Use of a pi-cnv9 gene from african cultivated rice in improving disease resistance in rice

Abstract

This invention discloses a cultivated rice from Africa pi- cnv9 The application of genes in improving rice disease resistance belongs to the field of genetic engineering technology. This invention has screened a gene associated with rice blast resistance. pi-cnv9 The gene, whose nucleotide sequence is shown in SEQ ID NO.1, was used in this invention to construct complementary transgenes for *Rhizophora flavescens* and *Rhizophora esculenta*, respectively. pi-cnv9 Rice plants with complementary genes. Inoculation experiments were conducted on wild-type and transgenic plants, and the results demonstrated that complementary transgenic... pi-cnv9 Genetically modified plants are more resistant to disease than wild-type plants; indicating that... pi-cnv9 Genes that positively regulate the disease resistance of rice can be used as target genes for genetic improvement and molecular breeding of rice resistance to rice blast, which is of great significance for breeding rice varieties with improved disease resistance.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, and in particular to a type of cultivated rice from Africa. pi-cnv9 Application of genes in improving disease resistance in rice. Background Technology

[0002] Rice is one of the world's most important food crops, with more than half of the world's population relying on it as a staple food. Rice blast is one of the most destructive diseases affecting rice production, exhibiting high diversity and characterized by its epidemic, sudden onset, and devastating effects, causing significant yield reductions annually. Practice has proven that breeding and planting disease-resistant varieties is the most effective, economical, and environmentally friendly measure for controlling rice blast. Because the physiological races of rice blast mutate rapidly, many new resistant varieties lose or even become resistant after a few years of widespread cultivation. Therefore, it is necessary to extensively collect various resistant germplasm resources and promptly replace and improve varieties adapted to local conditions to prevent outbreaks and epidemics of rice blast.

[0003] To date, several disease resistance genes have been identified in the rice genome, such as Pi9 , Pi-ta , Pib , Pish , Pigm More than half of these loci are distributed as gene clusters on chromosomes 6, 11, and 12 of rice. Researchers have identified many rice blast genes over the past few decades, but due to the complex genetic structure and susceptibility to mutation within the rice blast fungus population, resistant rice varieties often struggle to maintain their resistance. Therefore, it is urgent to continuously discover new rice resistance genes, increase gene reserves, and aggregate superior genes to diversify rice resistance genes and defend against the ever-changing races of rice blast fungus. Summary of the Invention

[0004] The purpose of this invention is to provide a cultivated rice from Africa. pi-cnv9 The application of genes in improving rice disease resistance addresses the problems of existing technologies. This invention screens a gene associated with rice blast resistance. pi- cnv9 Genes can be used as target genes for genetic improvement and molecular breeding of rice resistance to rice blast, which is of great significance for breeding rice varieties with improved disease resistance.

[0005] To achieve the above objectives, the present invention provides the following solution: This invention provides pi-cnv9 The application of genes in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the development of transgenic rice with enhanced resistance to rice blast; (3) Application in the preparation of products that enhance rice resistance to rice blast; The pi-cnv9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0006] Furthermore, the aforementioned [method / condition] was upregulated in rice. pi-cnv9 The expression level of the gene increases the resistance of the rice to rice blast.

[0007] The present invention also provides an application of a recombinant vector, the recombinant vector comprising: pi-cnv9 Gene; The pi-cnv9 The nucleotide sequence of the gene is shown in SEQ ID NO.1; The application is any one of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the development of transgenic rice with enhanced resistance to rice blast; (3) Application in the preparation of products that improve rice resistance to rice blast.

[0008] The present invention also provides the use of engineered bacteria comprising the above-described recombinant vector in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the development of transgenic rice with enhanced resistance to rice blast; (3) Application in the preparation of products that improve rice resistance to rice blast.

[0009] The present invention also provides a method for improving rice resistance to rice blast, comprising upregulating the rice... pi-cnv9 The steps to improve the expression level of genes and enhance the resistance of rice to rice blast; The pi-cnv9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0010] Furthermore, the aforementioned upward adjustment pi-cnv9 Methods for assessing gene expression levels, including overexpression of the gene in rice. pi-cnv9 Gene.

[0011] This invention also provides a method for breeding rice with improved resistance to rice blast, comprising the following steps: Overexpression in rice cells pi-cnv9 Genes are then used to cultivate rice cells, and rice is regenerated using the rice cells to obtain rice with improved resistance to rice blast. The pi-cnv9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0012] The present invention discloses the following technical effects: This invention screened out a species associated with rice blast resistance. pi-cnv9 The gene, whose nucleotide sequence is shown in SEQ ID NO.1, was used in this invention to construct complementary transgenes for *Rhizophora flavescens* and *Rhizophora esculenta*, respectively. pi-cnv9 Rice plants with complementary genes. Inoculation experiments were conducted on wild-type and transgenic plants, and the results demonstrated that complementary transgenic... pi-cnv9 Genetically modified plants are more resistant to disease than wild-type plants; indicating that... pi-cnv9 Genes that positively regulate the disease resistance of rice can be used as target genes for genetic improvement and molecular breeding of rice resistance to rice blast, which is of great significance for breeding rice varieties with improved disease resistance. Attached Figure Description

[0013] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0014] Figure 1 Phenotypic images of leaves after rice plants were inoculated with rice blast pathogen; where a is the phenotype of wild-type Daohuaxiang rice; b is the phenotype of transformed rice. pi-cnv9 Phenotypic diagrams of complementary rice varieties inoculated with *Magnaporum oryzae*; c is the phenotypic diagram of wild-type Teqing rice inoculated with *Magnaporum oryzae*; d is the phenotypic diagram of the transformed rice. pi-cnv9 Phenotypic diagram of complementary special green rice inoculated with rice blast fungus; Figure 2 In genetically modified rice plants pi-cnv9 Statistical results of gene expression levels. Detailed Implementation

[0015] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0016] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0017] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0018] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0019] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0020] The African cultivated rice selected in this invention ( Oryza glaberrima It has the characteristics of vigorous growth and strong resistance to adverse conditions, and is a very good germplasm resource. The goal is to explore the rice blast resistance gene from it in order to provide new gene resources for the genetic improvement of disease resistance in Asian cultivated rice.

[0021] Example 1 1. Experimental Materials The wild-type rice varieties used in this invention are Daohuaxiang and Teqing, which serve as the background for constructing transgenic rice.

[0022] 2. Construction of gene complementation vector Using the genomic DNA of African cultivated rice OP108 as a template, a 7323 bp amplification was performed. pi-cnv9 Gene, pi-cnv9 The nucleotide sequence of the gene is shown in SEQ ID NO.1. The above fragment was inserted into the pCAMBIA1300 vector using homologous recombination.

[0023] SEQ ID NO.1:

[0024] The complementary vector primers are as follows: F1: catgattacgaattcgagctcggtaccGAAGAACGCGAGAGGAAAGG, SEQ ID NO.2; R1: cttgcatgcctgcaggtcgactctagaAGCTGAGGGAAACAATGAAGA, SEQ ID NO. 3.

[0025] 3. General process of carrier construction 3.1 Amplification of the target fragment The high-fidelity enzyme TKS (Takara) was used to amplify the corresponding vector fragments using primers with nucleotide sequences as shown in SEQ ID NO.2-SEQ ID NO.3. The reaction system and amplification conditions are shown in Tables 1 and 2. The amplification products were detected by electrophoresis on a 1% agarose gel.

[0026] Table 1 TKS enzyme reaction system Table 2 TKS enzyme reaction conditions 3.2 Vector Enzyme Digestion Based on the restriction enzyme sites of different vectors, a double digestion method was used, and the reaction was incubated at the optimal reaction temperature of the restriction enzyme for 4 hours, and then terminated using 10× loading buffer (Takara). The reaction system is shown in Table 3.

[0027] Table 3. Carrier Enzyme Digestion Reaction System 3.3 Purification of the target fragment and vector Follow the instructions for the DNA gel recovery kit (GeneSand).

[0028] 3.4 Carrier Connection The reaction mixture was incubated at 50°C for 15 min using the Seamless Assembly CloneSmarter kit, followed by 2-3 min on ice (the reaction time can be extended appropriately depending on the length of the ligation fragment). The reaction system is shown in Table 4.

[0029] Table 4. Carrier-linked reaction system Note: The addition volume is determined by combining the length of the vector and the amplified fragment. The ratio of amplified fragment amount to vector fragment amount is (3-10):1.

[0030] 3.5 Escherichia coli transformation Using Trelief from Qingke Biotechnology Co., Ltd. ® For strain 5α, follow the instructions to obtain a single-clone bacterial culture.

[0031] 3.6 Identification and Preservation of Positive Clones Using the monoclonal bacterial culture obtained from "3.5 Escherichia coli transformation" as a template, PCR amplification was performed, and cloned bacterial cultures containing the target fragment were screened for sequencing verification. Positive cloned bacterial cultures were mixed with 50% glycerol (V / V) at a volume ratio of 1:1 and stored at -80℃ for long-term storage.

[0032] 3.7 Plasmid Extraction Place the bacterial culture in approximately 15 mL of LB liquid medium and incubate overnight at 37°C on a shaker. Extract plasmids from the obtained bacterial culture using a plasmid miniprep kit (TIANGEN), following the instructions in the kit's manual.

[0033] 4. Genetic transformation of rice 4.1 Agrobacterium-mediated transformation Agrobacterium transformation was performed using the freeze-thaw method. The competent cells of Agrobacterium strain EHA105 used for rice genetic transformation were purchased from Qingke Biotechnology Co., Ltd., and plasmid transformation was carried out according to its instructions.

[0034] 4.2 Rice callus induction and culture (1) Take plump rice seeds without bacterial spots and hull them using a threshing machine.

[0035] (2) Place the seeds in a sterilized Erlenmeyer flask and treat them with 70% ethanol for 2 min and 15% NaClO for 25 min.

[0036] (3) Pour out the NaClO solution in the clean bench and rinse the seeds with sterile water until there is no NaClO residue. Then place them in a petri dish lined with sterile filter paper to air dry.

[0037] (4) Place the dried seeds evenly in NB basic culture medium, about 40 seeds per dish.

[0038] (5) Incubate in the dark at 28℃ for 7 days until pale yellow callus tissue grows.

[0039] 4.3 Agrobacterium infection (1) Add the Agrobacterium with plasmid to about 10 mL of YEB liquid medium containing antibiotics and incubate overnight at 28°C and 220 rpm.

[0040] (2) Take 2-3 mL of the overnight culture and add it to 60 mL of YEB liquid medium containing antibiotics. Adjust the initial OD using a spectrophotometer. 600 The value is between 0.12 and 0.15.

[0041] (3) Incubate at 28℃ and 220 rpm for 4-5 h until the bacterial culture OD reaches its maximum. 600 The value is between 0.5 and 0.6.

[0042] (4) Centrifuge at 6000 rpm for 10 min, discard the supernatant, and resuspend the cells in AAM liquid containing 20 mg / mL AS (10.0 g / L glucose, 0.5 g / L yeast extract, 20.0 g / L calcium carbonate, 1.0 g / L dipotassium hydrogen phosphate, 0.2 g / L magnesium sulfate, and 10 mL / L anhydrous ethanol).

[0043] (5) Transfer the isolated rice callus to a 100 mL Erlenmeyer flask, add AAM resuspension, and incubate at 28℃ and 220 rpm for 30 min.

[0044] (6) Remove the liquid and let the callus dry in a petri dish lined with sterile filter paper.

[0045] (7) Place the dried callus on NB-Ac medium (5.0 g / L peptone, 3.0 g / L beef extract, 1.0 g / L yeast extract, 5.0 g / L sodium chloride and 10 mL / L acetic acid) lined with sterile filter paper and incubate in the dark at 25°C for 3 days.

[0046] (8) Wash the cultured callus sequentially with sterile water without antibiotics and sterile water containing 200 mg / mL cephalosporin and 200 mg / mL termethin, respectively, air dry, and transfer to screening medium.

[0047] 4.4 Screening, plant regeneration, and testing of resistant callus 4.4.1 Screening for resistant callus Two screenings were performed under dark incubation at 28°C: (1) Add 200 mg / mL cephalosporin, 200 mg / mL termethin, and 35 mg / mL hygromycin to the screening medium for the first screening. The screening time is 21-28 days.

[0048] (2) Add 200 mg / mL cephalosporin, 200 mg / mL termethin, and 50 mg / mL hygromycin to the screening medium for a second screening. The screening time is 21-28 days.

[0049] 4.4.2 Plant regeneration (1) Predifferentiation: The selected active callus was transferred to the predifferentiation medium and cultured in the dark at 28°C for 7 days.

[0050] (2) Differentiation: After predifferentiation, the callus was transferred to the differentiation medium and cultured at 28°C for 21-28 days, with a cycle of 16 h of light culture followed by 8 h of dark culture.

[0051] (3) Rooting: Transfer the differentiated bud tissue to the rooting medium, 28℃, and culture for 14-21 days according to the cycle of 16 h of light culture and 8 h of dark culture.

[0052] 4.4.3 Detection of positive plants DNA was extracted from the leaves of the transgenic seedlings and amplified by PCR using hygromycin primers (SEQ ID NO.4-SEQ ID NO.5). The transformation vector and sterile water were used as positive and negative controls, respectively. Plants that amplified the same band as the transformation vector were considered positive plants.

[0053] Hygromycin primer-F: AAATCCGCGTGCACGAGGT, SEQ ID NO.4; Hygromycin primer-R: TCGTTATGTTTATCGGCACTTTGCA, SEQ ID NO.5.

[0054] 5. Cultivating transgenic plants Transgenic plants of generation T0 were cultured, self-pollinated, and propagated for multiple generations to obtain generation T2 seeds.

[0055] 6. Phenotypic identification 6.1 Cultivating Plants Using tissue culture and soil culture methods, complementary transgenic seedlings were transformed. pi-cnv9 T2 seeds of the genetic line were cultured indoors.

[0056] 6.1.1 Rooting tissue culture seedlings (1) First, prepare the rooting medium. After sterilizing the medium and the rooting bottle at 121℃ for 20 min by autoclaving, pour the medium into the rooting bottle in a clean bench until the medium level is 2 cm. The formula of 1 / 2 MS rooting medium is shown in Table 5.

[0057] Table 5. 1 / 2 MS medium formulation (pH adjusted to 5.8) (2) Remove the shells from the seeds and wash them with 70% alcohol for 2 minutes. Pour off the washing liquid and soak them in 15% NaClO for 20 minutes. During this time, place them on a shaker at 37°C and shake them thoroughly.

[0058] (3) Pour off the NaClO and wash the seeds 5 times with clean water. Place them on filter paper to dry. Then put the dried seeds into a rooting bottle, seal it, and place it in an incubator for cultivation.

[0059] 6.1.2 Hydroponic seedling cultivation (1) Drying the seeds: Dry the seeds at 42℃ for two days.

[0060] (2) Disinfection: Soak in 15% sodium hypochlorite solution for 30 min.

[0061] (3) Washing: Wash the soaked seeds with deionized water and keep them in a 37℃ incubator for 3 days. During this period, pay attention to the germination.

[0062] (4) Sowing: Sow the seeds that have sprouted white leaves into the mixed nutrient soil, 10 seeds per pot, and grow them until they have 4 leaves and 1 heart.

[0063] 6.2 Cultivation of rice blast fungus 6.2.1 Prepare 1 L of tomato-oat medium (OTA). (1) Add 500 mL of ddH2O to 40 g of oats, boil for 20 min, and take the filtrate.

[0064] (2) 160 mL of juice was extracted from the tomato homogenate and mixed with the oat filtrate.

[0065] (3) Add 0.6 g CaCO3 and 20 g agar to the mixture, and bring the volume to 1 L with deionized water.

[0066] (4) Sterilize under high temperature and high pressure for 20 min, dispense into sterile culture dishes, and store at room temperature.

[0067] 6.2.2 Strain activation Pick 1-2 pieces of dried filter paper containing mycelia stored at -20℃ using a sterilized toothpick, flatten them and press them firmly against the center of the OTA plate, invert it, and incubate at 28℃ for 10 hours in light and 14 hours in darkness, alternating for 5-7 days.

[0068] 6.2.3 Sporulation Culture In a clean bench, 600 µL of sterile water is added to the rice blast fungus plate that has been growing for 5-7 days. Then, using a sterilized cotton swab, all the mycelia of the rice blast fungus that have been growing for about 5-7 days are scraped off. The mycelial solution is transferred to a new thick oat board, spread evenly, dried in the bench, and then placed in a constant temperature incubator for 2 days. Three replicates are set up for each strain.

[0069] 6.2.4 Hyphae Breakage Gently wipe away the aerial mycelia growing on the surface of the conidiogenous plate with a cotton swab, rinse with water and let dry. Then cover the petri dish with two layers of gauze and secure with rubber bands. Incubate at 28℃, with 10 hours of light and 14 hours of darkness, alternating for 2-3 days. A large number of conidia will then be generated on the surface of the culture medium.

[0070] 6.2.5 Preparation of spore suspension Add 0.025% Tween 20 solution to the thick OTA medium plate where conidia were produced. Use a triangular glass rod to wash off the conidia and transfer them to a 50 mL centrifuge tube. Mix thoroughly, then add approximately 10 µL of the conidia solution to a hemocytometer and count three times. Calculate the average value, then adjust the conidia concentration to 5 × 10⁻⁶ using Tween 20 solution. 5 Bacterial culture per mL, prepared fresh for immediate use.

[0071] 6.2.6 Preservation of Rice Blast Fungus Strains First, the cut filter paper pieces are sterilized three times under high temperature and high pressure, dried, and then spread evenly on the prepared OTA medium to make a culture plate. Next, the mycelium in the viable culture plate of the strain to be preserved is gently scraped away with a sterile cotton swab, and some of the culture medium under the mycelium is scraped off with a sterile toothpick. The strain to be preserved is then spotted onto the culture plate. The plate is incubated at 28℃ in an incubator with alternating light and dark cycles of 10 hours and 14 hours, inverted for 10 days. Once the colonies have covered the entire culture plate, the filter paper pieces are removed and placed in a high-temperature, high-pressure sterilized sulfuric acid paper bag. The bag is then blown dry in a laminar flow hood for 12 hours until the paper pieces are completely dry. The sulfuric acid paper bag is then transferred to a sealed bag containing absorbent silica gel granules and stored at -20℃ for long-term use.

[0072] 6.3 Leaf inoculation with rice blast fungus Wild-type rice flower fragrance plants, complementary transformation with rice flower fragrance as the background pi-cnv9 Genetically modified plants, wild-type plants with a special green background, and complementary transgenic plants with a special green background pi-cnv9 Genetically modified plants were inoculated with rice blast fungus.

[0073] Take rice seedlings that have grown to four leaves and one bud. Using the bud leaf as the penultimate leaf, cut off the middle portion of the fully unfolded second-to-last leaf. Use an insect needle to make three equidistant (1.5 cm) wounds on the leaf, taking care to avoid the veins and not to penetrate the leaf. Place two short plastic rods on a petri dish lined with moistened absorbent paper, and place the detached leaf segments on the rods. Repeat this process with three leaf segments per petri dish. Use a pipette to drop 10 µL of the prepared spore suspension onto each wound. Spray the inside of the petri dish lid with atomized water to keep it moist. Place the petri dishes containing the inoculated leaf segments in an incubator at 70% relative humidity and 28°C in the dark for 24 h. Then, place the petri dishes in an incubator at 28°C and alternate between light and dark for 10 h and 14 h, maintaining humidity for 4 days.

[0074] 6.4 Phenotypic Identification Phenotypic identification was performed 4 days after inoculation, and the results are as follows: Figure 1 As shown, the results indicate that compared with wild-type *Rhizophora stylosa* plants (… Figure 1 Compared to a), complementary transformation pi-cnv9 The genetic line of fragrant rice ( Figure 1 The disease resistance of the plant (b) was significantly improved; compared with the wild-type Teqing plant ( Figure 1 Compared to c), complementary transformation pi-cnv9 Special green rice lines with unique genes ( Figure 1 The disease resistance of d) was significantly improved.

[0075] 7. Quantitative analysis Plant tissues used for RNA extraction were flash-frozen in liquid nitrogen and then stored at -80 °C. Three biological replicates were taken from each sample and the samples were mixed and ground for extraction.

[0076] 7.1 Total RNA extraction from plants (Trizol method) (1) Take 100 mg of plant tissue and grind it thoroughly with liquid nitrogen. Transfer the mixture to a pre-cooled 2.0 mL centrifuge tube and place it on ice. After the liquid nitrogen has completely evaporated, immediately add 1 mL of Trizol extract and vortex for 15 s to fully lyse the sample. Let it stand at room temperature for 5 min.

[0077] (2) Add 200 μL of chloroform, vortex to mix thoroughly, and let stand at room temperature for 10 min.

[0078] (3) Centrifuge at 12,000 rpm at 4℃ for 10 min, transfer 600 μL of supernatant to a new 1.5 mL centrifuge tube, add an equal volume of isoamyl alcohol, and mix gently. Incubate at room temperature for 10 min to allow RNA to precipitate.

[0079] (4) Centrifuge at 12,000 rpm at 4℃ for 10 min, discard the supernatant, and add 1 mL of 75% ethanol (v / v) to wash the precipitate.

[0080] (5) Centrifuge at 12,000 rpm at 4℃ for 5 min, discard the supernatant, and dry at room temperature for 10 min.

[0081] (6) Add 60 μL RNase-H2O to dissolve completely, and store at -80℃ for a long time.

[0082] 7.2 Reverse transcription to generate cDNA Reverse transcription was performed using the Mei5bio M5 Super qPCR RT Kit with gDNA remover (MF166).

[0083] 7.3 Gene Expression Analysis Utilize StepOnePlus TM The detection was performed using a Real-Time PCR System (applied biosystems). The quantitative primers are as follows: F: TGCGGAGATAATGGGGAAGC, SEQ ID NO.6; R: CCCTATGTGCGATGCTTTGC, SEQ ID NO. 7.

[0084] Using the rice Actin gene as an internal control, the quantitative primers are as follows: Actin-F: GACTCTGGTGATGGTGTCAGC, SEQ ID NO.8; Actin-R: GGCTGGAAGAGGACCTCAGG, SEQ ID NO.9.

[0085] The reaction system is shown in Table 6. Amplification was performed using a three-step method. The reaction program was: 95℃ for 3 min, 1 cycle; 95℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 40 cycles; 95℃ for 10 s, with the temperature increasing by 0.5℃ every 5 s from 65℃ to 95℃. Using 2... -△△Ct The relative expression level of the target gene is calculated using this method. Three biological replicates are designed for each experiment. Figure 2 As shown, the analysis revealed pi-cnv9 Gene expression levels increased significantly after inoculation.

[0086] Table 6 RT-qPCR reaction system The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. A kind pi-cnv9 The application of genes in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the development of transgenic rice with enhanced resistance to rice blast; (3) Application in the preparation of products that enhance rice resistance to rice blast; The pi-cnv9 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

2. The application as described in claim 1, characterized in that, Upregulation in rice pi-cnv9 The expression level of the gene increases the resistance of the rice to rice blast.

3. An application of a recombinant vector, characterized in that, The recombinant vector comprises pi-cnv9 genes; The pi-cnv9 The nucleotide sequence of the gene is shown as SEQ ID NO. 1; The application is any one of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the development of transgenic rice with enhanced resistance to rice blast; (3) Application in the preparation of products that improve rice resistance to rice blast.

4. The use of an engineered bacterium comprising the recombinant vector of claim 3 in any of the following: (1) Application in regulating rice resistance to rice blast; (2) Application in the development of transgenic rice with enhanced resistance to rice blast; (3) Application in the preparation of products that improve rice resistance to rice blast.

5. A method for improving rice resistance to rice blast, characterized in that, Including upregulation in rice pi-cnv9 The steps to improve the expression level of genes and enhance the resistance of rice to rice blast; The pi-cnv9 The nucleotide sequence of the gene is shown as SEQ ID NO.

1.

6. The method as described in claim 5, characterized in that, The upregulation pi-cnv9 A method of increasing the expression level of a gene in a plant, comprising overexpressing the pi-cnv9 gene in the plant.

7. A breeding method for rice with improved resistance to rice blast, characterized in that, Includes the following steps: Overexpression in rice cells pi-cnv9 Genes are then used to cultivate rice cells, and rice is regenerated using the rice cells to obtain rice with improved resistance to rice blast. The pi-cnv9 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

Images