A limonene synthase sabers, a coding gene thereof and an application thereof
By expressing the bergamotene synthase SaBERS in Escherichia coli, the lack of α-bergamotene synthase genes was solved, enabling efficient synthesis of α-bergamotene and β-bergamotene and promoting the industrial production of sandalwood essential oil compounds.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI
- Filing Date
- 2026-02-02
- Publication Date
- 2026-05-01
AI Technical Summary
Currently, the TPS gene for α-bergamotene synthesis has not been reported. Although the key enzyme in the biosynthesis of sandalene (SaSSY) is known, it catalyzes the production of the main compounds α-santalene and β-santalene from the substrate FPP. The gene for α-bergamotene synthase is lacking.
A bergamotene synthase, SaBERS, is provided, which has a high degree of homology with SaSSY in amino acid sequence, differing by only one amino acid. It is expressed in large quantities by E. coli genetically engineered bacteria and catalyzes the production of the main compounds α-bergamotene and β-bergamotene by FPP using pET28a vector and Rosetta 2(DE3) host cells.
The efficient in vitro synthesis of α-bergamerene and β-bergamerene was achieved, with yields of 62.3 ng/ul and 13.4 ng/ul, respectively, showing broad prospects for industrial applications.
Smart Images

Figure CN121610477B_ABST
Abstract
Description
A bergamotene synthase, SaBERS, its encoding gene, and its applications. Technical Field
[0001] This invention belongs to the field of plant genetic engineering technology, specifically relating to a bergamotene synthase SaBERS, its encoding gene, and its applications. Background Technology
[0002] Plant terpenoids, as natural products, have long been widely used in the pharmaceutical and fragrance industries. Although thousands of terpenoids have been discovered in different plant species, their yields are typically low, and they are mostly induced by biotic and abiotic stresses. Their accumulation patterns vary with the seasons, or they may accumulate in specific tissues or be dynamically released. Many studies have shown that terpene synthases (TPSs) are crucial enzymes responsible for synthesizing structurally diverse terpenoids; they utilize substrates such as farnesyl pyrophosphate (FPP), geranyl pyrophosphate (GPP), or geranylgeranyl pyrophosphate (GPP) to generate monoterpenes, sesquiterpenes, or diterpenes. Increasing research is exploring the production of valuable terpenoids by transferring plant TPS genes into hosts such as bacteria or yeast. However, mining genes encoding the corresponding metabolite biosynthetic enzymes from plants is not only a breakthrough in basic research but also a key driver of innovation in agriculture, medicine, and biotechnology.
[0003] Sandalwood essential oil is widely used in the perfume industry and possesses anti-inflammatory, antibacterial, and antitumor properties. More than 100 terpenoid compounds have been isolated from the essential oil, with (Z)-α-santalol and (Z)-β-santalol being the main components. Other components in lower concentrations include α-santalene, β-santalene, racemic α-bergamotene, (E)-α-santalol, and sesquiterpenes. The key enzyme in santalol biosynthesis, sandalene synthase (SaSSY), has been reported, catalyzing the substrate FPP to produce the main compounds α-santalene and β-santalene. However, the TPS gene for α-bergamotene synthesis has not yet been reported. Summary of the Invention
[0004] The purpose of this invention is to provide a bergamotene synthase gene, SaBERS, which differs from the previously reported SaSSY sequence by only one amino acid. SaBERS is expressed in large quantities in Escherichia coli to produce a recombinant enzyme. This enzyme catalyzes the synthesis of the main compound α-bergamotene from the substrate FPP, which accounts for 82.2% of the total content, with the remainder being β-bergamotene.
[0005] This invention first provides a bergamotene synthase derived from sandalwood (Santalum album), with the amino acid sequence shown in SEQ ID NO.2. The nucleotide sequence of its encoding gene—the bergamotene synthase gene SaBERS—is shown in SEQ ID NO.1. It shares 99.82% amino acid sequence homology with SaSSY, differing by only one amino acid at the enzyme active site (Figure 1).
[0006] The present invention also provides the application of the bergamotene synthase SaBERS or its encoding gene SaBERS in the preparation of α-bergamotene and / or β-bergamotene.
[0007] The present invention also provides a recombinant expression vector containing the bergimide synthase gene SaBERS. Preferably, the recombinant expression vector uses the pET28a vector as its backbone.
[0008] The present invention also provides a genetically engineered bacterium comprising the recombinant expression vector. Preferably, the host cell used for the genetically engineered bacterium is *Escherichia coli*; the *E. coli* strain used as the host cell can be Rosetta 2(DE3).
[0009] This invention also provides a method for preparing α-bergamotene and / or β-bergamotene, using bergamotene synthase SaBERS, with farnesyl pyrophosphate as a substrate, and catalyzing the synthesis of α-bergamotene and β-bergamotene in the presence of dithiothreitol, MgCl2, and glycerol. Preferably, the initial catalytic reaction system contains 2.0 μg of bergamotene synthase SaBERS, a substrate concentration of 5 μM, concentrations of dithiothreitol and MgCl2 of 5 mM and 10 mM, respectively, and a glycerol volume concentration of 10%.
[0010] This invention validates the function of the sandalwood-derived bergamotene synthase SaBERS. It was found that this sandalwood-derived enzyme can be successfully expressed in a prokaryotic expression system, generating a recombinant protein. In an in vitro enzymatic reaction system, this enzyme catalyzes FPP to produce α-bergamotene and β-bergamotene (Figure 2). Based on peak area calculations, the contents of the two compounds reached 62.3 ng / ul and 13.4 ng / ul, respectively. This invention enables the large-scale preparation of the enzyme using *E. coli* and its application in the in vitro synthesis of bergamotene. Furthermore, it can be applied to the synthesis of α-bergamotene or β-bergamotene, demonstrating broad industrial application prospects and potential for large-scale development. Attached Figure Description
[0011] Figure 1 shows a comparison of the coding sequences of the Sabers and SaSSY genes;
[0012] Figure 2 shows the in vitro enzyme activity assay of bergimene synthase SaBERS. A, GC-MS total ion peak diagram of the product, with SaBSY enzyme catalytic product as a positive control and empty vector as a negative control. Peak 1, α-santalene; 2, α-bergimene; 3, epi-β-santalene; 4, β-santalene; 5, β-bergimene. B, Concentrations of α-bergimene (peak 2) and β-bergimene (peak 5) generated from the substrate FPP catalyzed by bergimene synthase SaBERS. Detailed Implementation
[0013] The following embodiments are further illustrations of the present invention, but not limitations thereof.
[0014] Example 1:
[0015] 1. Full-length clone of the Sabers gene
[0016] Total RNA was extracted from sandalwood stems using a plant RNA extraction kit (Huayue Yang Technology Co., Ltd.). cDNA was obtained by reverse transcription using Promega M-MLV reverse transcriptase. Primers (SaBERS ORF primers in Table 1) were designed based on the candidate SaBERS gene sequence, and high-fidelity PCR was performed using cDNA as a template. The PCR reaction system consisted of: 5 μL 10 × PCR buffer, 1 μL each of forward and reverse primers (10 μM), 1 μL cDNA, 0.5 μL high-fidelity KOD enzyme, and water to a final volume of 50 μL. The PCR parameters were: 95℃ denaturation for 5 min, 95℃ denaturation for 30 sec, 60℃ annealing for 30 sec, 72℃ extension for 2 min, 30 cycles; and 70℃ extension for 10 min. After the PCR reaction was completed, the product was subjected to agarose gel electrophoresis, the target band was excised and recovered, and cloned into the pMD18-T vector (Takara). Positive clones were screened on LB solid plates containing 100 μg / mL ampicillin and sent to BGI for sequencing verification. The gene SaBERS with the nucleotide sequence shown in SEQ ID NO.1 was successfully obtained. The amino acid sequence of the enzyme encoded by this gene is shown in SEQ ID NO.2.
[0017] Table 1 Primer sequences used in this invention
[0018] Primer nameSequence (5′-3′)SaBERS ORFForward ATGGATTCTTCCACCGCCACCGCCAReverse CTACTCGCCGAGAGGAATAGGGTCGATpET28a:: SaBERSForward CGCGGATCCATGGATTCTTCCACCGCCACCGCCAReverse GCGGCCGCCCCTCGCCGAGAGGAATAGGGTCGAT surface
[0019] 2. Construction of Sabers gene recombinant vector and engineered bacteria
[0020] Primers for amplifying the complete coding frame of the SaBERS gene were designed based on the coding sequence. Restriction endonuclease sites (BamHI upstream and NotI downstream) were introduced into the upstream and downstream primers, respectively. Specific primers (pET28a::SaBERS in Table 1) were designed to amplify the full-length gene with restriction sites using cDNA from sandalwood stems. The PCR reaction system consisted of: 5 μL 10×PCR buffer, 1 μL each of upstream and downstream primers, 1 μL cDNA, 0.5 μL high-fidelity KOD enzyme, and water to a final volume of 50 μL. The PCR reaction parameters were: denaturation at 95℃ for 5 min; followed by denaturation at 95℃ for 30 sec, annealing at 60℃ for 30 sec, and extension at 72℃ for 2 min, for 30 cycles; and a final extension at 70℃ for 10 min. After PCR amplification, the products were subjected to agarose gel electrophoresis, and the target band was recovered by gel extraction. The pET-28a vector was ligated into DH5α using in-fusion, and the resulting cells were transformed. Single clones were selected on LB agar plates containing 50 μg / mL kanamycin. Sequencing was performed to verify the correct vector construction, yielding the pET28a-SSY2 plasmid. The bacterial culture was then amplified, and the pET28a-SSY2 plasmid was extracted. Two μl of the pET28a-SSY2 plasmid was heat-shocked into 100 μl of Rosetta2 (DE3) competent cells. Positive clones were selected on LB agar plates containing 50 μg / mL kanamycin and 100 μg / mL chloramphenicol, yielding the engineered strain Rosetta 2 (DE3) / pET28a-SaBERS. Using the SaSSY gene (whose nucleotide sequence is shown in SEQ ID NO.3, and its coding sequence is compared with that of the SaBERS gene in Figure 1, and whose encoded amino acid sequence is shown in SEQ ID NO.4) as a control, the engineered bacteria Rosetta 2 (DE3) / pET28a-SaSSY were constructed by treating it in the same way.
[0021] 3. Protein induction, expression, and purification
[0022] The engineered bacterial colonies of Rosetta 2 (DE3) / pET28a-SaBERS or Rosetta 2 (DE3) / pET28a-SaSSY obtained in step 2 were picked and placed into 3 ml of LB broth containing 50 μg / mL Kana and 100 μg / mL Chl, and cultured overnight at 37°C with shaking. The culture was then added to LB broth containing the corresponding antibiotics (50 μg / mL Kana, 100 μg / mL Chl) at a volume ratio of 1:100, and cultured at 37°C. The OD of the culture was then expanded. 600 = 0.6-0.8; Add 0.5 mM IPTG, induce at 16℃ for 24 h, collect bacterial cells by centrifugation, and wash the precipitate with sterile ddH2O. Resuspend the bacterial cells in 45 ml of lysis buffer (50 mM NaH2PO4, pH 8.0, 300 mM NaCl), add 100 μl PMSF, mix well, and place on ice for 30 min; sonicate for 0.5 h, add imidazole to a final concentration of 10 mM and 1 ml of protein purification packing material, shake slowly on a small shaker for 0.5-1 h, and load the protein onto the packing material; desalt and elute with a PD-10 column to obtain Sabers or SaSSY protein.
[0023] 4. Analysis of the in vitro catalytic properties of recombinant enzyme SaBERS
[0024] The prepared SaBERS or SaSSY recombinant enzyme solution (concentration 50 mg / ml, volume 10 μL) was added to Tris-HCl (pH 7.0) buffer, 5 μM substrate FPP, 10 mM MgCl2, 5 mM DTT, and 10% glycerol to form a 1 ml reaction system. The mixture was reacted at 30℃ for 2 h, and the reaction product was extracted with n-hexane. GC-MS was used for qualitative analysis of the product. Chromatographic conditions: GC-2010 Shimadzu gas chromatograph; HP-5 column; carrier gas: N2, purge flow rate 3 mL / min, splitless; column oven initial temperature 40℃, hold for 2 min, then ramp to 220℃ at 7℃ / min, hold for 5 min; injection port temperature 250℃; detector temperature 250℃. Mass spectrometry data were collected in 45-220 full scan mode. The product was analyzed by comparison with the NIST database.
[0025] The results are shown in Figure 2. As can be seen from Figure 2, the bergamotene synthase SaBERS of this invention catalyzes FPP to produce α-bergamotene and β-bergamotene (Figure 2). Based on peak area calculations, the contents of the two compounds reached 62.3 ng / ul and 13.4 ng / ul, respectively. In contrast, the SaSSY enzyme, which differs from SaBERS by only one amino acid, catalyzes FPP to synthesize five products, including α-santalene, α-bergamotene, epi-β-santalene, β-santalene, and β-bergamotene. The retention times of compounds at peaks 2 and 5 are completely consistent with those of the two products synthesized by the SaBERS enzyme, and NIST database analysis confirms that these products are α-bergamotene and β-bergamotene.
Claims
1. A bergamotene synthase, SaBERS, characterized in that, The amino acid sequence is shown in SEQ ID NO.
2.
2. A bergamotene synthase gene SaBERS encoding the bergamotene synthase SaBERS of claim 1.
3. The bergamotene synthase gene SaBERS according to claim 2, characterized in that, The nucleotide sequence is shown in SEQ ID NO.
1.
4. The use of the bergamotene synthase SaBERS according to claim 1, or the bergamotene synthase gene SaBERS according to claim 2 or 3, in the preparation of α-bergamotene and / or β-bergamotene.
5. A recombinant expression vector comprising the bergamotene synthase gene SaBERS as described in claim 2 or 3.
6. The recombinant expression vector according to claim 5, characterized in that, The recombinant expression vector described uses the pET28a vector as its backbone.
7. A genetically engineered bacterium comprising the recombinant expression vector of claim 5 or 6.
8. The genetically engineered bacteria according to claim 7, characterized in that, The host cell used is Escherichia coli.
9. A method for preparing α-bergamotene and / or β-bergamotene, characterized in that, Using the bergamotene synthase SaBERS as described in claim 1, α-bergamotene and β-bergamotene are synthesized catalyzed by farnesyl pyrophosphate as a substrate in the presence of dithiothreitol, MgCl2 and glycerol.
10. The method according to claim 9, characterized in that, The synthesis of α-bergamotene and β-bergamotene uses an initial catalytic reaction system with 2.0 μg of bergamotene synthase SaBERS, a substrate concentration of 5 μM, concentrations of dithiothreitol and MgCl2 of 5 mM and 10 mM, respectively, and a glycerol volume concentration of 10%.
Citation Information
Patent Citations
Use of novel sesquiterpenoids as fragrance materials
CH622946A5
Novel santalene synthase gene as well as encoding protein and application thereof
CN119193554A