Lactobacillus salivarius and its use in the preparation of a medicament for alleviating parkinson's disease

By screening and applying saliva-based Lactobacillus NCU-41 to activate the AKT/Nrf2 signaling pathway, a drug containing indole-3-lactic acid was prepared, filling the gap in existing technologies for the prevention and relief of Parkinson's disease. This achieved safe and effective multi-target intervention and gut microbiota regulation, significantly improving PD symptoms.

CN121610414BActive Publication Date: 2026-05-12NANCHANG UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
NANCHANG UNIV
Filing Date
2026-01-26
Publication Date
2026-05-12

AI Technical Summary

Technical Problem

There are no clear reports in the current technology on the application of saliva-associated lactobacillus and its metabolites in the prevention and relief of Parkinson's disease, and chemotherapy has side effects such as liver and kidney damage and gastrointestinal reactions, which makes it difficult to meet the needs of safe and effective intervention.

Method used

We screened out Lactobacillus salivarius NCU-41 strains with activity in preventing and/or alleviating Parkinson's disease. Through oral administration, we activated the AKT/Nrf2 signaling pathway to enhance the brain's antioxidant defense capacity and improve the gut microbiota structure. We then prepared a drug containing indole-3-lactic acid to synergistically intervene in Parkinson's disease.

Benefits of technology

Saliva-associated Lactobacillus NCU-41 significantly improved motor dysfunction, reduced neuroinflammatory responses, protected dopaminergic neurons, and restored intestinal microecological balance in PD mice, providing comprehensive and effective prevention and relief effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121610414B_ABST
    Figure CN121610414B_ABST
Patent Text Reader

Abstract

The application discloses saliva combined lactobacillus and application thereof in preparation of medicine for relieving Parkinson's disease, and belongs to the field of microbial medicine. The strain is screened from healthy human excrement and has the activity of preventing and / or relieving Parkinson's disease. The strain is gram-positive non-spore bacillus, has no hemolytic activity and no cytotoxicity, meets the safety standard of probiotics, and can be orally administered for a long time, thereby avoiding the side effects such as liver and kidney damage and gastrointestinal reaction caused by chemical drug treatment of Parkinson's disease. Further researches show that the saliva combined lactobacillus NCU-41 and its metabolites can enhance the antioxidation defense ability in the brain by activating the AKT / Nrf2 signal pathway.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial medicine, specifically to Lactobacillus salivarius and its application in the preparation of drugs to alleviate Parkinson's disease. Background Technology

[0002] Parkinson's disease (PD) is a common neurodegenerative disorder that primarily affects middle-aged and elderly individuals. Its core pathological feature is the progressive degeneration and death of dopaminergic (DA) neurons in the substantia nigra of the midbrain, leading to a significant decrease in striatal dopamine levels. The pathogenesis of this disease is complex, involving the interaction of multiple factors, including genetic susceptibility, exposure to environmental toxins, age-related neurodegenerative changes, and oxidative stress. Clinical observations show that gastrointestinal dysfunction is common in Parkinson's disease patients, such as dysphagia, delayed gastric emptying, and chronic constipation. These symptoms often appear more than a decade earlier than typical motor symptoms, strongly suggesting a close link between the gut environment and disease progression. Numerous epidemiological studies and metagenomic analyses have confirmed a significant imbalance in the gut microbiota structure of Parkinson's disease patients, particularly a marked reduction in the abundance of Prevotella family bacteria. This gut microbiota dysbiosis may affect the inflammatory response and oxidative stress levels of the central nervous system through the gut-brain axis, thereby accelerating damage to dopaminergic neurons.

[0003] Lactobacillus salivans ( Ligilactobacillus salivarius Lactobacillus salivarius, also known as *Lactobacillus salivarius*, is a Gram-positive bacillus belonging to the family Lactobacillusceae and the genus *Lactobacillus*. It is widely present in the intestines of humans and animals and is excreted in feces. As part of the normal human flora, *Lactobacillus salivarius* is an important component of the normal intestinal microbiota system and accompanies the host throughout life, playing a vital role in maintaining intestinal microecological balance. As a probiotic in the intestinal flora and an edible lactic acid bacterium, *Lactobacillus salivarius* can help intestinal peristalsis, enhance digestion, and improve immunity. In recent years, *Lactobacillus salivarius*, as a highly promising probiotic lactobacillus, has become a research hotspot and is increasingly being used to produce probiotic preparations suitable for humans and animals. The diversity of *Lactobacillus salivarius* sources leads to genetic and functional diversity. However, there are currently no clearly reported applications of *Lactobacillus salivarius* and its metabolites specifically for the prevention and / or relief of Parkinson's disease. Existing technologies have significant gaps in strain screening, metabolite function verification, and drug development, making it difficult to meet the clinical demand for safe and effective interventions. Summary of the Invention

[0004] To address the aforementioned issues, this invention provides *Lactobacillus salivarius* and its application in the preparation of drugs for alleviating Parkinson's disease. This strain is obtained through screening from the feces of healthy individuals and possesses activity in preventing and / or alleviating Parkinson's disease. The strain is a Gram-positive, non-spore-forming bacillus with no hemolytic activity or cytotoxicity, meeting the safety standards for probiotics. It can be administered long-term via oral formulations, avoiding the side effects such as liver and kidney damage and gastrointestinal reactions associated with chemotherapy for PD. Furthermore, this invention elucidates the mechanism by which *Lactobacillus salivarius* NCU-41 and its metabolites enhance the brain's antioxidant defense capacity by activating the AKT / Nrf2 signaling pathway.

[0005] This invention is the first to demonstrate that the probiotic *Lactobacillus saliva-associated* NCU-41 can delay the progression of Parkinson's disease (PD). This strain can improve motor dysfunction in PD mice, reduce α-synuclein aggregation, alleviate neuroinflammatory responses (manifested as a reduction in glial fibrillary acidic protein (GFAP) and ionized calcium linker 1 (IBA1) positive areas), and exert a protective effect on dopaminergic neurons (increased tyrosine hydroxylase expression). Further mechanistic studies in this invention suggest that these ameliorative effects may stem from the activation of the AKT / Nrf2 signaling pathway by indole 3-lactic acid produced by *Lactobacillus saliva-associated* NCU-41 metabolism, thereby enhancing the brain tissue's antioxidant defense capacity and ultimately achieving a neuroprotective effect. These findings provide data support for the future application of *Lactobacillus saliva-associated* NCU-41 in PD treatment and the development of related microbial therapies. Furthermore, the saliva-associated lactobacillus NCU-41 and its metabolites can improve the gut microbiota structure and restore the balance of the gut microbiota. This not only helps maintain the integrity of the intestinal barrier and reduce the production of inflammatory mediators, but may also have a positive impact on the nervous system through gut microbiota metabolites (such as short-chain fatty acids), further synergistically alleviating Parkinson's disease symptoms. These synergistic effects enable the drug to intervene in Parkinson's disease from multiple pathological stages, providing a more comprehensive and effective prevention and relief effect.

[0006] To achieve the above objectives, the present invention provides, in one aspect, a *Lactobacillus salivans* (Saliva-associated lactobacillus) Ligilactobacillus salivarius The Lactobacillus salivarius was named Lactobacillus salivarius NCU-41 and was deposited on April 7, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.34105. The 16S rDNA sequence of Lactobacillus salivarius NCU-41 is shown in SEQ ID NO: 1.

[0007] A second aspect of the present invention provides a bioactive product, wherein the bioactive product is a culture, fermentation broth, fermentation broth extract or metabolite of Lactobacillus saliva-associated 41 described in the present invention, and the bioactive product includes indole-3-lactic acid.

[0008] A third aspect of the present invention provides the use of the present invention’s Lactobacillus saliva-associated NCU-41 and / or the bioactive product thereof in the preparation of a medicament for the prevention and / or relief of Parkinson’s disease, wherein the use is not intended for the treatment of the disease.

[0009] Furthermore, the drug comprises at least one of the following functions: (1) alleviating MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (a neurotoxin))-induced motor dysfunction in mice, including improving the motor ability of mice; (2) increasing the level of antioxidants in the midbrain of MPTP-induced mice and alleviating oxidative stress; and (3) improving the intestinal flora structure of MPTP-induced mice.

[0010] Furthermore, the drug comprises pharmaceutically acceptable excipients, wherein the excipients are selected from one or more of diluents, binders, disintegrants, lubricants, coating materials, or protectants, and its dosage form is selected from capsules, tablets, powders, drops, granules, or microencapsulated granules. The diluent / filler is selected from microcrystalline cellulose, starch (corn / potato), lactose, mannitol, and calcium carbonate; the binder is selected from hydroxypropyl methylcellulose (HPMC), gelatin, and polyvinylpyrrolidone (PVP); the disintegrant is, for example, croscarmellose sodium (CCNa) or low-substituted hydroxypropyl cellulose (L-HPC); the lubricant is selected from magnesium stearate, silica, and talc; the coating material is selected from gastric / enteric coatings (such as acrylic resins and shellac); and the protectant, used to maintain the stability of the bacterial agent, is selected from trehalose, skim milk powder, glycerin, etc.

[0011] Furthermore, the viable count of *Lactobacillus salivarius* in the drug is not less than 1 × 10⁻⁶. 9 CFU / mL.

[0012] Furthermore, the drug works synergistically through the following two mechanisms: (1) regulating the balance of intestinal flora: increasing the relative abundance of beneficial bacteria such as Lactobacillus in the intestine and reducing the relative abundance of pathogenic bacteria such as Proteobacteria; (2) mediating the activation of the AKT / Nrf2 signaling pathway: the relative expression of p-AKT (phosphorylated protein kinase B) protein is upregulated by ≥40% (with GAPDH (glyceraldehyde-3-phosphate dehydrogenase) as an internal reference); the expression of Nrf2 (nuclear factor E2-related factor 2) nucleoprotein is upregulated by ≥50%; upregulating the phosphorylation level of AKT (protein kinase B) protein and the expression of Nrf2 gene in the substantia nigra of the brain of PD model mice; reducing oxidative stress damage (α-synuclein content is reduced by ≥20%, and superoxide dismutase (SOD) activity is increased by ≥15%).

[0013] Furthermore, the AKT / Nrf2 signaling pathway includes: upregulating the phosphorylation level of AKT protein and the expression of Nrf2 gene in PD model organisms.

[0014] A fourth aspect of the present invention provides a pharmaceutical composition for the prevention and / or relief of Parkinson's disease, comprising the present invention's Lactobacillus saliva-associated NCU-41 and / or the present invention's bioactive product as active ingredients, and a pharmaceutically acceptable carrier or excipient.

[0015] Furthermore, the dosage form of the pharmaceutical composition is an oral preparation, including capsules, tablets, powders, granules, oral liquids, or fermented emulsions.

[0016] The fifth aspect of this invention provides the application of the Lactobacillus saliva-associated with the present invention NCU-41 in the preparation of biomarkers for the auxiliary diagnosis or disease assessment of Parkinson's disease.

[0017] Compared with the prior art, the present invention has at least the following beneficial effects:

[0018] (1) This invention is the first to clearly report that the Lactobacillus salivae NCU-41 strain has the function of delaying the progression of Parkinson's disease. This not only expands the application scope of this specific strain, but also provides a novel, microbiome-based candidate treatment strategy for PD intervention;

[0019] (2) The present invention found that this strain can improve multiple key pathological aspects of PD at the same time: from behavior (motor function), pathological features (α-synuclein aggregation) to the cellular level (neuritis, dopaminergic neuron survival), demonstrating its multi-target and comprehensive therapeutic potential, which surpasses the limitations of single-target intervention.

[0020] (3) This invention innovatively attributes the beneficial effects of probiotics to their specific metabolite indole-3-lactic acid (ILA) and elucidates the downstream mechanism by which it enhances the brain's antioxidant defense capabilities by activating the AKT / Nrf2 signaling pathway. This provides direct evidence for the complete chain of action of "microbe-metabolite-host signaling pathway-neuroprotection" and provides a more in-depth analysis of the mechanism. Attached Figure Description

[0021] Figure 1 The results of Example 2 of this invention show that the combination of saliva with Lactobacillus NCU-41 and ILA significantly improved the symptoms of PD mice: (A) Flowchart of experimental animals; (B) Rod test (s, n=8); (C) String test (s, n=8); (D) Total distance traveled in five minutes (cm, n=8); (E) Distance to enter the central region in five minutes (cm, n=8); (F) Movement trajectory of mice; (G) Content of α-syn in brain tissue (n=6).

[0022] Wherein, MPTP: 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine; α-syn: α-synuclein; M: PD model group (n=10); ML: Lactobacillus salivarius NCU-41 group (n=10); MI: ILA group (n=10); all data are expressed as mean ± standard deviation; one-way repeated measures ANOVA and Tukey's test were used for multiple comparisons and statistical analysis; the statistical significance was * p <0.05、** p <0.01 and *** p <0.001; "ns" has no meaning.

[0023] Figure 2 This indicates that in Example 2 of the present invention, the combination of saliva with Lactobacillus NCU-41 and ILA improved the neuropathological features and intestinal function of PD mice; (AC) Immunofluorescence staining of GFAP, IBA-1 and TH (scale bar = 100 μm); (D) mRNA level of Occludin gene in intestinal tissue (n=6); (E) mRNA level of ZO-1 gene in intestinal tissue (n=6); (FH) ILA level in mouse feces, serum and brain tissue (n=6);

[0024] Wherein, M: PD model group (n=10); ML: saliva-treated with Lactobacillus NCU-41 (n=10); MI: ILA treatment group (n=10); all data are expressed as mean ± standard deviation; one-way repeated measures ANOVA and Tukey's test were used for multiple comparisons; statistical significance was set as *. p <0.05、** p <0.01 and ***p <0.001; “ns” indicates no significant difference.

[0025] Figure 3 This indicates that in Example 2 of the present invention, the salivary lactobacillus NCU-41 and ILA can alter the structure of the gut microbiota to affect the progression of PD disease: (A) Venn diagram; (B) PCoA analysis; (C) LefSe analysis; (D) Chao1 and Simpson indices (n=6); (E) taxonomic composition at the genus level;

[0026] Wherein, M: PD model group (n=10); ML: Lactobacillus saliva-associated NCU-41 group (n=10); MI: ILA group (n=10); all data are expressed as mean ± standard deviation; one-way repeated measures ANOVA and Tukey's test were used for multiple comparisons and statistical analysis; the statistical significance was * p <0.05、** p <0.01 and *** p <0.001; "ns" has no meaning.

[0027] Figure 4 This indicates that transcriptomics and RT-qPCR in Example 2 of this invention revealed that the AKT / Nrf2 signaling pathway is a potential key mechanism by which ILA improves PD: (A) PCA analysis; (B) volcano plot; (C) top 20 upregulated and downregulated genes; (D) GO enrichment analysis of M and MI (n=3); (E) KEGG-GSEA analysis of M and MI (n=3); (F) mRNA levels of PD-related genes in brain tissue (n=6).

[0028] Figure 5 The Western blot diagrams showing the AKT / Nrf2 signaling pathway in Example 2 of this invention are as follows: (A) Western blot analysis of key proteins in the AKT / Nrf2 signaling pathway in brain tissue; (B) p-AKT / AKT ratio (n=3); (C) Nrf2 / β-actin ratio (n=3); (D) Keap1 / β-actin ratio (n=3); (EG) Oxidative stress-related GSH-Px, T-AOC and T-SOD levels (n=6).

[0029] Wherein, M: PD model group (n=10); ML: Lactobacillus saliva-associated NCU-41 group (n=10); MI: ILA group (n=10); all data are expressed as mean ± standard deviation; one-way repeated measures ANOVA and Tukey's test were used for multiple comparisons and statistical analysis; statistical significance was set as *. p <0.05 and ** p <0.01.

[0030] Figure 6 The inhibitor in Example 3 of this invention confirms that *Lactobacillus saliva-associated* NCU-41 alleviates PD by regulating the AKT / Nrf2 signaling pathway: (A) Flowchart of experimental animals; (B) Content of α-syn in brain tissue (n=6); (CE) ILA levels in mouse feces, serum, and brain tissue (n=6); (F) Western blot analysis of key proteins in the AKT / Nrf2 signaling pathway; (G) p-AKT / AKT ratio (N=3); (H) Nrf2 / β-actin ratio (n=3); (I) Keap1 / β-actin ratio (n=3); (JL) Oxidative stress-related GSH-Px, T-AOC, and T-SOD levels (n=6).

[0031] Wherein, M: PD model group (n=10); ML: Lactobacillus saliva-associated NCU-41 group (n=10); MI: ILA group (n=10); MLY: NCU-41 + AKT inhibitor (MK-2206) group (n=10); all data are expressed as mean ± standard deviation; one-way repeated measures ANOVA and Tukey's test were used for multiple comparisons and statistical analysis; the statistical significance was * p <0.05、** p <0.01 and *** p <0.001; "ns" has no meaning.

[0032] Figure 7 This indicates that after inhibitor treatment in Example 3 of the present invention, the ameliorative effect of saliva combined with Lactobacillus NCU-41 on the behavioral performance, pathological tissue damage, and intestinal function of PD mice was reversed; (A) Rod crawling test (time, seconds, n=8); (B) Wire suspension test (time, seconds, n=8); (C) Distance into the central region within five minutes (cm, n=8); (D) Total movement distance within five minutes (cm, n=8); (E) Movement trajectory of the mouse; (FH) Immunofluorescence staining of GFAP, IBA-1, and TH (scale bar = 100 μm); (I) mRNA level of Occludin gene in intestinal tissue (n=6); (J) mRNA level of ZO-1 gene in intestinal tissue (n=6).

[0033] Wherein, M: PD model group (n=10); ML: saliva combined with Lactobacillus NCU-41 treatment group (n=10); MLY: saliva combined with Lactobacillus NCU-41 + AKT inhibitor treatment group (n=10); all data are expressed as mean ± standard deviation; one-way repeated measures ANOVA and Tukey's test were used for multiple comparisons; statistical significance was set as *. p <0.05 and **p <0.01; “ns” indicates no significant difference. Detailed Implementation

[0034] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0035] According to one aspect of the present invention, a salivary lactobacillus ( Ligilactobacillus salivarius The Lactobacillus salivarius was named Lactobacillus salivarius NCU-41 and was deposited on April 7, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.34105. The 16S rDNA sequence of Lactobacillus salivarius NCU-41 is shown in SEQ ID NO: 1.

[0036] In this invention, the strain can be obtained through various methods. For example, it can be isolated and screened from intestinal samples of healthy individuals or from fermented foods. During the isolation process, selective culture media can be used for enrichment, followed by morphological observation, physiological and biochemical characterization, and molecular biological identification (e.g., 16S rDNA sequencing) to confirm it as *Lactobacillus salivarius*. In some embodiments, after obtaining multiple *Lactobacillus salivarius* strains, further screening experiments are conducted, such as evaluating the production capacity of specific metabolites (e.g., indole-3-lactic acid), or assessing its effects on Parkinson's disease-related indicators in in vitro cell models or in vivo animal models, thereby screening out strains with specific functional activities and naming them NCU-41.

[0037] According to a second aspect of the present invention, a bioactive product is provided, wherein the bioactive product is a culture, fermentation broth, fermentation broth extract or metabolite of Lactobacillus salivae NCU-41 of the present invention, and the bioactive product includes indole-3-lactic acid (ILA).

[0038] In this invention, the metabolite participates in the regulation of oxidative stress and cellular homeostasis by activating the AhR receptor and influencing the Nrf2 signaling pathway, significantly impacting neuroprotective mechanisms. The highly efficient indole-3-lactic acid production characteristics of *Lactobacillus saliva* NCU-41 ensure a reliable supply of the metabolite; and indole-3-lactic acid, through precise regulation of the AKT / Nrf2 signaling pathway, achieves targeted intervention in the progression of Parkinson's disease.

[0039] According to a third aspect of the present invention, the use of the present invention’s *Lactobacillus salivarius* NCU-41 and / or the bioactive product thereof in the preparation of a medicament for the prevention and / or relief of Parkinson’s disease is provided, wherein the use is not intended for the treatment of the disease.

[0040] In some embodiments, the drug comprises at least one of the following functions: (1) alleviating MPTP-induced motor dysfunction in mice, including improving the motor ability of mice; (2) increasing the level of antioxidants in the midbrain of MPTP-induced mice and alleviating oxidative stress; and (3) improving the intestinal flora structure of MPTP-induced mice.

[0041] As a specific implementation method, an oral formulation containing *Lactobacillus salivarius* NCU-41 can be prepared, such as capsules or powder. The viable count of *Lactobacillus salivarius* NCU-41 in this formulation can be no less than 1 × 10⁻⁶. 9 CFU / mL.

[0042] In some embodiments, the drug works synergistically through the following two mechanisms: (1) regulating the balance of intestinal flora: increasing the relative abundance of beneficial bacteria such as Lactobacillus in the intestine and decreasing the relative abundance of pathogenic bacteria such as Proteobacteria; (2) mediating the activation of the AKT / Nrf2 signaling pathway: the relative expression of p-AKT protein is upregulated by ≥40% (with GAPDH as an internal reference); the expression of Nrf2 nucleoprotein is upregulated by ≥50%; the phosphorylation level of AKT protein and the expression of Nrf2 gene are upregulated in the substantia nigra of the brain of PD model mice; and oxidative stress damage is reduced (α-syn content is reduced by ≥20%, and superoxide dismutase SOD activity is increased by ≥15%).

[0043] As a specific implementation method, saliva-containing Lactobacillus NCU-41 and its metabolites were prepared into a microencapsulated formulation and delivered orally to the intestine. In the intestinal microenvironment, indole-3-lactic acid was continuously released. This metabolite acts on the central nervous system via the gut-brain axis, significantly improving motor dysfunction. Experimental data showed that in Parkinson's disease model mice treated with this strain, α-synuclein aggregation (M group:ML group:MI group = 473.53 ng / L: 362.70 ng / L: 368.19 ng / L), reduced neuroinflammation (reduced GFAP and IBA1 positive areas), and protected dopaminergic neurons (increased TH expression) confirmed the practical value of this technical approach in the prevention and relief of Parkinson's disease.

[0044] In some embodiments, the AKT / Nrf2 signaling pathway is mediated by upregulating the phosphorylation level of AKT protein and the expression of the Nrf2 gene in PD model organisms.

[0045] Through the aforementioned technical solution, the drug is explicitly required to possess specific functions targeting key pathological processes in Parkinson's disease, thereby overcoming the problems of unclear drug functions and unstable effects in existing technologies. This solution ensures that the drug, in preventing and / or alleviating Parkinson's disease, can significantly improve motor dysfunction, effectively combat oxidative stress, and optimize gut microbiota structure. This multi-target, functionally defined intervention strategy allows the drug to act more precisely and effectively on the development and progression of Parkinson's disease, thus providing more reliable and comprehensive prevention and relief effects.

[0046] According to a fourth aspect of the present invention, a pharmaceutical composition for the prevention and / or relief of Parkinson's disease is provided, comprising the *Lactobacillus saliva-associated* NCU-41 and / or the bioactive product thereof as active ingredients, and a pharmaceutically acceptable carrier or excipient.

[0047] In some embodiments, the dosage form of the pharmaceutical composition is an oral preparation, including capsules, tablets, powders, granules, oral liquids, or fermented emulsions.

[0048] According to a fifth aspect of the present invention, the application of the present invention’s Lactobacillus saliva-associated NCU-41 in the preparation of biomarkers for the auxiliary diagnosis or disease assessment of Parkinson’s disease is provided.

[0049] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of the present invention. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0050] In the following embodiments:

[0051] The reagents used included: MK-2206 (HY-108232, Med Chem Express, USA), MPTP (M924689, Maclean's, China), ampicillin (1 g / L, A6920, Solarbio, China), vancomycin (0.5 g / L, V8050, Solarbio, China), neomycin (1 g / L, N8090, Solarbio, China), and metronidazole (1 g / L, SM8460, Solarbio, China), glial fibrillary acidic protein (GFAP) (GB12096, Servicebio, China), ionized calcium linker protein 1 (Iba1) (GB12105, Servicebio, China), and tyrosine hydroxylase (TH) (GB11181, Servicebio). ELISA kits for α-synuclein (α-syn) (MM-45565M1, Jiangsu ELISA, China), glutathione peroxidase (GSH-Px) (MM-0758M2, Jiangsu ELISA, China), total antioxidant capacity (T-AOC) (MM-0743M2, Jiangsu ELISA, China), and total superoxide dismutase (T-SOD) (MM-44953M2, Jiangsu ELISA, China), (MM-92609501, Jiangsu ELISA, China), TRIzol reagent (10296010CN, 100mL, Gibco, USA), reverse transcription kit (RR047A, Takara, Japan), TB GreenPremix Ex Taq. TM The kit (containing Tli RNaseH Plus) (RR420A, Takara, Japan), AKT polyclonal antibody (10176-2-AP, Proteintech, China), phosphorylated AKT (Ser473) monoclonal antibody (66444-1-Ig, Proteintech, China), NRF2 (D1Z9C) XP® rabbit monoclonal antibody (12721, CST, USA), Keap1 rabbit monoclonal antibody (R26935, Zenbio, China), and β-actin monoclonal antibody (66009-1-Ig, Proteintech, China), and MRS medium (HB0384-5, Hybio Biotechnology, China)

[0052] The instruments used included: a fluorescence microscope (Nikon Eclipse C1), a ViiA 7 real-time quantitative PCR system (Applied Biosystems, USA), a spectrophotometer (NanoDrop, Thermo Scientific), and a UPLC-ESI-MS / MS system (ExionLC AD coupled with QTRAP6500+).

[0053] Example 1: Isolation, purification and identification of Lactobacillus saliva-associated with NCU-41.

[0054] 1.1 Sample Collection and Processing

[0055] Place 1g of fresh, normal, healthy human feces into a 10mL centrifuge tube (containing 5mL of PBS solution). Then, centrifuge the sample (800rpm, 5min). After centrifugation, take 1mL of the supernatant and transfer it to a 1.5mL centrifuge tube for serial dilution with sterile PBS, with each dilution being 10-10. 1 ~10 9 Select appropriate concentration gradients (1-9) for plate spreading (MRS medium). In this case, samples numbered 3, 5, 7, and 9 were selected. Spread 30 μL of each sample onto a plate (the glass rod should be repeatedly heated, and the plate should be shaken before adding the sample). The plates were then placed in an anaerobic incubator for growth and cultured for 24-48 hours.

[0056] 1.2 Single colony selection and culture

[0057] Take a plate with 200-400 colonies, and in a sterile clean bench, select 5-10 single colonies based on the morphology, size, color, neatness of the edges, whether they are raised, and the growth rate of the colonies. Inoculate them into the corresponding 5mL liquid MRS medium and anaerobically activate them for 24-28 hours.

[0058] 1.3 DNA Extraction and Sequencing

[0059] (1) Inoculate the isolated single bacteria into the corresponding 5ml liquid culture medium;

[0060] (2) Preserve bacteria with 30% glycerol (one tube is sufficient for multiple samples), centrifuge (8000 rpm, 2 min), and discard the supernatant;

[0061] (3) Add 600 μL of lysis buffer (lysis buffer: 500 mM NaCl, 50 mM tris-HCl, pH 8.0, 50 mM EDTA, 4% SDS), 200 μL of Tris-saturated phenol and 0.3-0.4 g of glass beads to the precipitate, shake for 30 s and repeat 3 times until the cells are completely suspended, and centrifuge (8000 rpm, 1 min).

[0062] (4) Transfer the supernatant to a new 1.5 mL centrifuge tube, add 250 μL of 10 M ammonium acetate, place on ice for 10 min, and centrifuge (8000 rpm, 1 min).

[0063] (5) Take the supernatant above the organic layer onto the DNA adsorption column, erring on the side of less rather than more, and do not take the organic layer. Centrifuge (8000 rpm, 1 min).

[0064] (6) Wash 2-3 times with 600 μL of 75% ethanol;

[0065] (7) After spinning at 8000 rpm for 2 min, transfer the DNA adsorption column to a new EP tube and air dry for 30 min;

[0066] (8) Add 50µL of TE (pH=8.0) to the dried centrifuge tube, and send 25µL to Sangon Biotech (Shanghai) Co., Ltd. for sequencing;

[0067] The 16S rDNA sequence is as follows:

[0068]

[0069] 1.4 Identification of strains

[0070] Based on the 16S rDNA sequencing results, the bacterial species were obtained by searching and comparing them on NCBI. Specific bacteria were selected for secondary identification and then deposited into a bacterial library. The secondary sequencing results were submitted to the GenBank database of the National Center for Biotechnology Information (NCBI) for homology comparison using the basic local alignment search tool (BLAST). The 16S rDNA gene sequence of the type strain with high homology was selected, and the bacterial species was identified as *Lactobacillus salivarius*.

[0071] Example 2: Animal experiment (mouse model validation) on the prevention / alleviation of Parkinson's disease by saliva-associated lactobacillus NCU-41 and its metabolite ILA.

[0072] The experimental protocol has been approved by the Laboratory Animal Ethics and Welfare Committee of Nanchang University (Approval No.: NCULAE-20221228054) and strictly followed the "Laboratory Animal Care and Use Guidelines" (8th Edition) published by the National Academy of Sciences Press in 2011.

[0073] 2.1 Laboratory Animals

[0074] Forty male C57BL / 6J mice, aged 6-8 weeks, were purchased from Beijing Spefol Biotechnology Co., Ltd. The mice were housed in a specific pathogen-free (SPF) laboratory animal center for one week for adaptation. They were kept under cyclical conditions of 12 hours of light and 12 hours of darkness, with the temperature maintained at 22℃ ± 3℃ and relative humidity at 50% ± 15%. Each cage contained 4-5 mice with free access to food and water. A 7-day acclimatization feeding period was given to the mice before the experiment. Temperature, humidity, and noise levels in the animal room were controlled within specified ranges, and the room was cleaned regularly each day.

[0075] 2.2 Experimental Grouping

[0076] a. Model group (M group=10): A subacute Parkinson's disease mouse model was established using MPTP. Simultaneously, 100 μL of combined antibiotics was administered by gavage to clear the original gut microbiota for 7 days. Then, mice were administered 200 μL of gelatin-saline solution by gavage for 7 days.

[0077] b. Lactobacillus salivarius NCU-41 group (ML group = 10): The Lactobacillus salivarius NCU-41 isolated in Example 1 was inoculated into MRS liquid medium and cultured for 12 hours. The bacterial pellet was collected by centrifugation and resuspended in gelatin saline to prepare a concentration of 10. 9 A bacterial suspension of CFU / mL was prepared for later use. After modeling and antibiotic treatment as in the model group, mice were then administered 200 μL of saliva-associated lactobacillus containing gelatin saline via gavage (viable count 1 × 10⁻⁶). 9 (CFU / mL), lasting for 7 days;

[0078] c. ILA group (MI group=10): ILA was dissolved in DMSO at a concentration of 20 mg / kg. After modeling and antibiotic treatment as in the model group, mice were then administered 200 μL (100 mg / kg) of indole-3-lactic acid containing gelatin saline by gavage for 7 days.

[0079] 2.3 Experimental Procedure

[0080] (1) MPTP modeling: A subacute PD mouse model was established using a dose of 20 mg / kg. Mice were injected intraperitoneally once a day with MPTP at a concentration of 2 mg / mL, with a dosage of 0.1 mL per 10 g body weight, for 7 consecutive days.

[0081] (2) Preparation of combined antibiotics: During the modeling period, each group was simultaneously administered 100 μL of combined antibiotics by gavage, including ampicillin (1 g / L), neomycin (1 g / L), metronidazole (1 g / L) and vancomycin hydrochloride (0.5 g / L).

[0082] (3) Behavioral tests

[0083] Three behavioral tests were performed according to the reference (Wang Y, Chen WJ, Han YY, Xu X, Yang AX, Wei J, Hong DJ, Fang X, Chen TT. Neuroprotective effect of engineered Clostridium butyricum-pMTL007-GLP-1 on Parkinson's disease mice models via promoting mitophagy. Bioeng Transl Med. 2023 Mar 17;8(3):e10505. doi: 10.1002 / btm2.10505): pole climbing test, open field test, and suspension test. Pole climbing test: The time it took for mice to climb from the top of the pole to the bottom was recorded to assess motor coordination. Open field test: The mice were observed for 5 minutes, and the total distance of movement and the distance of movement in the central area were recorded as indicators of anxiety-like behavior. Suspension test: The duration for which the mice's forelimbs gripped the horizontal rope was recorded to assess grip strength. All tests were repeated three times, and the final result was the average of the three measurements.

[0084] (4) Test results

[0085] like Figure 1 As shown, the results indicated that, compared to group M, ILA significantly improved the mice's motor coordination, muscle strength, and grasping ability. Furthermore, it increased the distance traveled in the central open field area and the total distance traveled, and improved the spatial movement trajectory. Figure 1 (Middle B–F).

[0086] 2.4 Sample Collection

[0087] After the behavioral assessment, the mice were anesthetized and euthanized. Brain tissue (substantia nigra and striatum), colon tissue, serum, and feces were rapidly separated, flash-frozen in liquid nitrogen, and stored at -80°C.

[0088] 2.5 Neuroprotective testing

[0089] To investigate the effects of ILA on neurons in PD mice, we further examined the following biomarkers:

[0090] 2.5.1 Immunofluorescence

[0091] Midbrain tissue was paraffin-embedded and sectioned. After dewaxing, the sections were washed with PBS. After blocking with BSA for 30 minutes, primary antibody was added to the sections and incubated overnight at 4°C. The sections were then washed with PBS and incubated with secondary antibody for 50 minutes at room temperature in the dark. After washing again, DAPI staining solution was added and incubated at room temperature for 10 minutes. The sections were washed three times with PBS (5 minutes each time) and mounted. Images were acquired using a fluorescence microscope (Nikon Eclipse C1), focusing primarily on the substantia nigra region. The primary antibodies used included: glial fibrillary acidic protein (GFAP) (GB12096, Servicebio, China), ionotropic calcium linker 1 (Iba1) (GB12105, Servicebio, China), and tyrosine hydroxylase (TH) (GB11181, Servicebio, China).

[0092] 2.5.2 ELISA

[0093] The levels of α-synuclein (α-syn) in brain tissue were detected using a mouse α-synuclein ELISA kit (MM-45565M1, Jiangsu ELISA, China) according to the manufacturer's instructions. In addition, the levels of antioxidant-related enzymes in brain tissue were assessed using ELISA kits, including: glutathione peroxidase (GSH-Px) (MM-0758M2, Jiangsu ELISA, China), total antioxidant capacity (T-AOC) (MM-0743M2, Jiangsu ELISA, China), and total superoxide dismutase (T-SOD) (MM-44953M2, Jiangsu ELISA, China). Furthermore, the concentrations of indole-3-lactic acid (ILA) in mouse feces, serum, and brain tissue were analyzed using an ILA ELISA kit (MM-92609501, Jiangsu ELISA, China).

[0094] 2.5.3 RT-qPCR (Real-time quantitative polymerase chain reaction)

[0095] Brain and colon tissue samples were removed from a -80°C freezer, and total RNA was extracted using TRIzol reagent (10296010CN, 100 mL, Gibco, USA). Subsequently, the RNA was reverse transcribed into cDNA using a reverse transcription kit (RR047A, Takara, Japan). The cDNA was then analyzed using TB GreenPremix Ex Taq on a ViiA 7 real-time quantitative PCR system (Applied Biosystems, USA). TMReal-time quantitative polymerase chain reaction (RT-qPCR) was performed using a kit containing Tli RNaseH Plus (RR420A, Takara, Japan) to quantify the relative expression levels of target genes. Genes analyzed included: AKT, Parkin, nuclear factor E2-associated factor 2 (Nrf2), phosphatase and tensin homolog (PTEN)-induced kinase 1 (PINK1), DJ-1, Notch1, P53, leucine-rich repeat kinase 2 (LRRK2), brain-derived neurotrophic factor (BDNF), nuclear factor κB (NF-κB), occlusive protein (Occludin), atretic zona 1 (ZO-1), and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (GAPDH was used as an internal control gene). Results were normalized to the expression of the housekeeping gene GAPDH, and relative gene expression levels were calculated using the 2-ΔΔCt method. Each experiment was repeated six times.

[0096] Primer sequences:

[0097] AKT: Upstream primer 5' CCGCCTGATCAAGTTCTCCT 3' (SEQ ID NO: 2), downstream primer 5' TTCAGATGATCCATGCGGGG 3' (SEQ ID NO: 3);

[0098] Parkin: Upstream primer 5' TTTTTCATCTACTGCAAAGGCC 3' (SEQ ID NO: 4), downstream primer 5' TTGGAATTAAGACATCGTCCCA 3' (SEQ ID NO: 5);

[0099] Nrf2: Upstream primer 5' GGCAGGACCAGTTGAACAGT 3' (SEQ ID NO: 6), downstream primer 5' GGGTCACCTCACTCCAGGTA 3' (SEQ ID NO: 7);

[0100] PINK1: Upstream primer 5' CATTGCCACCACGCTCTA 3' (SEQ ID NO: 8), downstream primer 5' TCTCAAGTCCGACAACATCCT 3' (SEQ ID NO: 9);

[0101] DJ-1: Upstream primer 5' TTGCACTAGCCATTGTGGAG 3' (SEQ ID NO: 10), downstream primer 5' ACATACAGACCCGGGATGAG 3' (SEQ ID NO: 11);

[0102] Notch1: Upstream primer 5' GATGGCTCAATGGTACAAG 3' (SEQ ID NO: 12), downstream primer 5' TCGTTGTTGTTGATGCACAGT 3' (SEQ ID NO: 13);

[0103] P53: Upstream primer 5' CACAGCGTGGTGGTACCTTATGAG 3' (SEQ ID NO: 14), downstream primer 5' TGGTAAGGATAGGTCGGCGGTTC 3' (SEQ ID NO: 15);

[0104] LRRK2: Upstream primer 5' TGGGTTGGTCACTTCTGC 3' (SEQ ID NO: 16), downstream primer 5' CATTGGCTGGAAATGAGTGC 3' (SEQ ID NO: 17);

[0105] BDNF: upstream primer 5' GCCTCCTCTACTCTTTCTG 3' (SEQ ID NO: 18), downstream primer 5' GGATTACACTTGGTCTCGT 3' (SEQ ID NO: 19);

[0106] NF-κB: Upstream primer 5' GCGTACACATTCTGGGGAGT 3' (SEQ ID NO: 20), downstream primer 5' GTTAATGCTCCTGCGAAAGC 3' (SEQ ID NO: 21);

[0107] Occludin: upstream primer 5' ATGTCCGGCCGATGCTCTC 3' (SEQ ID NO: 22), downstream primer 5' TTTGGCTGCTCTTGGGTCTGTAT 3' (SEQ ID NO: 23);

[0108] ZO-1: Upstream primer 5' TTTTTGACAGGGGGAGTGG 3' (SEQ ID NO: 24), downstream primer 5' TGCTGCAGAGGTCAAAGTTCAAG 3' (SEQ ID NO: 25);

[0109] GAPDH: Upstream primer 5' CTCATGACCACAGTCCATGC 3' (SEQ ID NO: 26), downstream primer 5' CACATTGGGGGTAGGAACAC 3' (SEQ ID NO: 27).

[0110] 2.5.4 Western blot (WB)

[0111] Brain tissue samples were lysed in RIPA lysis buffer containing a mixture of protease inhibitors (50× Cocktail) (G2006-250UL, Servicebio, China) and a phosphorylated protease inhibitor (G2007-1ML, Servicebio, China). After homogenization on ice, the samples were centrifuged at 4°C and 10,000 rpm, and the supernatant was collected for protein extraction. Protein samples were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto polyvinylidene fluoride (PVDF) membranes. After blocking the membrane with skim milk, it was incubated overnight at 4°C with primary antibodies, including: AKT polyclonal antibody (10176-2-AP, Proteintech, China), phosphorylated AKT (Ser473) monoclonal antibody (66444-1-Ig, Proteintech, China), NRF2 (D1Z9C) XP® rabbit monoclonal antibody (12721, CST, USA), Keap1 rabbit monoclonal antibody (R26935, Zenbio, China), and β-actin monoclonal antibody (66009-1-Ig, Proteintech, China). Subsequently, the membrane was incubated with the corresponding secondary antibodies (anti-mouse secondary antibody, SA00001-1, Proteintech, China; anti-rabbit secondary antibody, SA00001-2, Proteintech, China). Finally, chemiluminescent solution (32209, Thermo Fisher, USA) was added to detect the target protein. The protein bands were quantitatively analyzed using ImageJ software (v1.8.0, USA).

[0112] 2.5.5 Neuroprotection-related test results

[0113] Existing research indicates that the upregulation of astrocyte marker GFAP and microglia marker IBA1 in PD reflects astrocyte proliferation and microglia activation in the context of neuroinflammation, respectively, while the downregulation of dopaminergic neuron marker TH directly indicates the progressive loss of these neurons. Furthermore, saliva combined with Lactobacillus NCU-41 and ILA significantly reduced α-synuclein levels in the brains of PD mice (ML:M = 362.70:473.53, ** p <0.01;MI:M=368.19:473.53,** p <0.01)( Figure 1 (G). For example Figure 2 As shown, immunofluorescence results further revealed that, compared with group M, the GFAP and IBA1 positive areas in the brains of mice treated with saliva combined with Lactobacillus NCU-41 and ILA were reduced, and TH expression was increased. Figure 2(AC). These results indicate that *Lactobacillus saliva-associated* NCU-41 and ILA can alleviate PD symptoms in mice by improving motor function, reducing brain tissue pathological changes, and decreasing α-syn levels. Furthermore, compared to group M, *Lactobacillus saliva-associated* NCU-41 and ILA significantly increased the mRNA expression levels of intestinal tight junction genes (Occludin and ZO-1), suggesting that they may enhance intestinal barrier integrity. Figure 2 (DE). Detection of ILA levels in mouse feces, serum, and brain tissue showed that the levels in the saliva combined with Lactobacillus NCU-41 and ILA intervention group were significantly higher than those in the M group ( Figure 2 (FH).

[0114] 2.6 Gut microbiota analysis

[0115] 2.6.1 High-throughput sequencing

[0116] This invention further evaluated the effects on the gut microbiota of PD mice:

[0117] (1) Collect fecal samples from each group of mice. Use a micropipette to take 200µL of sterile physiological saline, rinse the mouse intestines repeatedly 3-5 times, place it in a 1mL centrifuge tube and add LB medium containing 15% glycerol until the centrifuge tube is full and there are no gaps;

[0118] (2) Microbial genomic DNA was extracted from human and mouse fecal samples using a DNA extraction kit (DP712-1, Tiangen Biotech, China), strictly following the instructions. The concentration and quality of the purified DNA samples were tested using a spectrophotometer (NanoDrop, ThermoScientific). The DNA samples were sent to Shanghai Paisenuo Biotechnology Co., Ltd. for PCR amplification of the V4 region of the 16S rDNA gene. The amplified products were sequenced using the Illumina NovaSeq platform. The raw sequencing data were processed and analyzed using QIIME 1.9.1 software to analyze the composition and structural characteristics of the microbial community. The raw sequencing data of this study have been stored in the National Center for Biotechnology Information (NCBI) database (https: / / www.ncbi.nlm.nih.gov / ), accession number PRJNA1355494;

[0119] (3) Analyze the α diversity (Shannon index), β diversity (PCoA analysis), and the relative abundance of differentially expressed genera (such as Akkermansia, Bifidobacterium, etc.) among the groups.

[0120] 2.6.2 Results of gut microbiota analysis

[0121] like Figure 3As shown, we analyzed the gut microbiota composition of each group after intervention: Venn diagrams showed that there were 35 common OTUs in the three groups, and the number of unique OTUs in each group (M, ML, MI) were 29, 37, and 24, respectively. Figure 3 (A). Diversity analysis showed that, compared with group M, the Chao1 index was significantly increased in the saliva-combined Lactobacillus NCU-41 and ILA intervention group; there was no significant difference in the Simpson index between the two groups ( p <0.01)( Figure 3 (Middle D). LefSe analysis showed significant differences in the types of microorganisms enriched in the ML group ( Figure 3 (C). PCoA results also showed significant differences in the microbial community structure among the groups ( Figure 3 At the genus level, compared with group M, the presence of Lactobacillus saliva-associated NCU-41 and ILA increased the relative abundance of the Lactobacillus genus (B). Figure 3 The results (E) suggest that saliva combined with Lactobacillus NCU-41 and ILA can alter the gut microbiota composition of PD mice. In conclusion, saliva combined with Lactobacillus NCU-41 and ILA can influence PD progression.

[0122] 2.7 Transcriptome Sequencing

[0123] RNA sequencing analysis was performed on brain tissues from PD model mice (group M, n=3) and ILA-treated PD mice (group MI, n=3). RNA extraction, quality control, library construction, and sequencing were performed by Parsons Biotechnology Co., Ltd. (Shanghai, http: / / www.personalbio.cn). Differential gene expression analysis was performed using DESeq2, with the selection criterion being |log2FoldChange|>1 and... P <0.05. Subsequently, the hypergeometric distribution algorithm ( p Gene Ontology (GO) functional annotation and KEGG pathway enrichment analysis were performed on differentially expressed genes (<0.05) to identify significantly enriched functional categories. Furthermore, gene set enrichment analysis (GSEA, http: / / www.broad.mit.edu / GSEA) was used to systematically compare gene expression profiles between groups M and MI. The raw sequencing data generated in this study are available in the NCBI database, accession number PRJNA1355494.

[0124] 2.8 Tryptophan Metabolism Analysis

[0125] Metabolomics analysis was used to detect 31 tryptophan metabolites in fresh stool samples from healthy individuals (n=20) and patients with progressive disease (PD) (n=20). Briefly, fresh stool samples were mixed with 500 μL of methanol, vortexed, and centrifuged at 12,000 rpm for 10 minutes at 4°C, collecting the supernatant. Metabolite quantification was performed using an UPLC-ESI-MS / MS system (ExionLC AD coupled with QTRAP6500+) in MRM (Multiple Reaction Monitoring) mode. Data processing included: 1) metabolite identification based on a standard compound database; 2) data acquisition using Analyst 1.6.3 in MRM mode, followed by peak area integration and quantitative analysis using MultiQuant 3.0.3; 3) comprehensive statistical analysis of the quantitative data, including principal component analysis (PCA), orthogonal partial least squares discriminant analysis (OPLS-DA), and hierarchical clustering. Differential metabolite screening was performed to identify significant changes in the metabolomic profile.

[0126] 2.9 Correlation Analysis

[0127] The Correlation Plot function in Origin 2021 software was used to perform a heatmap analysis of the correlation between clinical population characteristics and gut microbiota. In addition, Origin software was used to generate a linear correlation plot between PD scores and gut microbiota / metabolites.

[0128] 2.10 Statistical Analysis

[0129] Data analysis was performed using GraphPad Prism 9.0 software (GraphPad, San Diego, California, USA). Independent samples t-tests or Mann-Whitney U tests were used for comparisons between two groups. For comparisons between three or more groups, one-way ANOVA was used to assess statistical significance, followed by Tukey's test for multiple comparisons. Shapiro-Wilk tests were used to assess data normality. If variances were unequal, Welch's t-tests or Welch's ANOVA were used. Pearson correlation analysis was used for correlation heatmap analysis. Results are expressed as mean ± standard deviation (SD) or median (interquartile range). p A value <0.05 is considered statistically significant.

[0130] 2.11 Mechanism of Action Results Analysis

[0131] like Figure 4 As shown, to further explore the molecular mechanism of action between Lactobacillus saliva-associated NCU-41 and ILA, we performed transcriptome sequencing on brain tissue from groups M and MI. PCA results showed significant differences between the two groups ( Figure 4Volcano plot analysis showed that, compared with group M, group MI had 188 upregulated genes, 180 downregulated genes, and 17,717 genes with no significant changes. Figure 4 (B). Further analysis revealed the top 20 genes with the most significant up- and down-regulation differences between the two groups ( Figure 4 In our study (C), we found that ILA promoted the expression of genes related to behavioral neuronal function (such as Chat and Slc10a4) while inhibiting the expression of genes related to neuronal activation (such as Fos and Ier2). To further elucidate the mechanism of ILA action, we performed pathway enrichment analysis: GO enrichment analysis showed a significant enrichment of "behavior" items related to PD (Problem-Related Atrophy). Figure 4 (D); KEGG pathway analysis showed that the PI3K-AKT signaling pathway was significantly enriched ( Figure 4 In addition, we detected the expression of PD-related genes in the mouse brain by RT-qPCR. The results showed that compared with the M group, the expression level of Nrf2 gene mRNA in the ML and MI groups was significantly increased (E). Figure 4 (Middle F).

[0132] like Figure 5 As shown, we further detected the expression levels of key proteins in the AKT / Nrf2 signaling pathway using Western blot. The results showed that, compared with the model group, treatment with saliva combined with Lactobacillus NCU-41 and ILA significantly increased the p-AKT / AKT ratio (…). p <0.01, accompanied by upregulation of Nrf2 protein ( p <0.01) and downregulation of Keap1 protein ( p <0.01)( Figure 5 (AD). Since activated Nrf2 can enter the nucleus and regulate the expression of downstream antioxidant enzymes (such as GSH-Px and T-SOD) by initiating antioxidant response elements, thereby enhancing the body's total antioxidant capacity (T-AOC), we further examined antioxidant indicators in mouse brain tissue and found that saliva combined with Lactobacillus NCU-41 and ILA significantly increased GSH-Px, T-SOD activity and T-AOC levels. Figure 5 These results collectively suggest that the NCU-41 metabolite ILA from Lactobacillus saliva may improve PD by activating the AKT / Nrf2 signaling pathway and enhancing the body's antioxidant defense system.

[0133] Example 3: To verify whether saliva-associated Lactobacillus NCU-41 improves PD mouse models by mediating the AKT / Nrf2 signaling pathway, AKT inhibitors were used for intervention.

[0134] 3.1 Experimental animals: Follow the steps in Example 4.

[0135] 3.2 Experimental Grouping

[0136] a. Model group (M group = 10): Follow the steps in Example 2;

[0137] b. Saliva-associated Lactobacillus NCU-41 group (ML group = 10): The procedure was performed according to Example 2;

[0138] c. Saliva-containing Lactobacillus NCU-41 + MK-2206 inhibitor group (MLY group = 10): 20 mg / kg MPTP was administered intraperitoneally for 7 consecutive days, followed by 10 mg / kg MPTP via gavage daily. 9 CFU / mL saliva combined with Lactobacillus NCU-41 suspension and intraperitoneal injection of 40 mg / kg MK-2206 for 7 days.

[0139] 3.3 Experimental procedure: Refer to the procedure in Example 2.

[0140] 3.4 Sample collection: After the behavioral assessment, the mice were anesthetized and euthanized. Brain tissue (substantia nigra and striatum), colon tissue, serum, and feces were quickly separated, flash-frozen in liquid nitrogen, and stored at -80°C.

[0141] 3.5 Neuroprotection-related tests: Performed according to the steps in Example 2.

[0142] 3.6 Intestinal flora analysis: Performed according to the steps in Example 2.

[0143] 3.7 Results Analysis

[0144] like Figure 6 As shown, to investigate the importance of the AKT / Nrf2 signaling pathway in improving PD, we treated mice with the AKT inhibitor MK-2206. Figure 6 (A). The results showed that this inhibitor reversed the effect of saliva-associated Lactobacillus NCU-41 in reducing α-synuclein levels in the mouse brain. p <0.05)( Figure 6 (B), but did not affect ILA levels in brain tissue, serum, or feces. Figure 6 (CE). At the molecular level, compared with the ML group, the p-AKT / AKT ratio in the brain tissue of the MLY group was significantly reduced ( p <0.05), Nrf2 protein expression decreased ( p <0.01), Keap1 protein expression showed an increasing trend but was not statistically significant. Figure 6 The results (FI) indicate that MK-2206 effectively inhibits AKT / Nrf2 pathway activation. Simultaneously, inhibitor treatment also led to an increase in GSH-Px ( ) in the brain. p <0.01), T-SOD activity ( p <0.01) and total antioxidant capacity (T-AOC, p<0.01) significantly decreased ( Figure 6 (JL), indicating a weakened antioxidant defense function.

[0145] like Figure 7 As shown, in terms of behavior and pathology, inhibitor treatment significantly impaired motor function in mice. Figure 7 AE), and increased the area of ​​GFAP and IBA1 positive staining in the brain, while reducing TH expression ( Figure 7 (FH). However, MK-2206 did not affect the ameliorative effect of Lactobacillus salivarius NCU-41 on intestinal barrier-related genes (FH). Figure 7 (IJ). In the gut microbiota analysis, the α-diversity results showed that compared with the ML group, the inhibitor group had an increased Chao1 index, while the Simpson index showed no significant difference.

[0146] In summary, the AKT inhibitor MK-2206 weakens the enhanced antioxidant capacity of Lactobacillus saliva-associated NCU-41 by inhibiting the AKT / Nrf2 signaling pathway and reverses its beneficial effects in neuroprotection, behavioral improvement, and some microbiome regulation, thus demonstrating that this pathway is a key way for NCU-41 to alleviate the progression of PD.

[0147] The above description is merely a preferred embodiment of the present invention, and the present invention is not limited to the above embodiments. It is understood that other improvements and variations that are directly derived or conceived by those skilled in the art without departing from the spirit and concept of the present invention should be considered to be included within the protection scope of the present invention.

Claims

1. A type of Lactobacillus salivarius ( Ligilactobacillus salivarius ), characterized in that, The Lactobacillus salivarius was named Lactobacillus salivarius NCU-41 and is deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.34105.

2. A bioactive product, characterized in that, The bioactive product is the fermentation broth of Lactobacillus salivarius NCU-41 as described in claim 1, and the bioactive product includes indole-3-lactic acid.

3. The use of the Lactobacillus salivae NCU-41 of claim 1 and / or the bioactive product of claim 2 in the preparation of a medicament for relieving Parkinson's disease.

4. The application according to claim 3, characterized in that, The drug contains at least one of the following functions: (1) alleviating MPTP-induced motor dysfunction in mice, including improving the motor ability of mice; (2) increasing the level of antioxidants in the midbrain of MPTP-induced mice and alleviating oxidative stress; and (3) improving the intestinal flora structure of MPTP-induced mice.

5. A pharmaceutical composition for relieving Parkinson's disease, characterized in that, It contains Lactobacillus salivarius NCU-41 as described in claim 1 and / or the bioactive product as described in claim 2 as the active ingredient, and a pharmaceutically acceptable carrier or excipient.

6. The pharmaceutical composition according to claim 5, characterized in that, The dosage form of the pharmaceutical composition is an oral preparation, including capsules, tablets, powders, granules, oral liquids, or fermented emulsions.