DsRNA (double-stranded ribonucleic acid) for preventing and treating dendroctonus valerionus and application thereof

Abstract

The invention discloses dsRNA (double-stranded ribonucleic acid) of dendroctonus valerionus and application of the dsRNA. Aiming at the DvCYP314a1 gene of the dendroctonus valerieus, dsRNA of the dendroctonus valerieus is constructed by utilizing an RNA interference technology, and the dendroctonus valerieus can be effectively prevented and treated by adopting a star-shaped polycation nano-carrier to wrap and apply to the dendroctonus valerieus.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and pest control technology, specifically to a dsRNA for controlling the red turpentine beetle and its application. Background Technology

[0002] The red turpentine beetle (Dendroctonus valens LeConte) is a devastating invasive forest pest originating from North America. Its infestation is highly concealed, spreads rapidly, and possesses a strong ability to infect and spread quickly, causing infected pine trees to die rapidly and severely impacting the stability of forest ecosystems and economic benefits.

[0003] Current control methods for the red turpentine beetle mainly involve traditional approaches such as inspection and quarantine, physical, chemical, and biological control. However, these methods suffer from limitations such as lack of specificity, low mortality rates, and inconsistent effectiveness. Existing research lacks efficient, environmentally friendly, and specific control technologies for the red turpentine beetle.

[0004] RNA interference (RNAi) is an evolutionarily conserved mechanism of post-transcriptional gene silencing and an important gene function research tool that has received widespread attention in the life sciences. RNAi involves Dicer-mediated cleavage of exogenous double-stranded RNA (dsRNA) into small interfering RNA (siRNA), which then guides the RNA-induced silencing complex (RISC) to degrade complementary mRNA. RNAi has been found to be useful for controlling certain insect pests. RNAi strategies typically use synthetic, non-naturally occurring "interfering RNA" or "interfering RNA molecules," which typically contain at least an RNA fragment targeting the target gene, a spacer sequence, and a second RNA fragment complementary to the first RNA fragment, thus forming a double-stranded RNA structure. This non-natural double-stranded RNA utilizes the natural RNAi pathway in the insect to trigger the downregulation of target genes that may lead to feeding and / or growth arrest and potentially death in the insect pest.

[0005] Those skilled in the art know that RNAi strategies targeting specific genes can produce insecticidal effects in certain insect species; however, it is also known that not every target sequence is successful, and the insecticidal effect cannot be predicted. Many sequences homologous to Coleoptera mRNA are not lethal in Coleoptera when used as dsRNA or siRNA. For example, Baum et al. (2007) described the effect of RNAi inhibition of several WCR gene targets, even at concentrations exceeding 520 ng / cm³. 2At very high concentrations of iRNA (e.g., dsRNA), eight of the 26 target genes tested failed to provide experimentally significant mortality rates in coleopteran pests. Furthermore, while dsRNA molecules targeting specific genes are known to produce strong RNAi effects in one insect species, such target genes may not be suitable targets for different insect species. For example, Whyard et al. (2009) reported nearly 100-fold differences in efficacy when testing the same dsRNA molecule targeting the V-ATPase gene in four different insect species. Therefore, there is a need in this field to select appropriate gene targets for specific insect species and design effective dsRNA molecules targeting those targets for control of that insect species. Summary of the Invention

[0006] To address the problems existing in the prior art, this invention provides a dsRNA targeting the ecdysone synthesis gene DvCYP314a1 of the red turpentine beetle, its preparation method, and its application. Inhibiting DvCYP314a1 gene expression through RNA interference affects the metamorphosis of the red turpentine beetle.

[0007] The dsRNA of the present invention can be mixed with a nucleic acid carrier acceptable for pest control to form a composition for the control of red turpentine beetle. For example, the dsRNA can be mixed with a star-shaped polycation (SPc) nanocarrier material to form a pre-encapsulated dsRNA suspension. This suspension can be dropped onto the dorsal side of the abdomen of the larva (referred to as the dorsal drop method, also called the body wall infiltration method), allowing the dsRNA to enter the body of the red turpentine beetle larva and achieving the purpose of controlling the red turpentine beetle.

[0008] Another objective of this invention is to provide a highly effective and safe insecticidal dsRNA that is significantly effective against the red turpentine beetle, providing new ideas and technical support for the development of rapid, efficient, environmentally friendly, and specific red turpentine beetle control technologies.

[0009] To achieve the above objectives, the present invention is accomplished through the following technical solution:

[0010] The dsRNA of the present invention (hereinafter referred to as dsDvCYP314a1) targets a specific gene fragment of the DvCYP314a1 gene, the nucleotide sequence of which is shown in SEQ ID NO. 5.

[0011] The present invention describes the two single-stranded nucleotide sequences of dsDvCYP314a1 as SEQ ID NO:18 and SEQ ID NO:19, respectively.

[0012] The present invention also provides a composition for controlling the red turpentine beetle, the composition comprising the dsRNA and a biocontrol-acceptable nucleic acid vector.

[0013] In some embodiments, the carrier is a star-shaped polycationic nanocarrier.

[0014] In some embodiments, the mass ratio of dsRNA to star-shaped polycationic nanocarrier in the composition is 1:1.

[0015] The present invention also provides a method for controlling red turpentine beetle, which includes the following steps: applying the above-mentioned dsRNA or the above-mentioned composition to red turpentine beetle.

[0016] In some implementations, the application is carried out by dripping onto the body wall or spraying.

[0017] The composition may be an aqueous solution, a suspension, a wettable powder, an emulsifiable concentrate, an emulsion, a sprayable solution, an aqueous dispersion, a powder, a granule, or a microcapsule.

[0018] The effects of controlling the red turpentine beetle include: promoting or advancing the pupation or emergence of the red turpentine beetle; increasing the mortality rate of the red turpentine beetle; and increasing the deformity rate of the red turpentine beetle.

[0019] As used in this article, the term "interfering RNA" or "dsRNA" refers to an RNA molecule that can degrade specific mRNAs by targeting mRNAs with homologous complementary sequences.

[0020] The method for controlling the red turpentine beetle of this invention results in high mortality and a high rate of deformity, exhibiting good sensitivity and significant control effect. Specifically, this invention has the following beneficial effects:

[0021] (1) A key gene for the synthesis of ecdysone, CYP314a1, was screened and obtained. By interfering with the expression of the DvCYP314a1 gene of the red turpentine beetle, its survival and metamorphosis process were affected, thereby achieving the purpose of controlling the red turpentine beetle.

[0022] (2) A highly efficient silencing dsRNA was developed. Based on the high specificity of the dsRNA of this invention, a control method for the forest pest red turpentine beetle was developed. Using RNA interference technology targeting key genes, namely SPc-wrapped dsDCYP314a1 drop back test, it was shown that dsDvCYP314a1 has a high mortality rate and a high deformity rate. Compared with the control, the effect is significant and the control purpose is achieved.

[0023] (3) The nanomaterials (SPc) used in this invention have low production costs, and the materials used to control red turpentine beetles can reduce the input cost of dsRNA biopesticides.

[0024] (4) Compared with traditional physical and chemical pesticides, the interference technology of the present invention has higher precision and environmental friendliness, so as to reduce the pollution and impact of chemical pesticides on the environment and non-target organisms.

[0025] The method of the present invention is easy to operate, effective and sensitive, highly efficient in killing insects, and environmentally friendly, and has many other advantages, and has a promising application prospect. Attached Figure Description

[0026] Figure 1 The image shows an agarose gel electrophoresis result of DvCYP314a1 gene amplification, where lane 1 represents the product of DvCYP314a1 gene amplification, and M is the marker, using the DL2000 DNA Marker.

[0027] Figure 2 Agarose gel electrophoresis image of synthesized dsRNA was used to detect the product. Lane 1 is the purified product, and M is the marker. DL2000 DNA Marker was used.

[0028] Figure 3 To detect SPc-encapsulated dsRNA, an agarose gel electrophoresis image was generated, in which lane 1 was dsCYP314a1, lane 2 was SPc+ dsCYP314a1, lane 3 was dsEGFP, lane 4 was SPc+ dsEGFP, and M was the marker. The DL2000 DNA Marker was used.

[0029] Figure 4 The bar chart shows the relative expression levels of the DvCYP314a1 gene in different developmental stages and tissues of the larvae of the red turpentine beetle. In Figure A, H represents the head, G the intestine, E the epidermis, Mt the Malpighian tubules, and Fb the fat body; in Figure B, E represents the egg, L1 the first instar larva, L2 the second instar larva, L3 the third instar larva, L4 the fourth instar larva, P the pupa, and A the adult. The relative gene expression levels were calculated using the TUB gene as an internal reference. Different letters on the bars indicate significant differences.

[0030] Figure 5 Bar graphs showing the relative expression levels of the DvCYP314a1 gene after 24, 48, and 72 hours of treatment with the red turpentine beetle. Different letters on the bars indicate significant differences.

[0031] Figure 6 The survival curves of the red liptinous bark beetle after RNA interference treatment.

[0032] Figure 7 The image shows photos of red turpentine beetle larvae after treatment, demonstrating the failure of molting in larvae treated with dsDvCYP314.

[0033] Figure 8 The image shows photos of red turpentine beetle larvae after treatment, demonstrating the failure of pupation in red turpentine beetle larvae treated with dsDvCYP314.

[0034] Figure 9 The images show the abnormal morphology of adult Red Turtle Beetle larvae after molting into adults following treatment with dsDvCYP314.

[0035] Figure 10 The image shows the results of the DvCYP314a1 gene analysis using eggNOG software. Detailed Implementation

[0036] Example

[0037] The test insects used in the following examples were fourth-instar larvae of the red turpentine beetle, collected in Datong, Shanxi Province (113º55′E, 40º16′N). The collected larvae were reared indoors to ensure a supply of test insects. Rearing method: Pine bark containing the phloem (approximately 20cm long and 10cm wide, adjustable according to the number of larvae) was peeled off and placed between two sterile, clean, and transparent plexiglass plates. Red turpentine beetle larvae were then introduced into the plates. The four corners of the plexiglass plates were secured with screws to simulate a pressure environment. The gaps between the plexiglass plates were then sealed with gauze and plaster to prevent the larvae from escaping. Holes were then punctured in the plaster with a needle to allow ventilation. The larvae were then kept in a dark environment at 25°C and approximately 50% relative humidity to simulate the environment of the larvae inside the pine tree.

[0038] Example 1

[0039] 1. Identification and analysis of the DvCYP314a1 gene

[0040] 1.1 Obtaining candidate genes

[0041] This invention is based on the genome (Liu et al., 2022) and transcriptome database (Zhao et al., 2021) of the red turpentine beetle, and the analysis was performed using eggNOG software (v5.0) (https: / / eggnog5.embl.de) (the analysis results are available in [link to documentation]). Figure 10 A gene DvCYP314a1 that synthesizes 20-hydroxyecdysone (20E) was obtained through screening.

[0042] 1.2 Total RNA Extraction

[0043] One egg, one 1-4 instar larva, one pupa, and one adult were collected and ground in liquid nitrogen. Total RNA was extracted using a high-purity RNA extraction kit (TransZol Up Plus RNA Kit, Beijing TransGen Biotech Co., Ltd.). The concentration and integrity of the RNA were detected using a nucleic acid protein analyzer.

[0044] 1.3 First-strand cDNA Synthesis

[0045] RNA extracted from different ages of *Leptochloa crus-galli* was mixed, and the resulting total RNA was used as a template for reverse transcription to synthesize cDNA using a reverse transcription kit (HiFiScript gDNA Removal RT MasterMix kit, Kangwei Century Biotechnology Co., Ltd.). The obtained cDNA was stored at -80°C for later use.

[0046] 1.4 Amplification of target gene fragments

[0047] The DvCYP314a1 gene sequence (accession number: ON245921.1) of *Lysimachia rubiginosa* was screened out by comparing the genome of *Lysimachia rubiginosa* (Liu et al., 2022), transcriptome database (Zhao et al., 2021), and NCBI search results. Specific primers containing the open reading frame (ORF) of the target gene were designed and amplified using Primer Premier 6.0 software (Premier Biosoft). The specific primer sequences are as follows.

[0048] Table 1. Primers used in the experiment

[0049]

[0050] The following PCR amplification reaction system and procedure were used to perform PCR amplification and obtain the amplification products.

[0051] Table 2. PCR amplification reaction system

[0052]

[0053] Table 3. PCR Reactivity Procedure:

[0054]

[0055] Electrophoresis was performed on a 1% agarose gel. Bands of the appropriate size were excised, and PCR amplification products were recovered according to the instructions of the gel extraction kit (Gel DNA Extraction Mini Kit, Nanjing Novizan Biotechnology Co., Ltd.). The recovered DNA solution was stored for later use (-20℃).

[0056] 1.5 Connection and Transformation

[0057] The cloning reaction system was constructed using the Zero Background pTOPO-TA / Blunt Simple Cloning Kit (Aidelai Biotechnology) (including the Ptopo-TA / Blunt Simple vector and 10x Enhancer), and the reaction solution was obtained by mixing.

[0058] Table 4. Connection reaction system

[0059]

[0060] Transformation: 10 μL of the above reaction solution was added to a suspension of *E. coli* DH5α competent cells (Novozymes, C502-02) and mixed well. The mixture was incubated on ice for 30 min, followed by heat shock at 42℃ for 2 min. Then, 500 μL of LB liquid medium was added in a clean bench, and the mixture was incubated at 37℃ and 200 rpm for 1 h with shaking. The bacterial culture was then spread onto LB solid medium (containing ampicillin) and incubated overnight in a constant temperature incubator. After bacterial growth, positive colonies were randomly selected and inoculated into LB liquid medium containing ampicillin for further culture. The plasmid was enriched and purified using a plasmid extraction kit (Plasmid Miniprep Kit, Bevo Medical) to obtain the recombinant plasmid containing DvCYP314a1.

[0061] 1.6 Identification and Sequencing

[0062] Bacterial PCR identification was performed using specific primers for the target gene (see Table 1). The bacterial PCR amplification reaction system and reaction procedure were basically the same as those used in amplification 1.4.

[0063] PCR amplification products were electrophoresed on a 1% agarose gel to check for consistency with the target band. If consistent, two strains were selected for amplification and plasmid extraction, followed by sequencing. Results showed that the amplification product band of the DvCYP314a1 gene was approximately 1800 bp in size. Figure 1 The sequencing results showed that the full length of the DvCYP314a1 gene was 1820 bp, proving that the DvCYP314a1 gene was successfully cloned.

[0064] 1.7 Gene sequence characteristics

[0065] Sequencing and sequence analysis revealed the nucleotide sequence of the cloned *DvCYP314a1* gene from *Red Turtle Beetle*. The full-length gene is 1984 bp, the ORF sequence length is 322 / 1788, and the CDS sequence length is 1467 bp (SEQ ID NO.1), encoding 483 amino acids (SEQ ID NO.2). Analysis of the protein's physicochemical properties using ProtParam software showed a molecular weight of 55.30 kDa and an isoelectric point (pI) of 8.18. Subcellular localization revealed the absence of a signal peptide sequence, indicating that the protein is primarily distributed in mitochondria. Sequence alignment and phylogenetic tree construction using DNAMAN and MAGA11 software further confirmed that the cloned gene is indeed the *DvCYP314a1* gene of *Red Turtle Beetle*.

[0066] Table 5. Physicochemical properties of DvCYP314a1 protein from the red liptinous beetle.

[0067]

[0068] 2. Obtaining dsRNA from *Red Lipid-Between Beetle*

[0069] 2.1 Primer design for target gene fragments

[0070] The EGFP gene sequence has no homologous, continuous sequence of at least 20 bp in length in the genome of the red turpentine beetle, therefore it was chosen as a negative control for RNA interference.

[0071] Primers targeting the DvCYP314a1 gene sequence (positions 1344 to 1710, totaling 367 bp, SEQ ID NO. 5) and the EGFP gene sequence (positions 99 to 512, totaling 414 bp, SEQ ID NO. 6), encoding enhanced green fluorescent protein (EGFP), were designed using Primer Premier 6.0 software (Premier Biosoft). A T7 promoter was added to the 5' end. Specific primers are shown in Table 6. The chemically synthesized primers containing the T7 promoter (SEQ ID NO. 9) are listed in Table 6.

[0072] Table 6. Primers used in the experiment

[0073]

[0074] 2.2 PCR amplification

[0075] Using the DvCYP314a1 plasmid obtained in ligation and transformation in section 1.5 as a template, PCR amplification was performed using primers containing the T7 promoter to obtain a template for in vitro transcription and synthesis of dsCYP314a1. The PCR amplification reaction was carried out using essentially the same system and procedure as in section 1.4.

[0076] Electrophoresis was performed on a 1% agarose gel. Bands of the appropriate size were excised, and the PCR amplification products were recovered according to the instructions of the Gel DNA Extraction Mini Kit. The recovered DNA solution was stored for later use (-20℃), i.e., the T7-DNA template.

[0077] 2.3 In vitro transcription synthesis and purification of dsRNA

[0078] Double-stranded RNA was synthesized using the T7 RNAi Transcription Kit (Nanjing Novizan Biotechnology Co., Ltd.). The transcription reaction system was prepared according to the table below, with a recommended amount of 1 μg of T7-DNA template.

[0079] Table 7. Transcription Reaction System

[0080]

[0081] After configuring the reaction system as described above, mix and centrifuge, and react at 37°C for 24-48 hours in a PCR instrument.

[0082] Prepare the dual-enzyme digestion system according to the table below, mix well, centrifuge, and incubate at 37°C for 30 min.

[0083] Table 8. Two-enzyme digestion system

[0084]

[0085] The obtained RNA product (containing dsRNA) was purified using alcohol precipitation. The alcohol precipitation method used is as follows:

[0086] After double enzyme digestion, DEPC water was added to bring the volume to 200 μL; 500 μL of anhydrous ethanol was added and vortexed; 20 μL of 3M sodium acetate (NaAc) at pH 5.2 was added and mixed; 1-2 μL of LPA precipitant was added and mixed by inverting the mixture, and then the mixture was incubated at -20°C for 20-60 min; the solution was centrifuged at 12000 rpm for 10-15 min (centrifuge pre-cooled); then washed twice with 1 mL of 75% ethanol, centrifuged at 12000 rpm for 3 min, and the precipitate was allowed to partially dry at room temperature before being dissolved in DEPC water to obtain purified dsRNA.

[0087] The mass of dsRNA was determined by agarose gel electrophoresis using 0.2 μL of the purified product. Electrophoresis conditions: 115 V, 20 min. The results are as follows: Figure 2 As shown, the concentration of dsDvCYP314a1 was calculated to be 1.8 μg / μL.

[0088] The dsDvCYP314a1 obtained by the above method is a double-stranded RNA composed of the nucleotide shown in SEQ ID NO: 18 and the nucleotide shown in its reverse complementary sequence (SEQ ID NO: 19).

[0089] 3. SPc encapsulates dsRNA

[0090] SPc (provided by Professor Shen Jie of China Agricultural University, preparation method see Ma et al., 2022) was mixed with the purified dsRNA at a mass ratio of 1:1 and incubated at room temperature for 15 min until the SPc completely encapsulated the dsRNA. Electrophoresis was then performed to detect the results. Figure 3 As shown, fully encapsulated dsRNA will remain in the upper part of the lane (e.g., lanes 2 and 4).

[0091] Example 2

[0092] 1. RNA interference treatment

[0093] The cells were randomly divided into two groups: a treatment group received dsDvCYP314a1 (0.5 μg / μL) encapsulated in SPc as described in Example 1, and a control group received dsEGFP + SPc (0.5 μg / μL) encapsulated in SPc as described in Example 1. Both were delivered using the body wall permeation method, with SPc-encapsulated dsDvCYP314a1 and dsEGFP respectively dropped onto the back of the larvae of *Echinochloa crus-galli* (e.g., *Echinochloa crus-galli*). Figure 5 The final concentration was 0.5 μg / μL, 1 μL / worm. After waiting for the dsRNA to penetrate into the worm's body (approximately 15 minutes after which the liquid on the worm's surface was completely absorbed), the worm was placed under suitable conditions for rearing.

[0094] Both the treatment and control groups consisted of 60 larvae. The mortality and developmental status of the larvae, including deformities, were observed and recorded every 24 hours.

[0095] 2. Real-time quantitative PCR efficiency for detecting RNA interference

[0096] After RNA interference treatment, the larvae were reared for 24h, 48h, and 72h. Three larvae were taken from each group, and the relative expression level of the DvCYP314a1 gene in the larvae of the red turpentine beetle was detected by RT-qPCR.

[0097] Using the method described in Example 1, total RNA was extracted and cDNA first strand was reverse transcribed. Using the qPCR primers in Table 9, with the TUB gene of *Leptochloa crus-galli* as an internal reference gene, real-time quantitative PCR analysis was performed to detect the relative expression level of the DvCYP314a1 gene. The reaction system and procedure are shown below:

[0098] Table 9. qPCR primer information

[0099]

[0100] Table 10. Real-time quantitative PCR reaction system

[0101]

[0102] Reaction procedure:

[0103] Constant temperature range: 95℃ for 5 minutes

[0104] Cyclic interval (40 cycles): 95℃ 5s, 60℃ 30s, 72℃ 20s (read fluorescence)

[0105] Melting sections: 95℃ for 15 seconds, 60℃ for 1 hour, 95℃ for 15 seconds

[0106] Data analysis: using 2 ﹣ΔΔCt The relative expression levels were calculated using the method described in the Schmittgen and Livak (2008), and the changes in DvCYP314a1 gene expression at 24h, 48h, and 72h after interference by *C. rubrum* were statistically analyzed. One / Two-Way ANOVA was used to analyze the significance of differences at each time point. The results are as follows: Figure 4 As shown, the expression of the DvCYP314a1 gene differs at different developmental stages of *Leptochloa crus-galli* and in different tissues of the 4th instar larvae, with the highest expression found in the larval fat body. Figure 4 A), is most highly expressed in 2nd and 3rd instar larvae. Figure 4 B).

[0107] The RNA interference efficiency was detected by real-time fluorescence quantitative PCR. The results showed that the above RNA interference treatment could significantly reduce the expression level of the target gene (DvCYP314a1 gene) in the larval stage of *Ceratophyllum demersum*. Figure 5RT-qPCR was performed at 24h, 48h, and 72h after treatment with *D. erythroptera*. The expression level of DvCYP314a1 in the larvae of the treatment group (dsDvCYP314a1+SPc) was significantly downregulated by more than 75% compared to the control group (dsEGFP+SPc). These results indicate that the RNA interference treatment of this invention successfully knocked down the expression level of the DvCYP314a1 gene in *D. erythroptera* larvae.

[0108] 3. Effects of RNA interference on red liptinous beetles

[0109] 3.1. Effects on pupation and emergence

[0110] In the dsEGFP control group (n=60), larvae began to pupate after 22 days of rearing, and began to emerge as adults after 10 days of pupation. A total of 37 larvae pupated, with a pupation success rate of 61.67%, and 35 adults emerged, with an emergence success rate of 58.34%. In contrast, in the dsDvCYP314a1 treatment group (n=60), larvae began to pupate after 20 days of rearing, and began to emerge as adults after 9 days of pupation. A total of 15 larvae pupated, with a pupation success rate of 61.67%, and 35 adults emerged, with an emergence success rate of 58.34%.

[0111] 3.2. Impact on Mortality Rate

[0112] The median lethal time (LT50) is the time (in days) required for a 50% mortality rate to occur in a tested insect.

[0113] In the dsDvCYP314a1 treatment group, deaths began on day 2, with a surge in deaths starting on day 17, reaching a cumulative mortality rate of 88.33% by day 34. LT 50 The survival time was 27 days. The cumulative mortality rate of larvae in the dsEGFP control group was 41.67%, showing a significant difference (Table 11). The survival curves after RNA interference are shown below. Figure 6 As shown in the figure. Experimental results show that dsDvCYP314a1 wrapped with SPc on the back significantly increases the mortality rate of red turpentine beetle larvae, proving that the DvCYP314a1 gene can serve as an effective target gene for the control of red turpentine beetles.

[0114] Table 11. Mortality rates at different insect developmental stages

[0115]

[0116] 3.3. Regarding growth and development

[0117] The malformation rate in the dsDvCYP314a1 treatment group reached 45%, with a larval malformation rate of 23.3% (13 larvae in total), characterized by inability to pupate and molting defects (old exoskeleton not shed); a pupal malformation rate of 15% (9 larvae in total), characterized by the formation of malformed pupae (such as unsuccessful molting and blackened wings), failing to emerge; and an adult malformation rate of 6.7% (4 larvae in total), characterized by malformed wings that could not be retracted after emergence (as shown in Table 12). Compared with the dsEGFP control, dsDvCYP314a1 treatment caused the following abnormal phenotypes: some red turpentine beetle larvae failed to molt ( Figure 7 ); Some red turpentine beetle larvae failed to pupate ( Figure 8 Some red turpentine beetles can emerge normally, but develop wing deformities. Figure 9 These three abnormal phenotypes indicate that dsDvCYP314a1 affects the growth and development of *Leptochloa crus-galli*, particularly larval molting, pupation, forewing size, and the integrity of adult emergence. Silencing the DvCYP314a1 gene significantly leads to abnormal metamorphosis and increases the malformation rate in *Leptochloa crus-galli*, further demonstrating that the DvCYP314a1 gene can serve as an effective target gene for the control of *Leptochloa crus-galli*.

[0118] Table 12. Deformity rate of different worm stages

[0119]

[0120] References

[0121] 1. Fire A, Xu S, Montgomery MK, et al. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans[J]. Nature, 2016, 1998. 391(6669): 806-11.

[0122] 2. Baum J, Bogaert T, Clinton W. et al. Control of coleopteran insectpests through RNA interference. Nat Biotechnol, 2007, 25: 1322-1326.

[0123] 3. Whyard S, Singh AD, Wong S. Ingested double-stranded RNAs can actas species-specific insecticides. Insect Biochem. Mol. Biol.2009, 39(11):824-832.

[0124] 4. Zhao D, Zheng C, Shi F, et al. Expression analysis of genesrelated to cold tolerance in Dendroctonus valens. PeerJ. 2021;9: e10864.

[0125] 5. Liu J, Li Z, Zhong Z, et al. Silencing of LIM homeodomaintranscription factor 1 alpha (Lmx1a) gene caused larval molting failure andadult reproductive deficiency in Henosepilachna vigintioctopunctata. InsectSci., 2025, doi:10.1111 / 1744-7917.70033

[0126] 6. Ma Z, Zheng Y, Chao Z, et al. Visualization of the process of ananocarrier-mediated gene delivery: stabilization, endocytosis and endosomalescape of genes for intracellular spreading [J]. J. Nanobiotechnology, 2022,20(1): 124.

[0127] 7. Schmittgen TD, Livak KJ. Analyzing real-time PCR data by thecomparative C T method. Nat Protoc. 2008;3(6): 1101-8.

[0128] sequence list

[0129] SEQ ID NO.1: DvCYP314a1 gene sequence

[0130]

[0131] SEQ ID NO.2: Amino acid sequence of DvCYP314a1 protein

[0132] MFGPITMLDIFTCLLGALFFMFIGFRPPWQPKKLQDFRHKEVQDIPGPLSLPWIGTRWLFTIGRYQMSKIPEFYQDMVRKYGLIFKEEAVWNVPIISVVERSDIETVLKSTGKWPVRPPTAAVAQYRKAHPERYASAGLVNEQGEKWQFLRTSLTTVLTSPKTINDFLPQMDEIADDWCHLIKQRRTADGRIDHLEELAGRLGLEATCALVLGRRMGFLIEDQRCEVAEKLAQSVHDHFIACRDTYFGLPFWSAFPTPNYRKLCKSERNMYEFASELIKTADDSTKDSAVFQSVLGAHIDEREKKSAIVDFLAAGIYTLKNSLLFLLYQIAMNPECQKKILEDTTNTYLKACSMETFRLSPTVHALARVTDRDLVLSGYKVSAGTVLLCQSALACQSERNFPEAKTFKPERWLNEEKNRTSATAAYLVTPFGYGKRICPGKRFIENALPIILEQMVQKFVITTERPLEVVFEFLVSPKAPISMTFQDRT

[0133] SEQ ID NO.3: EGFP gene sequence

[0134] GCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA

[0135] SEQ ID NO.4: Amino acid sequence of EGFP protein

[0136] ARAMPPTASPSSSAPPASCPCPGPPSPPPTACSASAATPTTSSTTSSSPPCPKATSRSAPSSSRTTATTRPAPRSSRATPWTASSRASTSRRTATSWGTSWSTTTTATTSISWPTSRRTASTSRSATTSRTAACSSPTTTSRTPPSATAPCCCPTTTAPSPPAKTPTRSAITWSCWSSPPPGSLSAWTSCTS

[0137] SEQ ID NO.5: Gene fragment targeting DvCYP314a1 gene of dsDvCYP314a1

[0138] CGAGGATACCACCAATACTTACTTGAAGGCATGTTCAATGGAAACCTTTCGATTATCGCCAACGGTTCATGCGCTAGCTCGGGTGACCGATAGGGATTTGGTGCTATCCGGGTACAAAGTCAGCGCTGGAACTGTGTTGCTGTGCCAATCAGCGCTAGCTTGCCAAAGTGAGCGAAACTTCCCGGAAGCCAAAACTTTTAAGCCAGAAAGATGGTTAAACGAAGAGAAAAACCGGACATCGGCAACAGCAGCTTACCTGGTCACCCCTTTTGGTTACGGAAAGAGGATTTGTCCAGGGAAGCGTTTCATTGAGAACGCATTGCCAATTATTCTGGAACAAATGGTCCAGAAGTTCGTCATTACAACC

[0139] SEQ ID NO.6: Gene fragment of dsEGFP targeting the EGFP gene

[0140] TACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACC

[0141] SEQ ID NO.7: Forward primer of the DvCYP314a1 gene

[0142] CAGGTGACTGGCACTACTTGA

[0143] SEQ ID NO.8:DvCYP314a1 cloning sequence

[0144] TCCAAGACCGAACGTAGCTG

[0145] SEQ ID NO.9:T7 ENVIRONMENT

[0146] FATHERCTCACTFATHERGG

[0147] SEQ ID NO.10:T7-DvCYP314a1-F

[0148] FATHER CATCACTFATHERGGCGAGGTACCACCAATACTT

[0149] SEQ ID NO.11:T7-DvCYP314a1-R

[0150] FATHERCGACTCACTFATGGGGGTTGTAATGACGAACTTCTG

[0151] SEQ ID NO.12:T7- EGFP -F

[0152] TAATACGACTCACTATAGGGTACGGCGTGCAGTGCTTCA

[0153] SEQ ID NO.13:T7- EGFP -R

[0154] TAATACGACTCACTATAGGGGGTGCTCAGGTAGTGGTTGTC

[0155] SEQ ID NO.14:qDvCYP314a1-F

[0156] CGATGTGAAGTGGCTGAGAAGT

[0157] SEQ ID NO.15:qDvCYP314a1-R

[0158] ATAGTTGGGCGTGGGAAAGG

[0159] SEQ ID NO.16:qTUB-F

[0160] CTTACCACCCCCACATACGG

[0161] SEQ ID NO.17:qTUB-R

[0162] ATTGCTGACTCCCTCTGGAC

[0163] SEQ ID NO.18: Sense strand of dsDvCYP314a1

[0164] CGAGGAUACCACCAAUACUUACUUGAAGGCAUGUUCAAUGGAAACCUUUCGAUUAUCGCCAACGGUUCAUGCGCUAGCUCGGGUGACCGAUAGGGAUUUGGUGCUAUCCGGGUACAAAGUCAGCGCUGGAACUGUGUUGCUGUGCCAAUCAGCGCUAGCUUGCCAAAGUGAGCGAAACUUCCCGGAAGCCAAAACUUUUAAGCCAGAAAGAUGGUUAAACGAAGAGAAAAACCGGACAUCGGCAACAGCAGCUUACCUGGUCACCCCUUUUGGUUACGGAAAGAGGAUUUGUCCAGGGAAGCGUUUCAUUGAGAACGCAUUGCCAAUUAUUCUGGAACAAAUGGUCCAGAAGUUCGUCAUUACAACC

[0165] SEQ ID NO.19: Antisense strand of dsDvCYP314a1

[0166] GGUUGUAAUGACGAACUUCUGGACCAUUUGUUCCAGAAUAAUUGGCAAUGCGUUCUCAAUGAAACGCUUCCCUGGACAAAUCCUCUUUCCGUAACCAAAAGGGGUGACCAGGUAAGCUGCUGUUGCCGAUGUCCGGUUUUUCUCUUCGUUUAACCAUCUUUCUGGCUUAAAAGUUUUGGCUUCCGGGAAGUUUCGCUCACUUUGGCAAGCUAGCGCUGAUUGGCACAGCAACACAGUUCCAGCGCUGACUUUGUACCCGGAUAGCACCAAAUCCCUAUCGGUCACCCGAGCUAGCGCAUGAACCGUUGGCGAUAAUCGAAAGGUUUCCAUUGAACAUGCCUUCAAGUAAGUAUUGGUGGUAUCCUCG

[0167] Although embodiments of the present invention have been shown and described above, it is understood that the above embodiments are exemplary and should not be construed as limiting the present invention. Those skilled in the art can make changes, modifications, substitutions and variations to the above embodiments within the scope of the present invention.

Claims

1. A dsRNA targeting a gene fragment of DvCYP314al gene of the Dendroctonus valens, the nucleotide sequence of the gene fragment is shown as SEQ ID NO.

5.

2. The dsRNA of claim 1, wherein the nucleotide sequences of the two single strands of the dsRNA are SEQ ID NO: 18 and SEQ ID NO: 19, respectively.

3. A composition for controlling Dendroctonus valens, the composition comprising the dsRNA of claim 1 or 2, and a pest control-acceptable carrier.

4. The composition of claim 3, wherein the carrier is a star polycationic nanocarrier.

5. The composition of claim 4, wherein the mass ratio of the dsRNA to the star polycationic nanocarrier in the composition is 1:

1.

6. A method of controlling the red turpentine beetle comprising the steps of:

6. The dsRNA of claim 1 or 2, or the composition of any one of claims 3-5 is applied to Dendroctonus valens.

7. The method of claim 6, wherein the application is by body wall dripping or spraying.

Images