the patient; and / or - Induce and / or increase the expression of one or more type I interferon suppressor genes in the patient.

21. The method according to any of the preceding claims, wherein the type I interferon inhibitor is selected from the group consisting of: MNK inhibitors (such as MNK1 and / or MNK2 inhibitors), IFNAR1 inhibitors, IFNAR2 inhibitors, TYK2 inhibitors, type I interferon neutralizers, and eukaryotic translation initiation factor 4E (eIF4E) inhibitors.

22. The method according to any preceding claim, wherein the type I interferon inhibitor is selected from the group consisting of: small molecules, antibodies, antibody portions thereof, antibody mimics, decoy receptors, receptor bodies, and vaccines.

23. The method according to any of the preceding claims, wherein the type I interferon inhibitor is selected from the group consisting of: deuterocelexitinib, anifrulimab, NDI-034858, NDI-031232, NDI-031301, NDI-031407, ESK-001, VTX-958, ICP-488, roxatinib, and GLPG3667.

24. The method according to any one of claims 1 to 22, wherein the type I interferon inhibitor is an MNK inhibitor, such as an MNK1 and / or MNK2 inhibitor.

25. The method of claim 24, wherein the MNK inhibitor is selected from the group consisting of: eFT508; 4ET-03-053; BAY1143269; ETC-1907206; and derivatives thereof.

26. The method of claim 24, wherein the MNK inhibitor is a compound of structure (II): (II) Or its pharmaceutically acceptable salt, wherein: R 1a It is a C1-C6 alkyl or aryl group; R 1b It is a C1-C6 alkyl or aryl group. Or R 1a and R 1b They are linked together with the carbon atoms to form cycloalkyl, cycloalkenyl, heterocyclic, aryl, or heteroaryl groups; R 2 For –NHR 3a –NHC(=O)R 3b –NHC(=S)R 3b Or –C(=O)R 3c ; R 3a It is hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl, each of which is optionally substituted by one or more substituents selected from the group consisting of: hydroxyl, C3-C6 cycloalkyl, -NHS(O)2CH3, heterocyclic, -C(=O)OH, -C(=O)N(R 3d )R 3d or -N(R) 3d )R 3d ; R 3b It is a C1-C6 alkyl, C3-C6 cycloalkyl, or heterocyclic group, each of which is optionally substituted by one or more substituents selected from the group consisting of: hydroxyl, halogen, C1-C6 alkyl, C3-C6 cycloalkyl, -NHS(O)2CH3, -N(R 3d )R 3d Heterocyclic groups, -C(=O)OH, -C(=O)N(R) 3d )R 3d , -NHC(=O)CH3, -CH2C(=O)OH, R 3c -N(R) 3d )R 3d Or heterocyclic group; R 3d Each time it appears, it is independently hydrogen, C1-C6 alkyl, or C3-C6 cycloalkyl; L is –NH– or –CH2NH–; and X is N and Y is CH, or X is CH and Y is N.

27. The method of claim 26, wherein when R 1a and R 1b Both are –CH3 or when R 1a and R 1b When linked to form a 5- or 6-membered cycloalkyl or heterocyclic group, then R 2 It does not have the following structure: –NH2 or .

28. The method of claim 26, wherein the MNK inhibitor is selected from Table 1.

29. The method according to claim 24, wherein the MNK inhibitor is a compound of formula (I'): Formula (I') Or its pharmaceutically acceptable salt, wherein: R 1 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl; R 2' Choose from the following groups: , , , , , , , , , , , , , , and ; R 3' Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, cyano, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, hydroxyl groups, and C groups optionally substituted with 1 to 3 substituents selected from the group consisting of the following groups 3-6 Cycloalkyl groups: halogens, C 1-6 Alkyl, C 1-6 Halogenated alkyl groups and C 1-6 Hydroxyalkyl; R 1c and R 1d Together they form a 3- to 7-membered ring having 0 to 2 heteroatoms selected from the group consisting of: N, O, and S, wherein the 3- to 7-membered ring may be further optionally substituted by one or more substituents selected from the group consisting of: halogenated, oxo-substituted, C-substituted. 1-6 Alkyl, R 8 and –C(=O)OR 9 ; Z 1 and Z 2 Each is an independent direct key or –{C(R) 4a (R) 4b )} p –Y 1 –; where p is 0, 1, 2, 3, 4 or 5, Y 1 For direct keys, –O– or –N(R) 8 )–; R 4a Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl); or two R 4a It connects with two adjacent carbons to form a direct bond; R 4b Each time it appears, independently select the group consisting of the following items: hydrogen, halogen, C. 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, NHCO(C 1-6 Alkyl), NHCO (C 3-7 Branched alkyl groups), NHCO (C 3-7 cycloalkyl), NHSO2 (C 1-6 Alkyl), NHSO2 (C 3-7 Branched alkyl groups) and NHSO2 (C 3-7 cycloalkyl); R 5 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups; R 6 Choose the group consisting of the following: hydrogen, NH2, NHR 6a , NHCH2CH2OH, NHCH2CH2NHSO2Me, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups; R 6a Choose from the group consisting of: -(CO)C1-6 alkyl, -(CO)C 3-7 Branched alkyl, -(CO)C1-6 hydroxyalkyl, , , , , , , , , and ; q can be 1, 2, 3, 4, 5, or 6; e is 1, 2, 3, 4, 5, or 6; X 2 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, C 1-6 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 Alkyl), N(C) 1-6 Alkyl)2, C 1-5 (COOH), C 1-6 (NHSO2Me); X 3 Choose the group consisting of the following: hydrogen, halogens, C 1-5 Alkyl, C 3-7 Branched alkyl, C 1-5 Haloalkyl, C 3-7 Branched alkyl halogens, hydroxyl groups, C 1-5 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-5 Alkoxy, C 3-7 Branched alkoxy groups, C 1-5 Halogenated alkoxy groups, C 3-7 Branched haloalkoxy groups, NH2, NH(C) 1-6 Alkyl), N(C) 1-6 Alkyl)2, COOH, C 1-5 (COOH), NHSO2Me, C 1-5 (NHSO2Me); R 7 Choose the group consisting of the following: hydrogen, halogens, C 1-6 Alkyl, C 3-7 Branched alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy and hydroxyl groups; R 8 Choose the group consisting of the following items: C 1-6 Alkyl, C 1-6 Haloalkyl, C 3-7 Branched haloalkyl, C 1-6 Hydroxyalkyl, C 3-7 Branched hydroxyalkyl, C 1-6 Alkoxy, C 3-7 Branched alkoxy groups, CO(C) 1-6 Alkyl), CO(C) 3-7 Branched alkyl groups), SO2 (C 1-6 Alkyl groups and SO2 (C 3-7 Branched alkyl groups); and R 9 Choose the group consisting of the following items: hydrogen, C 1-6 Alkyl and aralkyl.

30. The method of claim 29, wherein the MNK inhibitor is a compound selected from the group consisting of: N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-3',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-bispiro[cyclopropane-1,1'-cyclohexane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclopropane-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclobutane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide; 6''-((6-(cyclopropanecarbamoyl)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclopropane-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1-carboxylic acid benzyl ester; 6''-((6-(cyclopropanecarbamoyl)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclobutane-3,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1-carboxylic acid tert-butyl ester; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclobutane-3,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide; 6''-((6-((2-hydroxyethyl)amino)pyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-bispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[azacyclopropane-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1-carboxylic acid benzyl ester; 1-(aminomethyl)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropane-1-carboxamide; (1R,5S,6r)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-3-azabicyclo[3.1.0]hexane-6-carboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-2-azaspiro[3.3]heptane-6-carboxamide; 2-Methyl-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-2-azaspiro[3.3]heptane-6-carboxamide; (1R,5S,6r)-3-methyl-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-3-azabicyclo[3.1.0]hexane-6-carboxamide; N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)-1-(methanesulfonamide methyl)cyclopropane-1-carboxamide; 1-((dimethylamino)methyl)-N-(6-((8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropane-1-carboxamide; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[azacyclopropane-2,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-bispiro[cyclopropane-1,1'-cyclopentane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopentane-1,1'-cyclopentane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-3,3-difluoro-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopentane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclobutane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclohexane-1,1'-cyclobutane-3',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-(cyclopropanecarbamoyl)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-2-carboxylic acid ethyl ester; (6''-((6-(cyclopropanecarbamoyl)pyrimidin-4-yl)amino)-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-2-yl)tert-butyl carbamate; N-(6-((2,2''-difluoro-8''-methyl-1'',5''-dioxo-1'',5''-dihydro-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-6''-yl)amino)pyrimidin-4-yl)cyclopropaneformamide; 6''-((6-aminopyrimidin-4-yl)amino)-2,2-difluoro-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-dispiro[cyclopropane-1,1'-cycloheptane-4',3''-imidazo[1,5-a]pyridine]-1'',5''-dione; 6''-((6-aminopyrimidin-4-yl)amino)-8''-methyl-2''H-bispiro[cyclopropane-1,1'-cyclohexane-4',3''-imidazo[1,5-a]pyridine]-2'-ene-1'',5''-dione; Or its pharmaceutically acceptable salt.

31. The method of claim 24, wherein the MNK inhibitor is a compound of formula IB: (IB) Or its pharmaceutically acceptable salt, wherein: W 1 and W 2 It can be independently O, S or N-OR', where R' is a lower alkyl group; Y is ‒N(R) 5” )‒, -O-, -S-, -C(O)-, -S=O, -S(O)2- or ‒CHR 9 ‒; R 1” It is hydrogen, a lower alkyl, cycloalkyl or heterocyclic group, wherein any lower alkyl, cycloalkyl or heterocyclic group is optionally substituted with 1, 2 or 3 J groups; n 2 It can be 1, 2, or 3; R 2” and R 3” Each is independently hydrogen, alkyl, alkenyl, alkynyl, aryl, arylalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclic or heterocyclic alkylene, wherein any alkyl, aryl, arylalkylene, heteroaryl, heteroarylalkylene, cycloalkyl, cycloalkylalkylene, heterocyclic or heterocyclic alkylene is optionally substituted with 1, 2 or 3 J groups; Or R 2” and R 3” Together with the carbon atoms to which they are attached, they form cycloalkyl or heterocyclic groups, wherein any cycloalkyl or heterocyclic group is optionally substituted with one, two or three J groups; R 4a” and R 4b” Each can be independently hydrogen, halogen, hydroxyl, thiol, hydroxyalkylene, cyano, alkyl, alkoxy, acyl, thioalkyl, alkenyl, alkynyl, cycloalkyl, aryl, or heterocyclic. R 5” It is hydrogen, cyano, or a lower alkyl group; Or R 5” and R 8 Together with the atoms they are attached to, they form fused heterocyclic groups that are optionally substituted with 1, 2 or 3 J groups; R 6” R 7” and R 8 Each of the following groups is independently hydrogen, hydroxyl, halogen, cyano, amino, alkyl, alkenyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkyleneyl, alkylamino, alkylcarbonylamino, cycloalkylcarbonylamino, cycloalkylamino, heterocyclic amino, heteroaryl, or heterocyclic, and any of the amino, alkyl, alkenyl, alkoxy, cycloalkyl, cycloalkylalkylene, cycloalkyleneyl, amino, alkylamino, alkylcarbonylamino, cycloalkylcarbonylamino, cycloalkylamino, heterocyclic amino, heteroaryl, or heterocyclic groups may optionally be substituted with one, two, or three J groups; Or R 7” and R 8 Together with the atoms to which they are attached, they form fused heterocyclic or heteroaryl groups optionally substituted with one, two, or three J groups; J is ‒SH, -SR 9 -S(O)R 9 -S(O)2R 9 -S(O)NH2, -S(O)NR 9 R 9 -NH2, -NR 9 R 9 -COOH, -C(O)OR 9 -C(O)R 9 -C(O)-NH2, -C(O)-NR 9 R 9 , hydroxyl, cyano, halogen, acetyl, alkyl, lower alkyl, alkenyl, alkynyl, alkoxy, haloalkyl, thioalkyl, cyanide, alkylamino, NH2-C(O)-alkylene, NR 9 R 9 -C(O)-alkylene, -CHR 9 -C(O)-lower alkyl, -C(O)-lower alkyl, alkylcarbonylamino, cycloalkyl, cycloalkylalkylene, cycloalkyleneyl, cycloalkylcarbonylamino, cycloalkylamino, -CHR 9 -C(O)-cycloalkyl, -C(O)-cycloalkyl, -CHR 9 -C(O)-aryl, -CHR 9 -Aryl, -C(O)-Aryl, -CHR 9 -C(O)-heterocyclic alkyl, -C(O)-heterocyclic alkyl, heterocyclic amino, or heterocyclic group; or any two J groups bonded to the same carbon or heteroatom may together form an oxo group; and R 9 It can be hydrogen, a lower alkyl group, or -OH.

32. The method of claim 31, wherein the MNK inhibitor is a compound selected from Table 5 or a pharmaceutically acceptable salt thereof.

33. A pharmaceutical composition comprising a type I interferon inhibitor and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in patients and / or a combination of one or more therapeutic agents for treating rheumatoid arthritis with a pharmaceutically acceptable carrier, diluent or excipient.

34. A method for treating or preventing pain associated with rheumatoid arthritis in a patient, the method comprising administering the pharmaceutical composition according to claim 33 to the patient.

35. A method of treating or preventing pain associated with rheumatoid arthritis in a patient, the method comprising administering a type I interferon inhibitor to the patient and one or more therapeutic agents for treating pain associated with rheumatoid arthritis in the patient and / or one or more therapeutic agents for treating rheumatoid arthritis.

36. A kit comprising a type I interferon inhibitor and one or more therapeutic agents for treating rheumatoid arthritis.

37. A method for identifying patients with pain associated with rheumatoid arthritis who require treatment with a type I interferon inhibitor, the method comprising the steps of: (a) Provide test samples from patients with pain associated with rheumatoid arthritis; (b) Determine the level of type I interferon signal transduction in the test sample; and (c) As determined in step (b), the patient is identified as a patient requiring treatment with a type I interferon inhibitor.

38. The method of claim 37, further comprising the step of administering a type I interferon inhibitor to the patient.

Citation Information

Patent Citations

  • Fused thiazolopyrimidine derivatives as mnks inhibitors

    EP3377501A1

  • Condensed thiazolopyrimidine derivatives as mnk inhibitors

    JP2018534314A

  • Piperidine-substituted Mnk inhibitors and methods related thereto

    US11083727B2

  • Sulfoximine substituted quinazolines for pharmaceutical compositions

    US20150361055A1

  • Mnk inhibitors and methods related thereto

    US20170266185A1