Phosphorus deficiency stress responding rice transcription factor OsbHLH18 and application thereof

By overexpressing the rice transcription factor OsbHLH18 and regulating acid phosphatase activity, the problem of phosphorus deficiency in rice was solved, and the phosphorus content and growth performance of rice were improved.

CN121610518APending Publication Date: 2026-03-06HUAZHONG AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202511907484.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-17
Publication Date
2026-03-06

AI Technical Summary

Technical Problem

Current research on the molecular mechanisms of phosphorus deficiency stress in rice is limited, and there is a lack of effective transcription factor regulation methods, resulting in low phosphorus utilization efficiency in rice.

Method used

By constructing and overexpressing the rice transcription factor OsbHLH18, the expression of downstream acid phosphatase genes was regulated, thereby increasing the activity of acid phosphatase in the roots and root surface and enhancing the absorption and utilization of phosphorus in rice.

Benefits of technology

Overexpression of OsbHLH18 can significantly increase the phosphorus content of rice, enhance its adaptability to phosphorus deficiency stress, and promote rice growth and phosphorus accumulation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121610518A_ABST
    Figure CN121610518A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of gene engineering, and provides a rice transcription factor OsbHLH18 responding to phosphorus deficiency stress and application thereof, the transcription factor OsbHLH18 is subjected to overexpression to be applied to increase of the phosphorus content of rice, an expression mode of the OsbHLH18 is explored, the effect of an overexpression OsbHLH18 carrier on rice growth is evaluated, and the result shows that the OsbHLH18 is a transcription factor positioned on a cell nucleus, and the OsbHLH18 is a transcription factor positioned on a cell nucleus. The transcription activity is realized; osbHLH18 is subjected to phosphorus deficiency induced expression on leaves and roots of rice, and the phosphorus deficiency induced expression is faster and higher in response to the roots; the plant height of the overexpressed OsbHLH18 rice is higher than that of a wild type, the overexpressed OsbHLH18 can regulate and control expression of downstream acid phosphatase genes, then the activity of acid phosphatase of root systems and root surfaces is improved, the phosphorus deficiency stress adaptability of the rice is relieved by degrading organic phosphorus, and the phosphorus content of the rice is improved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology and relates to transcription factor OsbHLH18, specifically to a rice transcription factor OsbHLH18 that responds to phosphorus deficiency stress and its application. Background Technology

[0002] Phosphorus is an essential nutrient element for plant growth and development, participating in various physiological processes such as energy transfer, signal transduction, nucleic acid and membrane structure construction. Phosphorus in soil mainly exists in the form of insoluble inorganic or organic phosphorus, and the concentration of available phosphorus for direct absorption and utilization by plants is usually low. Therefore, phosphorus deficiency has become one of the major factors limiting crop yield. To cope with phosphorus deficiency stress, plants have evolved a series of adaptive mechanisms, including altering root architecture, enhancing the expression of phosphate transport proteins, inducing acid phosphatase and organic acid secretion, and establishing symbiotic relationships with arbuscular mycorrhizal fungi. These response processes are usually precisely regulated by transcription factors.

[0003] bHLH (basic Helix-Loop-Helix) transcription factors are a class of regulatory proteins widely distributed in plants, participating in multiple biological processes such as light signal transduction, hormone response, abiotic stress response, and nutrient uptake and utilization. The rice bHLH family member OsPTF1 has been reported to be induced by phosphorus deficiency, and overexpression of OsPTF1 increases phosphorus uptake by promoting root growth. OsbHLH6 can regulate phosphorus starvation response through interaction with the phosphorus signaling protein OsSPX4. However, the rice bHLH family has many members, and the functions of most genes under phosphorus stress remain unclear; their regulatory mechanisms in the phosphorus signaling network still require further investigation.

[0004] Currently, research on the molecular mechanisms of phosphorus deficiency response in rice mainly focuses on downstream functional genes such as phosphorus transporters and phosphatases, while the systematic exploration and functional verification of upstream transcription factors remain relatively limited. Therefore, discovering new transcription factors that respond to phosphorus deficiency stress and elucidating their regulatory roles in phosphorus signaling pathways is of great significance for revealing the molecular basis of phosphorus efficiency in plants and for breeding new varieties of phosphorus-efficient crops.

[0005] This invention provides a rice transcription factor OsbHLH18 that responds to phosphorus deficiency stress and its application. Overexpression of the transcription factor OsbHLH18 is used to increase the phosphorus content of rice, providing a new approach and means to improve acid phosphatase activity and phosphorus content, thereby solving the problem of phosphorus deficiency in rice. Summary of the Invention

[0006] The purpose of this invention is to provide a rice transcription factor OsbHLH18 that responds to phosphorus deficiency stress. By applying OsbHLH18 to the phosphorus deficiency stress response of rice and using OsbHLH18 overexpression plasmids to improve rice growth, this invention provides a new approach and means to improve acid phosphatase activity and phosphorus content, thereby solving the problem of phosphorus deficiency in rice.

[0007] To achieve the above objectives, the technical solution of the present invention is as follows:

[0008] This invention provides a method for constructing a rice overexpression vector of OsbHLH18. The method specifically includes: using rice cDNA as a template, amplifying the CDS sequence of OsbHLH18 by PCR, ligating the amplified product with an enzyme-digested pTF101 vector, transforming it into Escherichia coli DH5α strain using a heat shock method, selecting single clones for PCR verification, and identifying plasmids that correctly align with positive clones through sequencing as OsbHLH18 overexpression vectors.

[0009] Preferably, the PCR amplification includes the use of an upstream primer and a downstream primer, wherein the upstream primer is: gtcgactctagaggatccATGGCGACGCAGTGGTTC, and the downstream primer is: cccggggctgttggatccCAGGGATAACTTGAATGC.

[0010] The present invention also provides a method for preparing rice seedlings overexpressing OsbHLH18, wherein the preparation method is as follows: the above-mentioned overexpressing OsbHLH18 vector is used to transform Agrobacterium EHA105, and OsbHLH18 overexpressing rice is obtained by Agrobacterium-mediated rice genetic transformation.

[0011] Preferably, the preparation method specifically includes:

[0012] (1) EHA105 Agrobacterium competent cells were mixed with OsbHLH18 overexpression vector and single clones were selected for verification. After the positive clones were correctly sequenced, the bacterial culture of the positive clones was mixed with an equal volume of 80% glycerol for later use.

[0013] (2) After disinfection and cleaning, the seeds are soaked. After soaking, the seeds are dried and transferred to the induction medium. The embryos are placed in the incubator in the dark. After the embryos are placed upwards, the appropriate callus tissues are selected and transferred to the subculture medium for further culture to complete the preparation of rice callus tissues.

[0014] (3) Soak the rice callus tissue in the prepared Agrobacterium tumefaciens solution, drain it, and then place the callus tissue on a co-culture medium for dark culture.

[0015] (4) After the callus tissue has been cultured in the dark, it is repeatedly washed, sterilized and dried. The dried callus tissue is then transferred to a selective medium containing sodium carbenicillin and glufosinate, an antibiotic corresponding to the plant selection marker of the carrier, for the first round of selection. After dark culture, the second round of selection is carried out until granular resistant callus tissue grows.

[0016] (5) Select resistant callus tissue and place it on differentiation medium. After light culture, the callus tissue will differentiate into seedlings, thus completing the preparation of rice seedlings overexpressing OsbHLH18.

[0017] Preferably, the suitable callus tissue is pale yellow, granular, dry, and highly viable.

[0018] Preferably, the concentration of carbenicillin sodium is 400 mg / L, and the concentration of the antibiotic glufosinate is 20 mg / L.

[0019] The present invention also provides an OsbHLH18 overexpression vector obtained by the above construction method.

[0020] The present invention also provides the application of the above-mentioned OsbHLH18 overexpression vector in rice growth.

[0021] The present invention also provides an application of rice transcription factor OsbHLH18 in the detection of phosphorus deficiency in rice, wherein rice transcription factor OsbHLH18 is highly expressed in rice roots when phosphorus deficiency is induced.

[0022] The beneficial effects of this invention are:

[0023] This invention provides a rice transcription factor OsbHLH18 that responds to phosphorus deficiency stress and its application. Overexpression of OsbHLH18 was used to increase phosphorus content in rice. The expression pattern of OsbHLH18 was explored, and the effects of OsbHLH18 overexpression materials were evaluated. The results showed that OsbHLH18 is a nucleus-localized transcription factor with transcriptional activity. OsbHLH18 expression was induced by phosphorus deficiency in both rice leaves and roots, with faster and higher expression in roots. The plant height of OsbHLH18 overexpression materials was higher than that of wild-type materials, indicating that OsbHLH18 overexpression can regulate the expression of downstream acid phosphatase genes, thereby increasing the activity of acid phosphatase in roots and root surfaces. This, in turn, alleviates phosphorus deficiency stress adaptation in rice by degrading organic phosphorus and increases the phosphorus content of rice. Attached Figure Description

[0024] Figure 1 This is the expression pattern of OsbHLH18 in response to phosphorus deficiency stress in this invention (A is the expression heatmap of OsbHLH18 gene in response to phosphorus deficiency; B is the relative expression level of OsbHLH18 in rice leaves and roots; *P<0.05, intergroup comparison).

[0025] Figure 2 This is a subcellular localization of transcription factor OsbHLH18 in rice protoplasts in an embodiment of the present invention (A is a localization map of co-expression of empty vector PM999::GFP and nuclear marker; B is a localization map of co-expression of OsbHLH18::GFP and nuclear marker; C is a localization map of co-expression of GFP::OsbHLH18 and nuclear marker).

[0026] Figure 3 This is a diagram verifying the transcriptional activity of OsbHLH18 in a yeast system in an embodiment of the present invention;

[0027] Figure 4 The following are the phenotypic analysis results of the OsbHLH18 overexpression material in the embodiments of the present invention under normal phosphorus (HP) and low phosphorus (LP) conditions (A is the phenotypic diagram; B is the expression level of OsbHLH18 in the overexpression material; C is the plant height; D is the root length; E is the aboveground dry weight; F is the root dry weight; *P<0.05, **P<0.01, intergroup comparison).

[0028] Figure 5 This is an analysis of acid phosphatase activity of the OsbHLH18 overexpression material under normal phosphorus (HP) and low phosphorus (LP) conditions in this invention (A is leaf acid phosphatase activity; B is root acid phosphatase activity; C is root surface acid phosphatase activity; *P<0.05, intergroup comparison).

[0029] Figure 6 This is an analysis of phosphorus content in the OsbHLH18 overexpression material under normal phosphorus (HP) and low phosphorus (LP) conditions in this invention (A is the inorganic phosphorus content in leaves; B is the inorganic phosphorus content in roots; C is the total phosphorus content in aboveground parts; D is the total phosphorus content in roots; *P<0.05, intergroup comparison). Detailed Implementation

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0031] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0032] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to specific embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0033] Example 1: Expression pattern analysis of OsbHLH18 in response to phosphorus deficiency stress

[0034] Analysis of transcriptome data from rice roots at different phosphorus deficiency time points revealed that prolonged phosphorus deficiency for 24 days significantly induced OsbHLH18 expression, which immediately decreased upon restoration of phosphorus supply (21+1 days). Other genes did not respond to phosphorus deficiency stress. Figure 1 A). Therefore, OsbHLH18 was selected as the target gene for functional analysis. To verify the transcriptome data, quantitative PCR was used to analyze the expression level of OsbHLH18 in leaves and roots at different phosphorus-deficient time points. Wild-type rice Nipponbare was used as material. The rice was cultured in normal nutrient solution for 10 days, then subjected to phosphorus-deficient culture for 21 days, followed by 1 day of normal phosphorus restoration. Samples were taken from leaves and roots on day 10 of normal culture (designated 0d), days 3, 7, 10, 14, and 21 of phosphorus-deficient culture (designated 3d, 7d, 10d, 14d, and 21d), and day 1 of restored phosphorus supply (designated R1d). RNA was extracted using an RNA extraction kit (Kangwei), and 1 μg of RNA was synthesized into cDNA using a reverse transcription kit (Kangwei). The cDNA template was diluted 5-fold, and the reaction system was prepared according to the instructions of the quantitative PCR kit (Yisheng). Quantitative PCR (Applied Biosystems QuantStudio™ 6 Flex System) was performed using 2... -ΔΔCT The relative expression level of OsbHLH18 was calculated using the method described above.

[0035] The reaction system is as follows:

[0036]

[0037] The PCR procedure is as follows:

[0038] Primers for quantitative real-time PCR of OsbHLH18 were designed using the NCBI (National Center for Biotechnology Information) database. The upstream primer was GGTCAAGATCCACTGCGAGA, and the downstream primer was TCACAGGGATAACTTGAATGCTTG. The amplification length was 214 bp.

[0039] like Figure 1As shown in Figure B, the expression level of OsbHLH18 in roots was higher than that in leaves. After 14 days of phosphorus deficiency, the expression level of OsbHLH18 in leaves began to increase, and the expression level increased with prolonged phosphorus deficiency. Once phosphorus supply was restored, the expression level immediately decreased. However, after 10 days of phosphorus deficiency, the expression level of OsbHLH18 in roots began to increase, and the expression level gradually increased with prolonged phosphorus deficiency, before significantly decreasing after phosphorus supply was restored. This indicates that OsbHLH18 expression is induced by phosphorus deficiency in both leaves and roots, with a faster and higher response in roots.

[0040] Example 2 Subcellular localization analysis of OsbHLH18 protein

[0041]

[0042] Vector construction: Using cDNA from Nipponbare rice as a template, the CDS sequence of OsbHLH18 was amplified by PCR. This CDS sequence was then ligated to the linearized vector PM999::GFP using a seamless cloning kit (ABclonal) to construct the vector OsbHLH18::GFP or GFP::OsbHLH18, fused to the N-terminus or C-terminus of GFP. The vector was then transformed into *E. coli* DH5α strain using the heat shock method. Single clones were selected for PCR verification. Positive clones were sequenced, and plasmids that matched the alignment were subjected to plasmid extraction for protoplast transformation.

[0043] Protoplast transformation: After dehulling, seeds were sterilized with 75% alcohol, 84 disinfectant, and sterilized water, then sown in rooting tubes containing solid nutrient solution and cultured in the dark at 28℃ for 10-12 days to obtain etiolated seedlings. Stems and leaf sheaths of the etiolated rice seedlings were taken and cut into 0.1-1.0 mm pieces, placed in enzymatic hydrolysate, vacuum-sealed for 30 min, and then placed on a shaker at 45 r / min for 4-5 h in the dark at room temperature. Twice the volume of W5 solution was added, and the enzymatic hydrolysate was filtered through a 400-mesh nylon mesh. Protoplasts were collected by centrifugation at 100 g for 10 min. The supernatant was discarded, 10 mL of W5 solution was added and gently mixed, centrifuged at 100 g for 5 min, and an appropriate volume of MMG solution was added. The mixture was then placed on ice for 30 min. Add 5 µg of plasmids to each 2 mL centrifuge tube, along with 200 µL of protoplasts and 220 µL of 40% PEG solution. Mix gently and incubate at room temperature for 20 min. Terminate the reaction by adding 1 mL of W5 solution. Centrifuge at 100g for 5 min, discard the supernatant, add 1 mL of W5 solution, mix gently, and incubate horizontally in a 28℃ incubator in the dark for 12-15 h. Observe the fluorescence signal in the cells using a laser confocal microscope (Leica). The excitation / emission wavelengths of GFP are 488 nm / 505-545 nm, and the excitation / emission wavelengths of mCherry are 552 nm / 580-645 nm.

[0044] The results are as follows Figure 2 As shown in Figure A, the empty vector is highly expressed in the cell membrane, cytoplasm, and nucleus. The green fluorescence signals of both OsbHLH18::GFP and GFP::OsbHLH18 overlap with the red fluorescence signal of the nuclear marker, indicating that OsbHLH18 is a typical nuclear transcription factor. Figure 2 (BC in the middle).

[0045] Example 3: Transcriptional activity analysis of OsbHLH18

[0046] Vector construction: Using cDNA from Nipponbare rice as a template, the CDS sequence of OsbHLH18 was amplified by PCR, ligated into the linearized vector pGBKT7 using a seamless cloning kit, and transformed into Escherichia coli DH5α strain using the heat shock method. Single clones were selected for PCR verification, and positive clones were sequenced. Plasmids with correct alignment were used for yeast transformation.

[0047] Yeast transformation: Take 100 μL of Y2HGold competent cells, add 1 μg of plasmid, 10 μL of denatured carrier DNA, and 500 μL of PEG / LiAc, mix well, incubate at 30℃ for 30 min, incubate at 42℃ for 15 min, centrifuge at 5000 rpm for 1 min and discard the supernatant, add 500 μL of sterile ddH2O to resuspend, and take 100 μL to spread on SD / -Trp medium and incubate at 30℃ for 3 days.

[0048] Transcriptional activity assay: Single colonies were picked and cultured in SD / -Trp liquid medium until OD600 reached 1. The culture was then diluted 10-fold, 100-fold, and 1000-fold with sterile water. Six μL of each colony was spotted onto SD / -Trp and SD / -His / -Trp+X-α-gal plates and incubated at 30°C for 3 days. Results are as follows: Figure 3 As shown, the negative control pGBKT7 could not grow on SD / -His / -Trp+X-α-gal plates, while the positive controls pGBKT7-VP16 and pGBKT7-OsbHLH18 grew on SD / -His / -Trp+X-α-gal plates and the colonies were blue, indicating that OsbHLH18 has transcriptional activity.

[0049] Example 4: Phenotypic analysis of OsbHLH18 overexpression rice

[0050] To investigate the function of OsbHLH18 in phosphorus deficiency stress, this invention creates OsbHLH18 overexpression materials.

[0051] Construction of the OsbHLH18 overexpression vector: First, primers for the overexpression vector were designed based on the principle of the seamless cloning kit. An 18 bp homologous sequence to the vector junction was added to both ends of the primers. The upstream primer for amplifying the OsbHLH18 CDS sequence was: gtcgactctagaggatccATGGCGACGCAGTGGTTC, and the downstream primer was: cccggggctgttggatccCAGGGATAACTTGAATGC. Lowercase letters represent homologous arms, and uppercase letters represent the specific sequence of OsbHLH18. Using cDNA from Nipponbare rice as a template, the OsbHLH18 CDS sequence was amplified by PCR. The PCR system consisted of 0.2 µL of cDNA, 0.4 µL each of the upstream and downstream primers, and 10 µL of 2x high-fidelity enzyme (Qingke I-5). TM The PCR conditions were as follows: 98℃ pre-denaturation for 2 min, 98℃ denaturation for 10 s, 58℃ annealing for 15 s, 72℃ extension for 20 s, and 72℃ final extension for 5 min, for 34 cycles. PCR products were separated by agarose gel electrophoresis, and the target fragment was recovered using a gel extraction kit (Qingke). The vector pTF101 was also linearized by restriction endonuclease BamHI (Thermo Fisher Scientific), and recovered using the same gel extraction kit (Qingke). Finally, the target gene and the linearized vector were ligated using a seamless cloning kit (ABclonal) at a 3:1 molar ratio. The ligation system consisted of 0.22 µL of OsbHLH18 CDS fragment, 1.1 µL of linearized vector, 2.5 µL of 2x Seamless, and 1.18 µL of ddH2O. The mixture was incubated at 50℃ for 30 min. The ligation product was transformed into *E. coli* DH5α strain using a heat shock method. 5 µL of the ligation product was added to 50 µL of DH5α competent cells and gently mixed. The mixture was incubated on ice for 30 min, then at 42°C for 60 s, followed by incubation on ice for 2-3 min. 500 µL of antibiotic-free liquid LB medium was added, and the mixture was activated at 37°C and 200 rpm for 1 h in a shaker. After centrifugation at 5000g for 2 min, the supernatant was discarded. The bacterial cells were spread onto LB solid medium containing kanamycin and incubated upside down overnight at 37°C. Single clones were selected for PCR verification, and positive clones were sequenced. The sequencing results were compared with a reference sequence. The plasmid that aligned correctly was identified as the OsbHLH18 overexpression vector.

[0052] Creation of overexpression materials: Genetic transformation of rice was carried out using Agrobacterium-mediated transgenic technology, with the background material being the japonica rice variety Nipponbare.

[0053] Transformation of Agrobacterium EHA105: Thaw competent Agrobacterium EHA105 cells on ice, add 2 µL of LOsbHLH18 overexpression vector plasmid DNA, gently mix with a pipette tip, incubate on ice for 1-2 min, place centrifuge tubes in liquid nitrogen for 1 min, and then incubate at 37°C for 5 min. Add 400 µL of antibiotic-free LB medium and activate at 28°C with a shaker at 200 rpm for approximately 3-4 h. Spread 100 µL of the bacterial culture evenly onto LB agar plates containing kanamycin and streptomycin resistance, and incubate upside down at 28°C for approximately 2-3 days. Select single clones and activate them with LB liquid medium containing kanamycin and streptomycin resistance for PCR verification. Mix the bacterial culture of positive clones with an equal volume of 80% glycerol and store at -80°C for subsequent rice genetic transformation.

[0054] Induction and subculturing of rice callus: After dehulling mature rice seeds, select plump, smooth, and sterile seeds and place them in centrifuge tubes. First, disinfect with 75% ethanol for 2 min, then add 30% NaClO solution (or 84 disinfectant: sterile water = 1:1) for 30 min, inverting and mixing several times during this process. Finally, wash five times with sterile water, and soak in sterile water for 30 min in the last wash, inverting and mixing several times during this process. After absorbing moisture on sterile filter paper, transfer the seeds to induction medium with the embryo facing up. Incubate in the dark at 28℃ for one month. Select pale yellow, granular, dry, and viable callus tissue and transfer it to subculture medium for further culture for about 20 days.

[0055] Infection and Co-culture: A single Agrobacterium colony was picked up with a sterile toothpick and placed in 10 mL of LB broth (containing kanamycin and streptomycin). The culture was incubated at 28°C with shaking at 250 rpm for 12-36 h until the OD600 reached 0.8-1.0. The Agrobacterium suspension was centrifuged at low speed (4000 rpm, 10 min), the supernatant was discarded, and the suspension was resuspended in an appropriate amount of suspension medium and diluted to an OD600 of 0.1. Rice callus particles that had grown to a certain size were picked up and soaked in the Agrobacterium suspension for 30 min. The callus tissue was removed, placed on sterile filter paper to drain for 2 h, and then evenly placed on a co-culture medium (with a layer of sterile filter paper on top to prevent excessive Agrobacterium growth). The culture was then incubated in the dark at 19°C for 3 days.

[0056] Screening of resistant callus: After 3 days of co-culture, callus was collected in 250 mL blue-capped bottles and repeatedly washed with sterile water until the water was clear. Finally, sterile water containing 1000 mg / L carbenicillin sodium was added and the callus was soaked for 30 min. The callus was spread on filter paper and dried for 3 h. The dried callus was then transferred to a selection medium containing 400 mg / L carbenicillin sodium and glufosinate (20 mg / L), the antibiotic corresponding to the vector plant selection marker, for the first round of selection. After 14 days of dark incubation at 28℃, a second round of selection was conducted until granular resistant callus tissue grew.

[0057] Differentiation and seedling formation of resistant callus: Select 2-3 resistant callus from the same callus and place them on differentiation medium. After culturing at 26℃ under light for 30-50 days, the callus tissue will differentiate into seedlings. When the green shoots grow to about 3-5 cm, remove the young roots with scissors and transfer them to rooting medium for culturing at 26℃ under light.

[0058] Transplanting and molecular identification of transgenic seedlings: After 10-15 days of rooting culture, seedlings with relatively complete root and stem-leaf differentiation were selected, the sealing film was opened, and an appropriate amount of distilled water or sterile water was added. After hardening off in a culture room for 5-7 days, the seedlings were transferred to rice nutrient solution for culture. Finally, the obtained transgenic seedlings were used for field propagation. Molecular detection was performed on the obtained transgenic materials. RNA was extracted from the leaves of the transgenic materials using an RNA kit (Kangwei). 1 µg of RNA was reversed into cDNA, and the cDNA was diluted 10-fold for quantitative real-time PCR analysis of OsbHLH18 expression. The quantitative PCR system, procedure, and primers were the same as in Example 1.

[0059] Quantitative PCR analysis confirmed that the expression level of OsbHLH18 in the overexpression material was 30-50 times that of the wild type. Figure 4 B). These three overexpression lines and the wild type were treated with normal phosphorus (HP) and low phosphorus (LP), and their growth phenotypes were observed. Under both normal and low phosphorus conditions, the plant height of the overexpression materials was higher than that of the wild type, while there was no significant difference in root length. Figure 4 A, Figure 4 C and Figure 4 D), the dry weight of the stem and roots of the OE-12 strain was significantly higher than that of the wild type ( Figure 4 (EF in the text). This indicates that overexpression of OsbHLH18 can promote rice growth.

[0060] Example 5: Acid phosphatase activity analysis of OsbHLH18 overexpression material

[0061] This invention uses the pNPP method to determine the acid phosphatase activity in leaves, roots, and root surface. Rice seeds were cultured in normal nutrient solution for 2 weeks after germination, followed by normal phosphorus (HP) and low phosphorus (-LP) treatments for 10 days. A portion of the seedlings were used to determine the acid phosphatase activity in leaves and roots. 0.1g of fresh sample was ground in liquid nitrogen, and 0.8 mL of protein extraction reagent was added. The sample was centrifuged at 14000g, 4℃ for 20 min, and the supernatant was collected. The protein concentration was determined using the Coomassie brilliant blue method. 10 μg (or 1 μg) of protein from leaves (or roots) was reacted with 600 μL of reaction solution containing 10 mM pNPP. The reaction was carried out at room temperature for 30 min, and then 1.2 mL of 1M NaOH was added to terminate the reaction. The OD410 absorbance value was measured. Another portion of the seedlings had their roots quickly rinsed with distilled water, then transferred to 30 mL of rice culture medium (pH 5.5) containing 10 mM pNPP. A control sample without plant samples was taken and reacted at 30℃ for 30 min. 370 µL of the reaction solution was then added to 1.66 mL of 1 M NaOH to terminate the reaction, and the OD410 absorbance was measured. After the measurement, the roots were weighed. Root surface acid phosphatase activity was calculated based on the pNP standard curve.

[0062] The results are as follows Figure 5 As shown, overexpression of OsbHLH18 does not affect the activity of acid phosphatase in leaves ( Figure 5 A), but under low phosphorus conditions, the root acid phosphatase activity of the OsbHLH18 overexpression material was significantly higher than that of the wild type ( Figure 5 B). Under different phosphorus levels, the root surface acid phosphatase activity of the overexpression material was significantly higher than that of the wild type. Figure 5 C). This suggests that overexpression of OsbHLH18 may improve the activity of root and root surface acid phosphatase by regulating the expression of downstream acid phosphatase genes, thereby alleviating phosphorus deficiency stress in rice through the degradation of organic phosphorus.

[0063] Example 6: Analysis of Inorganic Phosphorus and Total Phosphorus Concentrations in OsbHLH18 Overexpression Material

[0064] To verify whether OsbHLH18 affects the phosphorus content in rice, this invention determined the inorganic and total phosphorus content in the aboveground parts and roots of the overexpression material under normal and low phosphorus conditions. After germination, rice seeds were cultured in normal nutrient solution for 2 weeks, followed by normal phosphorus (HP) and low phosphorus (LP) treatments for 10 days. The roots were washed three times with distilled water and dried. Then, 25 mg of fresh leaf and root samples were taken from a portion of the seedlings and extracted with 25 μL of 5M sulfuric acid and 1.5 mL of distilled water. The samples were centrifuged at 10000 g at 4℃ for 10 min, and the supernatant was collected. The mixture was reacted at room temperature for 30 min at a 3:1 volume ratio of sample to malachite green working solution, and the absorbance at OD650 nm was measured. The inorganic phosphorus concentration was calculated based on the KH2PO4 standard curve. Another portion of the seedlings was sampled from the aboveground parts and roots, bagged, and dried at 60℃ to constant weight. The samples were ground, and 250 mg of the sample was placed in a digestion tube, 2 mL of concentrated sulfuric acid was added, and the mixture was left to stand overnight. Heat the digestion tube at 120℃ for 1 hour, add 3-4 drops of 30% H2O2, continue digestion for 30 minutes, then add another 3-4 drops of 30% H2O2, repeating this process until the digestion solution becomes clear. Finally, continue digestion for about 1 hour to completely decompose the H2O2. After the digestion solution cools, add pure water to 1-2 cm below the mark, cool to room temperature, and then bring the volume to 20 mL. Shake well, filter through filter paper into a 10 mL centrifuge tube for later use. Dilute the digestion solution by a certain factor, take 1 mL of the diluted solution into a 10 mL centrifuge tube, add one drop of 2,4-dinitrophenol indicator, add 4M NaOH solution until it turns yellow, then add 2M H2SO4 until it becomes colorless, add pure water to the 7-8 mL mark, add 1 mL of molybdenum antimony reagent, bring the volume to 10 mL, mix well, incubate at 30℃ for 30 minutes, and measure the OD700 absorbance value using a microplate reader. Calculate the total phosphorus concentration of the sample according to the KH2PO4 standard curve.

[0065] The results are as follows Figure 6 As shown, normal phosphorus levels and overexpression of OsbHLH18 can significantly increase the inorganic phosphorus content in leaves. Figure 6 A), the root inorganic phosphorus content was also increased, with the OE-5 strain showing a significantly higher root inorganic phosphorus content than the wild type ( Figure 6 B). Similarly, overexpression of OsbHLH18 increased the total phosphorus concentration in both the shoots and roots under normal phosphorus conditions (B). Figure 6 (CD in the text). This indicates that overexpression of OsbHLH18 can increase phosphorus content in rice, but the specific mechanism needs further analysis.

[0066] In summary, OsbHLH18 is a nucleus-based transcription factor, and transcriptional activity analysis confirmed its transcriptional activity. OsbHLH18 expression was induced in both rice leaves and roots by phosphorus deficiency, with faster and higher expression in the roots in response. Three OsbHLH18 overexpression materials were created; the plant height of the overexpression materials was higher than that of the wild type, while root length showed no significant difference, indicating that OsbHLH18 overexpression can promote rice growth. OsbHLH18 overexpression may alleviate phosphorus deficiency stress in rice by regulating the expression of downstream acid phosphatase genes, thereby increasing the activity of acid phosphatase in the roots and root surface, and degrading organic phosphorus to improve rice's adaptation to phosphorus deficiency stress and increase phosphorus content.

[0067] The above-described embodiments are merely preferred embodiments of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the scope of protection of the present invention. Therefore, the scope of protection of the present invention should be determined by the appended claims.

Claims

1. A method for constructing a rice overexpression vector for OsbHLH18, characterized in that, The construction method specifically comprises the following steps: taking rice cDNA as a template, amplifying the CDS sequence of OsbHLH18 by PCR, connecting the amplification product with the pTF101 carrier subjected to enzyme digestion, and then transforming the connection product into an E. coli DH5a strain by heat shock method, picking a single clone for PCR verification, and sequencing the positive clone to obtain a plasmid for comparison.

2. The construction method of claim 1, wherein, The PCR amplification comprises using an upstream primer and a downstream primer, wherein the upstream primer is gtcgactctagaggatccATGGCGACGCAGTGGTTC, and the downstream primer is cccggggctgttggatccCAGGGATAACTTGAATGC.

3. A method for preparing a rice seedling overexpressing OsbHLH18, characterized by, The preparation method specifically comprises the following steps:

4. The production method according to claim 3, characterized by, (1) mixing EHA105 agrobacterium competent cells with the super-expression OsbHLH18 carrier, picking a single clone for verification, and mixing the bacterial liquid of the positive clone with 80% glycerol in an equal volume for standby use after sequencing comparison; (2) soaking the seed after disinfection and cleaning, drying the seed after soaking, and then placing the seed into an induction medium with the seed embryo upward, and then placing the appropriate callus into a subculture medium for continuous culture to prepare the rice callus; (3) soaking the rice callus in the standby agrobacterium bacterial liquid, draining, and then placing the callus on a co-culture medium for dark culture; (4) repeatedly washing and sterilizing the callus after dark culture, drying the callus, and then placing the dried callus into a selection medium containing carbenicillin sodium and an antibiotic corresponding to the plant selection marker glufosinate ammonium for the first round of selection, and then performing the second round of selection after dark culture until the granular resistant callus grows out; (5) picking the resistant callus and placing it on a differentiation medium, and then culturing the callus under light to differentiate the seedlings, and then preparing the super-expression OsbHLH18 rice seedlings. The appropriate callus is a light yellow, granular, dry and strong callus.

5. The production method according to claim 4, characterized by, The concentration of the carbenicillin sodium is 400 mg / L, and the concentration of the antibiotic glufosinate ammonium is 20 mg / L.

6. The preparation method according to claim 4, characterized in that, 7. The OsbHLH18 super-expression carrier obtained by the construction method according to claim 1.

8. The application of the OsbHLH18 super-expression carrier according to claim 7 in rice growth. The rice transcription factor OsbHLH18 is highly expressed under the induction of phosphorus deficiency when the rice root is short of phosphorus.

9. Application of rice transcription factor OsbHLH18 in detection of phosphorus deficiency in rice, characterized in that, ​