CD40L-IL15 fusion protein and application of CD40L-IL15 fusion protein in preparation of medicine for treating tumors

Abstract

The invention relates to the technical field of biological medicines, in particular to a CD40L-IL15 fusion protein and application thereof in preparation of a medicine for treating tumors, the structure of the fusion protein is as follows: N terminal-trimerized CD40L-first connexon-IgG1Fc-second connexon-IL-15-IL-15R alpha sushi region-C terminal, each functional domain has at least 95% identity with SEQ ID NO: 1-6, the whole functional domain has at least 90% identity with SEQ ID NO: 7, and the functional domain has at least 90% identity with SEQ ID NO: 7. The encoding nucleic acid has at least 90% identity with SEQ ID NO: 8. The trimerized CD40L is used for replacing an antibody, so that the toxic and side effects are reduced, and the half-life period is prolonged by fusing IL-15 and IL-15R alpha sushi regions. The invention further provides a coding nucleic acid, a pcDNA3.4 recombinant vector, a CHO-S transformant, a preparation method and a pharmaceutical composition of the CHO-S transformant, and the CHO-S transformant is applicable to tumor treatment and high in clinical transformation value. The invention further provides the coding nucleic acid, the pcDNA3.4 recombinant vector, the CHO-S transformant, the preparation method and the pharmaceutical composition of the CHO-S transformant.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a CD40L-IL15 fusion protein and its application in the preparation of drugs for treating tumors. Background Technology

[0002] Cancer treatment has always been a key focus and challenge in the field of biomedicine. While traditional chemotherapy and radiotherapy can inhibit tumor growth, they suffer from problems such as poor targeting, strong side effects, and easy drug resistance. With the advancement of immunological research, tumor immunotherapy, which activates the body's own immune system to attack tumor cells, has become a new generation of treatment methods. Among them, the regulation of co-stimulatory molecules and the application of cytokines are one of the core directions.

[0003] CD40, a member of the tumor necrosis factor receptor (TNFR) superfamily, is mainly expressed on the surface of antigen-presenting cells (APCs) such as B cells and dendritic cells (DCs). Its natural ligand, CD40L, is primarily secreted by activated T cells. After binding to CD40, CD40L can activate the TNFR-associated factor (TRAF) signaling pathway, regulating B cell activation and differentiation, T cell proliferation, and cytokine secretion. This is crucial for the function of CD8+ cytotoxic T lymphocytes (CTLs) and is a key step in adaptive immune responses. Currently, CD40 agonists have entered preclinical or clinical research. Some CD40 antibodies, when used in combination with radiotherapy and PD-1 antibodies, have shown tumor-shrinking effects in tumors such as pancreatic ductal adenocarcinoma. However, most existing CD40 antibodies are activating antibodies, which have significant toxic side effects and limited activation efficiency. Furthermore, clinical research is still in its early stages, and safety and efficacy require further optimization.

[0004] Interleukin-15 (IL-15) is another key immunomodulatory cytokine, mainly secreted by activated monocytes / macrophages and epidermal cells. Its receptor (IL-15R) is composed of α, β, and γ chains, with the sushi domain of IL-15Rα being the core functional region for IL-15 binding and trans-presentation of signals. IL-15 can promote the proliferation of NK cells and T cells and CTL cytotoxicity. Unlike IL-2, it does not induce activation-induced cell death or maintain regulatory T cell function, showing great promise in cancer treatment. However, existing IL-15 therapies have significant drawbacks: when used alone, its short half-life necessitates high doses to achieve anti-tumor effects, and high doses can easily cause toxic side effects. Although some studies have improved the half-life through Fc fusion or IL-15Rα fusion, the immune activation breadth of IL-15 alone is limited, making it difficult to comprehensively mobilize multiple immune cell types for synergistic anti-tumor action.

[0005] Cytokine fusion proteins, as novel tumor biopharmaceuticals, can integrate the functional advantages of different factors. Current research has explored the fusion of CD40-activating antibodies with IL-15; however, such fusion proteins, using antibodies to replace natural CD40L, suffer from insufficient specificity and a higher risk of toxic side effects. Furthermore, designs that fuse natural CD40L in a trimer form with IL-15 and the IL-15Rαsushi region have not yet been reported. Therefore, developing a fusion protein that can simultaneously optimize CD40 activation efficiency and IL-15 pharmacokinetic properties, and synergistically activate multiple types of immune cells, is of great significance for improving the efficacy of tumor immunotherapy and reducing toxic side effects. Summary of the Invention

[0006] (a) Technical problems to be solved

[0007] To address the shortcomings of existing technologies, this invention provides a CD40L-IL15 fusion protein and its application in the preparation of drugs for treating tumors.

[0008] (II) Technical Solution

[0009] A CD40L-IL15 fusion protein is constructed by tandemly fusing trimerized CD40L with IL-15 and the sushi region of IL-15 receptor α via an IgG1 Fc domain and a specific linker. The trimerized CD40L binds more specifically to CD40 on the surface of antigen-presenting cells compared to CD40-activating antibodies. The structure of the fusion protein is: N-terminus → trimerized CD40L → first linker → IgG1 Fc domain → second linker → IL-15 → IL-15 receptor α sushi region → C-terminus. It can synergistically activate antigen-presenting cells, dendritic cells, natural killer cells, and CD8+ cytotoxic T lymphocytes.

[0010] The trimerized CD40L comprises three consecutive CD40L functional domains, each of which has at least 95% amino acid sequence identity with the sequence shown in SEQ ID NO:1; the amino acid sequence of the IgG1 Fc domain has at least 95% amino acid identity with the sequence shown in SEQ ID NO:2; the amino acid sequence of IL-15 has at least 95% amino acid identity with the sequence shown in SEQ ID NO:3; the amino acid sequence of the IL-15 receptor αsushi region has at least 95% amino acid identity with the sequence shown in SEQ ID NO:4; the amino acid sequence of the first linker has at least 95% amino acid identity with the sequence shown in SEQ ID NO:5; the amino acid sequence of the second linker has at least 95% amino acid identity with the sequence shown in SEQ ID NO:6; and the overall amino acid sequence of the fusion protein has at least 90% amino acid identity with the sequence shown in SEQ ID NO:7.

[0011] Preferably, the three CD40L functional domains in the trimerized CD40L are connected in series via a first linker. The C-terminus of the CD40L trimer is connected to the N-terminus of the IgG1 Fc domain via the first linker, the C-terminus of the IgG1 Fc domain is connected to the N-terminus of IL-15 via a second linker, and the C-terminus of IL-15 is directly connected to the N-terminus of the IL-15 receptor αsushi region. The first linker is a glycine-serine repeat sequence with an amino acid sequence that has at least 98% identity with the sequence shown in SEQ ID NO:5 and a length of 8-10 amino acids. The second linker is a glycine-serine repeat sequence with an amino acid sequence that has at least 98% identity with the sequence shown in SEQ ID NO:6 and a length of 10-12 amino acids.

[0012] Preferably, the amino acid sequence of the CD40L functional domain is completely identical to the sequence shown in SEQ ID NO:1, the amino acid sequence of the IgG1 Fc domain is completely identical to the sequence shown in SEQ ID NO:2, the amino acid sequence of IL-15 is completely identical to the sequence shown in SEQ ID NO:3, the amino acid sequence of the IL-15 receptor αsushi region is completely identical to the sequence shown in SEQ ID NO:4, the amino acid sequence of the first linker is completely identical to the sequence shown in SEQ ID NO:5, the amino acid sequence of the second linker is completely identical to the sequence shown in SEQ ID NO:6, and the overall amino acid sequence of the fusion protein is completely identical to the sequence shown in SEQ ID NO:7; and the EC50 value of the fusion protein stimulating the proliferation of natural killer cells is 80-100 ng / mL.

[0013] Preferably, an isolated nucleic acid encodes a CD40L-IL15 fusion protein as described above, the nucleotide sequence of which has at least 90% identity with the sequence shown in SEQ ID NO:8; and the nucleic acid sequence has undergone codon optimization to adapt to the codon preferences of mammalian host cells; the nucleic acid sequence does not contain complex secondary structures that affect mRNA stability, and codons matching the amino acid sequence of the linker are added between the coding sequences corresponding to each functional domain to ensure that the linker is correctly expressed and does not affect the reading frames of adjacent functional domains.

[0014] Preferably, a recombinant vector is provided, wherein the recombinant vector contains the isolated nucleic acid described above, and the recombinant vector is a recombinant expression vector with a backbone plasmid of pcDNA3.4; the nucleic acid is subcloned into the multiple cloning site of the pcDNA3.4 vector by enzyme digestion and ligation, and a CMV promoter is tandemly connected upstream of the insertion site, and a BGH poly(A) tailing signal is tandemly connected downstream; the vector also contains an ampicillin resistance gene as a selection marker, and an SV40 replication origin.

[0015] Preferably, a transformant comprises the isolated nucleic acid or recombinant vector as described above, and the host cell of the transformant is a CHO-S cell; after the CHO-S cells are transfected with the recombinant vector, when cultured in ExpiCHO medium containing 10% inactivated fetal bovine serum at 37°C, 8% CO2, and 80 rpm with shaking, the secretory expression level of the fusion protein reaches 50-80 mg / L; and after the transformant is cloned and screened by limiting dilution method, a stable expression strain is obtained.

[0016] Preferably, a method for preparing CD40L-IL15 fusion protein includes the following steps:

[0017] (1) Plasmid preparation: The nucleic acid sequence described above is synthesized, which has at least 95% identity with the sequence shown in SEQ ID NO:8. It is subcloned into the pcDNA3.4 vector, and transfection-grade plasmids are prepared using an endotoxin-free plasmid extraction kit. The plasmid purity (A260 / A280) is 1.8-2.0.

[0018] (2) Cell preparation: One day before transfection, CHO-S cells were prepared at 3×10⁻⁶ cells / day. 6 -4×10 6 Subculture at a density of 7 × 10⁶ cells / mL, and incubate overnight at 37°C with 8% CO₂ and shaking at 80 rpm until the cell density reaches 7 × 10⁶ cells / mL. 6 -1×10 7 Transfection was performed at a cell / mL level;

[0019] (3) Transfection procedure: Dilute CHO-S cells to 6 × 10⁶ cells / year using fresh, preheated ExpiCHO medium. 6 The plasmid volume was calculated based on a transfection volume of 1.0 μg / mL. The volume ratio of the transfection reagent ExpiFectamine CHO to the plasmid was 12.5:1. The plasmids were diluted separately with OptiPRO medium and mixed. The mixture was incubated at room temperature for 1-5 minutes to form a transfection complex. The transfection complex was slowly added to the cell suspension and cultured with shaking at 37°C, 8% CO2, and 80 rpm.

[0020] (4) Culture and feeding: On day 1 and day 5 after transfection, 0.12% of the culture volume of ExpiCHO enhancer and 5% of ExpiCHO feed were added to the culture system, respectively.

[0021] (5) Purification and Harvesting: After 10 days of culture, the cell culture supernatant was collected, filtered through a 0.22 μm filter membrane, and loaded onto MabSelect SuRe. TM The LX affinity chromatography column was eluted with 50 mM citrate buffer, and the eluent was further purified by Superdex 200 gel filtration chromatography. The final product purity was ≥95%, and its amino acid sequence was ≥98% identical to the sequence shown in SEQ ID NO:7.

[0022] Preferably, a pharmaceutical composition comprises the CD40L-IL15 fusion protein having at least 90% identity with the sequence shown in SEQ ID NO:7, and a pharmaceutically acceptable carrier; the concentration of the fusion protein in the pharmaceutical composition is 0.5-2 mg / mL, and the single dose is 1 mg / kg; the pharmaceutically acceptable carrier is selected from one or more of physiological saline, phosphate buffer, and 5%-10% sucrose solution; the pharmaceutical composition may also contain a combination therapy component selected from PD-1 antibody, chemotherapeutic agent, or oncolytic virus, wherein the molar ratio of PD-1 antibody to fusion protein is 1:1-1:2.

[0023] Preferably, the pharmaceutical composition is used in the preparation of a drug for treating tumors, wherein the tumor is a solid tumor or a hematopoietic malignant tumor, the solid tumors including melanoma, colorectal cancer, and pancreatic ductal adenocarcinoma, and the hematopoietic malignant tumors including diffuse large B-cell lymphoma; the drug is administered by intravenous injection, once every 2 days, for a total of 5 treatment cycles; in a melanoma model, after one treatment cycle, the tumor volume in the treatment group is reduced by 60%-70% compared to the control group, and the amino acid sequence of the fusion protein used has at least 95% identity with the sequence shown in SEQ ID NO:7.

[0024] Preferably, a kit is provided, the kit comprising the CD40L-IL15 fusion protein or the pharmaceutical composition described above; the kit further comprises a drug delivery device and instructions for use, the drug delivery device being selected from a 1mL or 2mL disposable intravenous syringe equipped with a 0.22μm filter needle; the instructions for use specifying the storage conditions of the fusion protein as 2-8℃ protected from light and not to be frozen, requiring equilibration at room temperature for 15-30 minutes before administration, the administration sequence when combined with PD-1 antibody as first injecting the fusion protein and then injecting the PD-1 antibody 24 hours later, and the adverse reaction management plan including the administration of acetaminophen for low-grade fever.

[0025] (III) Beneficial Technical Effects

[0026] Compared with existing technologies, the beneficial effects of this invention are:

[0027] 1. This fusion protein utilizes a natural CD40L trimer structure, which, compared to existing CD40-activating antibodies, more closely resembles the physiological binding mode of CD40. It can specifically bind to CD40 on the surface of APCs, effectively avoiding toxic side effects caused by non-specific activation. Simultaneously, the trimer structure enhances CD40 activation efficiency, significantly improving safety while ensuring signal transduction, laying a solid foundation for clinical application. Furthermore, the fusion design of IL-15 with the IL-15Rαsushi region mimics the trans-presentation mode of IL-15 under physiological conditions. Compared to IL-15 alone or traditional IL-15 fusion forms, it significantly prolongs the in vivo half-life of IL-15, reducing the dosage and further lowering the toxic side effects of high-dose administration, thus improving treatment safety and patient tolerability.

[0028] 2. This fusion protein achieves synergistic effects between the CD40 and IL-15 pathways, simultaneously activating multiple key immune cell types: on the one hand, it activates APC cells such as dendritic cells (DCs) through the CD40L trimer, promoting their maturation and upregulating the expression of co-stimulatory molecules and secretion of pro-inflammatory cytokines, thereby enhancing antigen presentation capabilities; on the other hand, through the fusion structure of IL-15 and the IL-15Rαsushi region, it effectively promotes NK cell proliferation and activation, enhancing their tumor-killing ability, while simultaneously driving CD8+ T cell proliferation and activation, and improving the specific tumor-killing effect of CTLs. This multi-cell synergistic activation effect, compared to using CD40 agonists or IL-15 alone, can more comprehensively mobilize the body's immune response, significantly broadening the breadth and depth of immune activation and enhancing anti-tumor efficacy.

[0029] 3. This fusion protein exhibits excellent growth-inhibiting effects against solid tumors such as melanoma and colorectal cancer, making it applicable to a wide range of tumor types. Its preparation utilizes the CHO-S cell expression system, resulting in high expression efficiency and stable product purity, facilitating large-scale production and reducing industrialization costs. Furthermore, this fusion protein can be used in combination with other therapeutic agents such as PD-1 antibodies and chemotherapeutic agents to further enhance anti-tumor effects, providing a new and effective approach for combination cancer therapy, and possessing extremely high clinical translational potential and application value. Attached Figure Description

[0030] Figure 1 SDS-PAGE purification and identification image, SEC-HPLC purity detection image and structural schematic diagram of CD40L-IL15 fusion protein;

[0031] Figure 2: The promoting effect of CD40L-IL15 fusion protein on IL-12 secretion in dendritic cells (DCs) and the upregulation effect on the expression of CD80 and CD86 surface molecules;

[0032] Figure 3 Comparison of the efficiency of CD40L-IL15 fusion protein and IL-15 in stimulating the proliferation of natural killer (NK) cells and analysis of EC50 values;

[0033] Figure 4 Flow cytometry results showing that the CD40L-IL15 fusion protein promotes CD8+ T cell proliferation based on CFSE fluorescence staining;

[0034] Figure 5 Flow cytometry analysis and statistical analysis of the positive expression rates of CD107a, CD69, and CD25 markers after CD40L-IL15 fusion protein activates CD8+ T cells;

[0035] Figure 6 Graph showing the in vivo antitumor effects of CD40L-IL15 fusion protein in melanoma and colorectal cancer. Detailed Implementation

[0036] according to Figures 1 to 6 The specific embodiments of the present invention are as follows:

[0037] The technical solution of the present invention is described in detail below through specific embodiments. The reagents and raw materials used in this embodiment are all commercially available. Operations without specific experimental conditions are performed in accordance with conventional biological experimental methods and conditions, or with reference to the product instructions.

[0038] Example 1: Expression and purification of fusion protein

[0039] 1. Plasmid Preparation: Based on the designed sequence of the fusion protein according to the present invention, the complete DNA sequence encoding the fusion protein was optimized and synthesized, which has at least 95% identity with the sequence shown in SEQ ID NO:8. The DNA sequence was subcloned into the multiple cloning site of the pcDNA3.4 vector using restriction endonucleases to construct a recombinant expression plasmid. Transfection-grade plasmids were prepared on a large scale using an endotoxin-free plasmid extraction kit. The plasmid fragment size was verified to be within expectations by agarose gel electrophoresis, and the plasmid sequence was verified to be correctly constructed by nucleic acid sequencing. The plasmid purity was controlled between 1.8 and 2.0 based on the A260 / A280 ratio.

[0040] 2. Cell transfection: One day before transfection, CHO-S cells were transfected at a rate of 3 × 10⁶ cells / year. 6 -4×10 6Cells were seeded at a density of 7 × 10⁶ cells / mL in shake flasks and cultured overnight at 37°C, 8% CO₂, and 80 rpm using ExpiCHO medium containing 10% inactivated fetal bovine serum. The cells were cultured with shaking until the density reached 7 × 10⁶ cells / mL. 6 -1×10 7 When the cell density was 6 × 10⁶ cells / mL, the cell density was diluted to 6 × 10⁶ cells / mL with fresh, preheated ExpiCHO medium. 6 The plasmid volume was calculated based on a transfection volume of 1.0 μg / mL. The volume ratio of the transfection reagent ExpiFectamine CHO to the plasmid was 12.5:1. The plasmid and transfection reagent were diluted separately with OptiPRO medium, mixed, and incubated at room temperature for 1–5 minutes to form a transfection complex. The transfection complex was then slowly added to the cell suspension, and the cells were cultured with shaking at 37°C, 8% CO2, and 80 rpm.

[0041] 3. Culture and feeding: On day 1 after transfection, add 0.12% of the culture volume of ExpiCHO enhancer to the culture system; on day 5 after transfection, add 5% of the culture volume of ExpiCHO feed to the culture system and continue culturing until day 10, then collect the cell culture supernatant.

[0042] 4. Purification and Analysis: The collected cell culture supernatant was filtered through a 0.22 μm filter membrane and then loaded onto MabSelectSuRe. TM The LX affinity chromatography column was run at an appropriate flow rate. After washing the column with equilibration buffer until the baseline stabilized, elution was performed with 50 mM citrate buffer (pH 3.0), and the eluent fraction was collected. The eluent fractions were mixed and exchanged through gel filtration chromatography to the final formulation buffer to obtain the purified CD40L-IL15 fusion protein. SDS-PAGE analysis of the fusion protein showed a clear target protein band. HPLC analysis of the fusion protein purity showed that the purified fusion protein met the required purity and the molecular weight was consistent with the theoretical value.

[0043] Figure 1 Includes purification and identification diagrams and structural schematics of the fusion protein: Figure 1 A shows the band of the purified fusion protein; Figure 1 B is the SEC-HPLC chromatogram. The detection instrument was an Agilent 1260 GR17010610 with an injection volume of 80.0 μL. The chromatographic column was a TSKgel G3000SWxl (301#). The mobile phase was 0.118 mol / L phosphate buffer (pH 6.7 ± 0.3) containing 0.1 mol / L Na2SO4, and the wavelength was 280 nm. Figure 1C is a schematic diagram of the fusion protein, clearly showing the structural composition from the N-terminus to the C-terminus.

[0044] Example 2: Detection of fusion protein activation of dendritic cells (DCs)

[0045] 1. DC cell culture: Lymphocytes were isolated from peripheral blood of healthy volunteers using human peripheral blood lymphocyte separation medium and resuspended in RPMI 1640 medium containing 10% inactivated fetal bovine serum to a concentration of 2 × 10⁶ cells / mL. 6 Cells / mL were pre-adhered and cultured in a 37°C, 5% CO2 incubator for 2 hours. Unadhered cells were discarded, and RPMI 1640 medium containing 10% inactivated fetal bovine serum was added to adherent cells. 50 ng / mL rhIL-4 and 100 ng / mL rhGM-CSF were then added, and the cells were cultured for another 6 days. Suspension cells were collected, which were the DC cells derived from monocytes.

[0046] 2. ELISA detection of IL-12 secretion: DC cells were sputtered at a concentration of 1×10⁻⁶. 5 Cells were seeded at a density of 100 cells / well in 96-well plates. CD40L-IL15 fusion protein, CD40L protein at an equimolar concentration of the fusion protein, and IL-15 protein at an equimolar concentration of the fusion protein were added to each well. A blank control group without added protein was included. Each group had three replicates. After culturing at 37°C and 5% CO2 for 24 hours, the cell supernatant was collected, and the IL-12 / p70 content in the supernatant was detected using an IL-12 / p70 ELISA kit. The results showed that the IL-12 / p70 secretion level in the CD40L-IL15 fusion protein group was significantly higher than that in the blank control group and the protein-only control group.

[0047] 3. Flow cytometry detection of surface molecules: DC cells were flowed at 1×10⁻⁶. 5 Cells were seeded at a density of 100 cells / well in 96-well plates. The experimental group received a final concentration of 2 μg / mL of CD40L-IL15 fusion protein, while the control group received no protein. Cells were cultured at 37°C and 5% CO2 for 24 hours. After culture, cells were collected, resuspended in 1×PBS buffer containing 1% FBS, centrifuged, and the supernatant was discarded. Anti-CD80 and anti-CD86 antibodies were added, and the cells were incubated on ice in the dark for 30 minutes. After incubation, cells were washed twice with 1×PBS buffer containing 1% FBS, centrifuged, and the supernatant was discarded. Cells were resuspended in 1×PBS buffer, and the expression levels of CD80 and CD86 were detected by flow cytometry. The results showed that the expression levels of CD80 and CD86 on the surface of DC cells in the fusion protein group were significantly higher than those in the control group.

[0048] Figure 2 Detection results for DC activation by fusion protein: Figure 2A is a comparison chart of IL-12 secretion levels, showing that the IL-12 secretion level in the CD40L-IL15 fusion protein group is higher than that in the blank control group, CD40L group, and IL15 group. Figure 2 B is a comparison chart of CD86 expression rates. Figure 2 C is a comparison of CD80 expression rates. Both graphs show that the molecular expression rate of the CD40L-IL15 fusion protein group is significantly higher than that of the blank control group, and the results are statistically significant.

[0049] Example 3: Detection of NK cell proliferation stimulated by fusion protein

[0050] NK cells from conventional passage culture were resuspended in RPMI 1640 medium containing 10% inactivated fetal bovine serum at a concentration of 1×10⁻⁶. 5 Cells were seeded at a density of 100 cells / well in 96-well plates, with 3 replicates per group. Equimolarly diluted CD40L-IL15 fusion protein and IL-15 protein were added to each experimental group, and the cells were cultured at 37°C and 5% CO2 for 48 hours. After culture, 10 μL of CCK8 reagent was added to each well, and the cells were cultured for another 2 hours at 37°C and 5% CO2. The absorbance (OD value) at 450 nm was measured using a microplate reader, and the NK cell proliferation rate and half-maximal effective concentration (EC50) were calculated. The results showed that the CD40L-IL15 fusion protein was more effective than IL-15 protein alone in stimulating NK cell proliferation, and the EC50 value of the fusion protein was lower than that of IL-15 protein alone.

[0051] Figure 3 The results of NK cell proliferation stimulated by fusion protein and IL-15 are shown in the figure: the left side is the curve of proliferation rate as a function of protein concentration, showing that the proliferation stimulation effect of fusion protein is stronger; the right side is the comparison of EC50 values, showing that the EC50 of fusion protein is lower than that of IL-15, with the EC50 of fusion protein being 90.87 and the EC50 of IL-15 being 123.8.

[0052] Example 4: Detection of T cell proliferation stimulated by fusion protein

[0053] 1. CD8+ T cell isolation and staining: Spleens from 6-8 week old male C57 / BL6N mice were collected, ground, and filtered through a 100 μM filter to prepare a single-cell suspension. CD8+ T cells were then sorted using a CD8+ T cell sorting kit. The CD8+ T cells were then stained at a concentration of 5 × 10⁻⁶ cells / mL. 5 Cells were seeded at a density of 100 cells / well in 96-well round-bottom plates. PBS containing CellTrace fluorescent dye was added to each well at a volume ratio of 1:1000, and the cells were incubated at 37°C for 15 minutes. Five volumes of culture medium containing 1% protein were added, and the cells were incubated at room temperature for 5 minutes to terminate staining. The cells were centrifuged, the supernatant was discarded, and the cells were resuspended in T-cell complete culture medium containing IL-2.

[0054] 2. Drug Treatment and Detection: Cells were divided into a control group and a treatment group. The control group was treated with PBS, while the treatment group was treated with CD40L-IL15 fusion protein. Cells were cultured at 37℃ and 5% CO2 for 72 hours. After culture, cells were collected, and cell fluorescence intensity was detected by flow cytometry. Cell division was analyzed using FlowJO software. The results showed that the fluorescence intensity of CD8+ T cells in the treatment group decreased more significantly, indicating that the fusion protein effectively promoted T cell proliferation.

[0055] Figure 4 The image shows the CFSE detection results of T cell proliferation stimulated by the fusion protein. The changes in fluorescence intensity demonstrate the cell division. It is clear that the fluorescence intensity of the treatment group (CD40L-IL15 group) is lower than that of the control group, indicating that the T cells in the treatment group are more active in division and have a more significant proliferation effect.

[0056] Example 5: Detection of T cell activation by fusion protein

[0057] Spleens from 6-8 week old male C57 / BL6N mice were collected, homogenized, and filtered through a 100 μM filter to prepare a single-cell suspension. CD8+ T cells were then sorted using a CD8+ T cell sorting kit. CD8+ T cells were seeded at an appropriate density in 96-well plates, and CD40L-IL15 fusion protein was added to a final concentration of 2 μg / mL. The plates were then cultured at 37°C and 5% CO2 for 24 hours. After culture, cells were collected, resuspended in 1×PBS buffer containing 1% FBS, and centrifuged at 1800 rpm for 5 minutes. The supernatant was discarded. A staining system containing anti-CD25 antibody, anti-CD107a antibody, and anti-CD69 antibody was added to the cells, and the plates were incubated on ice in the dark for 30 minutes. After incubation, 200 μL of 1×PBS buffer containing 1% FBS was added to terminate staining. The plates were centrifuged at 1800 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in an appropriate amount of 1×PBS buffer. The positive expression rate of each marker was detected by flow cytometry. The results showed that the positive expression rates of CD25, CD107a, and CD69 in CD8+ T cells of the fusion protein treatment group were significantly higher than those in the blank control group, indicating that the fusion protein can effectively activate T cells.

[0058] Figure 5 Results of detection of markers for T cell activation by fusion protein: Figure 5 A is a flow cytometry plot of CD107a. Figure 5 B is the flow cytometry plot represented by CD69. Figure 5 C is the flow cytometry plot represented by CD25. Figure 5 D represents the statistical results of the positive expression rate of each marker, all of which show that the positive expression rate of the fusion protein group (CD40L-IL15 group) is significantly higher than that of the control group.

[0059] Example 6: Detection of the in vivo antitumor effect of the fusion protein

[0060] 1. Tumor Model Construction: Six- to eight-week-old male C57 / BL6N mice were divided into a melanoma model group and a colorectal cancer model group. Mice in the melanoma model group received a subcutaneous injection of 2×10⁻⁶ mg / L of iodine solution into the right axilla. 5 B16F10 melanoma cells per 100 μL; colorectal cancer model mice were subcutaneously injected with 1×10⁻⁶ cells per 100 μL. 6 MC38 colorectal cancer cells per 100 μL.

[0061] 2. Drug Administration and Detection: Eight days after tumor inoculation, mice were randomly divided into a treatment group and a control group. The treatment group received a tail vein injection of 1 mg / kg of CD40L-IL15 fusion protein, while the control group received 100 μL of PBS. The drugs were administered every two days for a total of five administrations. Tumor volume was measured at regular intervals during the treatment period, and tumor growth curves were plotted. The results showed that the tumor volume in the treatment group was significantly smaller than that in the control group, indicating that the fusion protein has a good anti-tumor effect in vivo.

[0062] Figure 6 Figure showing the in vivo anti-tumor effects of the fusion protein: Figure 6 A shows tumor images of the control group (Ctrl, PBS) and the treatment group (CD40L-IL15) in a melanoma model. Figure 6 B is the statistical curve of the change in tumor volume of the two groups with the number of days after inoculation in the melanoma model; Figure 6 C shows tumor photographs in the control group and the drug-treated group in a colorectal cancer model. Figure 6 D is a statistical curve showing the change in tumor volume between the two groups in the colorectal cancer model with the number of days since inoculation. The results show that the tumor volume in the treatment group is significantly smaller than that in the control group.

[0063] sequence list

[0064] <120> A CD40L-IL15 fusion protein and its application in the preparation of anti-tumor drugs

[0065] <160> 8

[0066] <170> PatentIn version 3.5

[0067] <210> 1

[0068] <211> 131

[0069] <212> PRT

[0070] <213> people

[0071] <400> 1

[0072] Gln Ile Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser 15

[0073] Val Leu Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu 30

[0074] Val Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu 45

[0075] Tyr Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser 60

[0076] Ser Gln Ala Pro Phe Ile Ala Ser Leu Trp Leu Lys Ser Pro Gly Arg 75

[0077] Phe Glu Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys 90

[0078] Pro Cys Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln 105

[0079] Pro Gly Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser 120

[0080] His Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu 131

[0081] <210>2

[0082] <211>226

[0083] <212>PRT

[0084] <213>Human

[0085] <400>2

[0086] Glu Pro Lys Ser Cys Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala 15

[0087] Pro Glu Leu Leu Gly Asp Asp Ser Val Phe Leu Phe Pro Pro Lys Pro 30

[0088] Lys Asp Thr Leu Met Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val 45

[0089] Val Asp Val Ser Asp Glu Asp Gly Glu Val Lys Phe Asn Trp Tyr Val 60

[0090] Asp Gly Val Glu Val His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln 75

[0091] Tyr Asn Ser Thr Tyr Arg Val Val Ser Val Leu Thr Val Leu His Gln 90

[0092] Asp Trp Leu Asn Gly Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala 105

[0093] Leu Pro Arg Pro Ile Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro 120

[0094] Arg Glu Pro Gln Val Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr 135

[0095] Lys Asn Gln Val Ser Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser 150

[0096] Asp Ile Ala Val Glu Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr 165

[0097] Lys Thr Thr Pro Pro Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr 180

[0098] Ser Lys Leu Thr Val Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe 195

[0099] Ser Cys Ser Val Met His Glu Ala Leu His Asn His Tyr Thr Gln Lys 210

[0100] Ser Leu Ser Leu Ser Pro 226

[0101] <210>3

[0102] <211>114

[0103] <212>PRT

[0104] <213>Human

[0105] <400>3

[0106] Cys Pro Pro Pro Met Ser Val Glu His Ala Asp Ile Trp Val Lys Ser 15

[0107] Tyr Ser Leu Tyr Ser Arg Glu Arg Tyr Ile Cys Asn Ser Gly Phe Lys 30

[0108] Arg Lys Ala Gly Thr Ser Ser Leu Thr Glu Cys Val Leu Asn Lys Ala 45

[0109] Thr Asn Val Ala His Trp Thr Thr Pro Ser Leu Lys Cys Ile Arg Asp 60

[0110] Ser Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser Gly Gly Gly Ser 75

[0111] Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp Leu Ile 90

[0112] Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp Val His 105

[0113] Pro Ser Cys Lys 114

[0114] <210>4

[0115] <211>115

[0116] <212>PRT

[0117] <213>Human

[0118] <400>4

[0119] Asn Trp Val Asn Val Ile Ser Asp Leu Lys Lys Ile Glu Asp Leu Ile 15

[0120] Gln Ser Met His Ile Asp Ala Thr Leu Tyr Thr Glu Ser Asp Val His 30

[0121] Pro Ser Cys Lys Val Thr Ala Met Lys Cys Phe Leu Leu Glu Leu Gln 45

[0122] Val Ile Ser Leu Glu Ser Gly Asp Ala Ser Ile His Asp Thr Val Glu 60

[0123] Asn Leu Ile Ile Leu Ala Asn Asp Ser Leu Ser Ser Asn Gly Asn Val 75

[0124] Thr Glu Ser Gly Cys Lys Glu Cys Glu Glu Leu Glu Glu Lys Asn Ile 90

[0125] Lys Glu Phe Leu Gln Ser Phe Val His Ile Val Gln Met Phe Ile Asn 105

[0126] Thr Ser 115

[0127] <210> 5

[0128] <211> 9

[0129] <212> PRT

[0130] <213> Artificial sequence

[0131] <220>

[0132] <223> First linker (glycine-serine repeat sequence)

[0133] <400> 5

[0134] Gly Gly Gly Gly Ser Gly Gly Gly Ser 9

[0135] <210> 6

[0136] <211> 11

[0137] <212> PRT

[0138] <213> Artificial sequence

[0139] <220>

[0140] <223> Second linker (glycine-serine repeat sequence)

[0141] <400> 6

[0142] Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala 11

[0143] <210> 7

[0144] <211> 885

[0145] <212> PRT

[0146] <213> Human-artificial fusion sequence

[0147] <220>

[0148] <223> Full sequence of CD40L-IL15 fusion protein

[0149] <400> 7

[0150] Asn Pro Gln Ile Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr 15

[0151] Thr Ser Val Leu Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn 30

[0152] Asn Leu Val Thr Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln 45

[0153] Gly Leu Tyr Tyr Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu 60

[0154] Ala Ser Ser Gln Ala Pro Phe Ile Ala Ser Leu Trp Leu Lys Ser Pro 75

[0155] Gly Arg Phe Glu Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser 90

[0156] Ala Lys Pro Cys Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu 105

[0157] Leu Gln Pro Gly Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln 120

[0158] Val Ser His Gly Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Gly 135

[0159] Gly Gly Gly Ser Gly Gly Gly Ser Gln Ile Ala Ala His Val Ile Ser 150

[0160] Glu Ala Ser Ser Lys Thr Thr Ser Val Leu Gln Trp Ala Glu Lys Gly 165

[0161] Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr Leu Glu Asn Gly Lys Gln 180

[0162] Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr Ile Tyr Ala Gln Val Thr 195

[0163] Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln Ala Pro Phe Ile Ala Ser 210

[0164] Leu Trp Leu Lys Ser Pro Gly Arg Phe Glu Arg Ile Leu Leu Arg Ala 225

[0165] Ala Asn Thr His Ser Ser Ala Lys Pro Cys Gly Gln Gln Ser Ile His 240

[0166] Leu Gly Gly Val Phe Glu Leu Gln Pro Gly Ala Ser Val Phe Val Asn 255

[0167] Val Thr Asp Pro Ser Gln Val Ser His Gly Thr Gly Phe Thr Ser Phe 270

[0168] Gly Leu Leu Lys Leu Gly Gly Gly Gly Ser Gly Gly Gly Ser Gln Ile 285

[0169] Ala Ala His Val Ile Ser Glu Ala Ser Ser Lys Thr Thr Ser Val Leu 300

[0170] Gln Trp Ala Glu Lys Gly Tyr Tyr Thr Met Ser Asn Asn Leu Val Thr 315

[0171] Leu Glu Asn Gly Lys Gln Leu Thr Val Lys Arg Gln Gly Leu Tyr Tyr 330

[0172] Ile Tyr Ala Gln Val Thr Phe Cys Ser Asn Arg Glu Ala Ser Ser Gln 345

[0173] Ala Pro Phe Ile Ala Ser Leu Trp Leu Lys Ser Pro Gly Arg Phe Glu 360

[0174] Arg Ile Leu Leu Arg Ala Ala Asn Thr His Ser Ser Ala Lys Pro Cys 375

[0175] Gly Gln Gln Ser Ile His Leu Gly Gly Val Phe Glu Leu Gln Pro Gly 390

[0176] Ala Ser Val Phe Val Asn Val Thr Asp Pro Ser Gln Val Ser His Gly 405

[0177] Thr Gly Phe Thr Ser Phe Gly Leu Leu Lys Leu Gly Gly Gly Gly Ser 420

[0178] Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ala Glu Pro Lys Ser Cys 435

[0179] Asp Lys Thr His Thr Cys Pro Pro Cys Pro Ala Pro Glu Leu Leu Gly 450

[0180] Asp Asp Ser Val Phe Leu Phe Pro Pro Lys Pro Lys Asp Thr Leu Met 465

[0181] Ile Ser Arg Thr Pro Glu Val Thr Cys Val Val Val Asp Val Ser Asp 480

[0182] Glu Asp Gly Glu Val Lys Phe Asn Trp Tyr Val Asp Gly Val Glu Val 495

[0183] His Asn Ala Lys Thr Lys Pro Arg Glu Glu Gln Tyr Asn Ser Thr Tyr 510

[0184] Arg Val Val Ser Val Leu Thr Val Leu His Gln Asp Trp Leu Asn Gly 525

[0185] Lys Glu Tyr Lys Cys Lys Val Ser Asn Lys Ala Leu Pro Arg Pro Ile 540

[0186] Glu Lys Thr Ile Ser Lys Ala Lys Gly Gln Pro Arg Glu Pro Gln Val 555

[0187] Tyr Thr Leu Pro Pro Ser Arg Asp Glu Leu Thr Lys Asn Gln Val Ser 570

[0188] Leu Thr Cys Leu Val Lys Gly Phe Tyr Pro Ser Asp Ile Ala Val Glu 585

[0189] Trp Glu Ser Asn Gly Gln Pro Glu Asn Asn Tyr Lys Thr Thr Pro Pro 600

[0190] Val Leu Asp Ser Asp Gly Ser Phe Phe Leu Tyr Ser Lys Leu Thr Val 615

[0191] Asp Lys Ser Arg Trp Gln Gln Gly Asn Val Phe Ser Cys Ser Val Met 630

[0192] His Glu Ala Leu His Asn His Tyr Thr Gln Lys Ser Leu Ser Leu Ser 645

[0193] Pro Gly Gly Gly Gly Ser Ile Thr Cys Pro Pro Pro Met Ser Val Glu 660

[0194] His Ala Asp Ile Trp Val Lys Ser Tyr Ser Leu Tyr Ser Arg Glu Arg 675

[0195] Tyr Ile Cys Asn Ser Gly Phe Lys Arg Lys Ala Gly Thr Ser Ser Leu 690

[0196] Thr Glu Cys Val Leu Asn Lys Ala Thr Asn Val Ala His Trp Thr Thr 705

[0197] Pro Ser Leu Lys Cys Ile Arg Asp Ser Gly Gly Ser Gly Gly Gly Ser 720

[0198] Gly Gly Gly Ser Gly Gly Gly Ser Asn Trp Val Asn Val Ile Ser Asp 735

[0199] Leu Lys Lys Ile Glu Asp Leu Ile Gln Ser Met His Ile Asp Ala Thr 750

[0200] Leu Tyr Thr Glu Ser Asp Val His Pro Ser Cys Lys Val Thr Ala Met 765

[0201] Lys Cys Phe Leu Leu Glu Leu Gln Val Ile Ser Leu Glu Ser Gly Asp 780

[0202] Ala Ser Ile His Asp Thr Val Glu Asn Leu Ile Ile Leu Ala Asn Asp 795

[0203] Ser Leu Ser Ser Asn Gly Asn Val Thr Glu Ser Gly Cys Lys Glu Cys 810

[0204] Glu Glu Leu Glu Glu Lys Asn Ile Lys Glu Phe Leu Gln Ser Phe Val 825

[0205] His Ile Val Gln Met Phe Ile Asn Thr Ser 835

[0206] <210>8

[0207] <211>2505

[0208] <212>DNA

[0209] <213>Artificial Sequence

[0210] <220>

[0211] <223>Nucleic acid sequence encoding CD40L-IL15 fusion protein

[0212] <400>8

[0213] ATGGGCTGGTCCTGCATCATCCTGTTTCTGGTGGCTACCGCTACCGGCGTGCACTCTAAT 30

[0214] CCACAGATTGCTGCTCATGTTATATCAGAGGCATCCAGTAAGACAACATCAGTGCTGCAG 60

[0215] TGGGCCGAGAAGGGCTACTACACCATGTCCAACAACCTGGTGACCCTGGAAAACGGCAAG 90

[0216] CAGCTGACCGTGAAGAGACAGGGCCTGTACTACATCTACGCCCAGGTGACCTTCTGCTCC 120

[0217] AACAGAGAGGCCAGCTCTCAGGCCCCTTTCATTGCCTCCCTGTGGCTCAAGTCTCCAGG 150

[0218] CAGATTTGAGAGAATCCTGCTGAGAGCTGCTAACACCCACAGCTCAGCCAAGCCTTGTG 180

[0219] GACAGCAGTCCATCCACCTGGGCGGAGTGTTTGAGCTGCAGCCTGGCGCTCTGTGTT 210

[0220] CGTGAATGTGACCGACCCCTCCCCAGGTGTCTCACGGCACCGGCTTCACATCTTTCGGC 240

[0221] CTGCTGAAGCTCGGCGGAGGTGGCTCTGGCGGTGGATCTCAGATTGCAGCTCATGTA 270

[0222] ATATCTGAGGCATCCAGTAAGACAACATCAGTGCTGCAGTGGGCGAGAAGGGCTAC 300

[0223] TACACCATGTCCAACAACCTGGTGACCCTGGAAAACGGCAAGCAGCTGACCGTGAAG 330

[0224] AGACAGGGCCTGTACTACATCTACGCCCAGGTGACCTTCTGCTCCAATAGAGAGGCC 360

[0225] AGCTCTCAGGCCCCTTTCATTGCCTCCCTGTGGCTCAAGTCTCCAGGCAGATTTGAG 390

[0226] AGAATCCTGCTGAGAGCTGCTAACACCCACAGCTCAGCCAAGCCTTGTGGACAGCAG 420

[0227] TCCATCCACCTGGGCGGAGTGTTTGAGCTGCAGCCTGGCGCCTCTGTGTTCGTGAA 450

[0228] TGTGACCGACCCCTCCCAGGTGTCTCACGGCACCGGCTTCACATCTTTCGGCCTGCT 480

[0229] GAAGCTCGGTGGTGGCGGATCAGGAGGCGGGAGCCAGATTGCAGCTCATGTAATATC 510

[0230] TGAGGCATCCAGTAAGACAACATCAGTGCTGCAGTGGGCCGAGAAGGGCTACTACAC 540

[0231] CATGTCCAACAACCTGGTGACCCTGGAAAACGGCAAGCAGCTGACCGTGAAGAGACA 570

[0232] GGGCCTGTACTACATCTACGCCCAGGTGACCTTCTGCTCCAATAGAGAGGCCAGCTC 600

[0233] CAGGCCCCTTTCATTGCCTCCCTGTGGCTCAAGTCTCCAGGCAGATTTGAGAGAATC 630

[0234] CTGCTGAGAGCTGCTAACACCCACAGCTCAGCCAAGCCTTGTGGACAGCAGTCCATC 660

[0235] CACCTGGGCGGAGTGTTTGAGCTGCAGCCTGGCGCCTCTGTGTTCGTGAATGTGACC 690

[0236] GACCCCTCCCAGGTGTCTCACGGCACCGGCTTCACATCTTTCGGCCTGCTGAAGCTC 720

[0237] GGAGGCGGCGGTAGTGGTGGAGGAGGCTCTGGCGGTGGTGGAAGCGCCTCTGAGCCC 750

[0238] AAGTCCTGCGACAAGACCCACACCTGTCCTCCATGTCCTGCTCCTGAGCTGCTGGGG 780

[0239] GATGACTCCGTGTTCCTGTTTCCTCCAAAGCCTAAGGACACCCTGATGATCTCTCGG 810

[0240] ACCCCTGAAGTGACCTGCGTGGTGGTGGACGTGTCCGACGAGGATGGCGAAGTGAAG 840

[0241] TTCAATTGGTACGTGGACGGCGTGGAAGTGCACAACGCCAAGACCAAGCCTAGAGAG 870

[0242] GAACAGTACAACTCCACCTACAGAGTGGTGTCCGTGCTGACCGTGCTGCACCAGGAT 900

[0243] TGGCTGAACGGCAAAGAGTACAAGTGCAAGGTGTCCAACAAGGCCCTGCCTCGGCCC 930

[0244] ATCGAAAAGACCATCTCCAAGGCCAAGGGCCAGCCTAGGGAACCCCAGGTTTACACC 960

[0245] TTGCCTCCATCTCGGGACGAGCTGACCAAGAACCAGGTGTCCCTGACCTGTCTCGTG 990

[0246] AAGGGCTTCTACCCCTCCGACATCGCCGTGGAATGGGAGTCTAATGGCCAGCCTGAG 1020

[0247] AACAACTACAAGACAACACCTCCTGTGCTGAGCGGGGGGGATCTATCACCTGCCCCA 1050

[0248] CCCATGTCGGTCGAACACGCTGACATCTGGGTGAAGTCCTACAGCCTGTACAGCCGG 1080

[0249] GAGCGGTACATCTGCAACAGCGGCTTCAAGCGGAAGGCTGGCACCTCCAGCCTGACC 1110

[0250] GAGTGTGTGCTGAACAAGGCCACCAACGTGGCTCACTGGACCACCCCCTCCTTGAAG 1140

[0251] TGCATCCGGGACAGCGGCGGCAGCGGCGGCGGATCTGGCGGCGGCGGATCTGGCGG 1170

[0252] CGGCGGATCTAACTGGGTGAACGTGATCTCCGACCTGAAGAAGATCGAGGACCTGAT 1200

[0253] CCAGAGCATGCACATCGACGCCACCTTGTACACCGAGAGCGACGTGCACCCCAGCTG 1230

[0254] CTGTAAGGTGACCGCCATGAAGTGCTTCCTGCTGGAGCTGCAGGTGATCAGCCTGGA 1260

[0255] GAGCGGCGACGCCAGCATCCACGACACCGTGGAGAATCTGATCATCCTGGCCAACGA 1290

[0256] CAGCCTGAGCAGCAACGGCAACGTGACCGAGAGCGGCTGCAAGGAGTGCGAGGAGCT 1320

[0257] GGAGGAGAAGAACATCAAGGAGTTCCTGCAGAGCTTCGTGCACATCGTGCAGATGTT 1350

[0258] CATCAACACCTCC 1359。

Claims

1. A CD40L-IL15 fusion protein, characterized in that, The fusion protein is constructed by connecting trimerized CD40L, IL-15 and the sushi region of IL-15 receptor alpha in series through an IgG1 Fc domain and specific linkers; wherein the trimerized CD40L can more specifically bind to CD40 on the surface of antigen presenting cells than CD40 activating antibodies, the structure of the fusion protein is N-terminal→trimerized CD40L→first linker→IgG1 Fc domain→second linker→IL-15→IL-15 receptor alpha sushi region→C-terminal, and the fusion protein can synergistically activate antigen presenting cells, dendritic cells, natural killer cells and CD8+ cytotoxic T lymphocytes. The trimerized CD40L is composed of three consecutive CD40L functional domains, each of which has an amino acid sequence identical to the sequence shown in SEQ ID NO: 1 with at least 95% identity; the IgG1 Fc domain has an amino acid sequence identical to the sequence shown in SEQ ID NO: 2 with at least 95% identity; the IL-15 has an amino acid sequence identical to the sequence shown in SEQ ID NO: 3 with at least 95% identity; the IL-15 receptor alpha sushi region has an amino acid sequence identical to the sequence shown in SEQ ID NO: 4 with at least 95% identity; the first linker has an amino acid sequence identical to the sequence shown in SEQ ID NO: 5 with at least 95% identity; the second linker has an amino acid sequence identical to the sequence shown in SEQ ID NO: 6 with at least 95% identity; and the overall amino acid sequence of the fusion protein has at least 90% identity to the sequence shown in SEQ ID NO:

7.

2. The CD40L-IL15 fusion protein of claim 1, wherein, The three CD40L functional domains in the trimerized CD40L are connected in series by a first linker, the C-terminal of the CD40L trimer is connected to the N-terminal of the IgG1 Fc domain through the first linker, the C-terminal of the IgG1 Fc domain is connected to the N-terminal of IL-15 through a second linker, and the C-terminal of IL-15 is directly connected to the N-terminal of the IL-15 receptor alpha sushi region; and the first linker is a glycine-serine repeat sequence with an amino acid sequence identical to the sequence shown in SEQ ID NO: 5 with at least 98% identity and a length of 8-10 amino acids; and the second linker is a glycine-serine repeat sequence with an amino acid sequence identical to the sequence shown in SEQ ID NO: 6 with at least 98% identity and a length of 10-12 amino acids.

3. The CD40L-IL15 fusion protein of claim 1, wherein, the amino acid sequence of the CD40L functional domain is completely identical to the sequence shown in SEQ ID NO: 1, the amino acid sequence of the IgG1 Fc domain is completely identical to the sequence shown in SEQ ID NO: 2, the amino acid sequence of IL-15 is completely identical to the sequence shown in SEQ ID NO: 3, the amino acid sequence of the IL-15 receptor alpha sushi region is completely identical to the sequence shown in SEQ ID NO: 4, the amino acid sequence of the first linker is completely identical to the sequence shown in SEQ ID NO: 5, the amino acid sequence of the second linker is completely identical to the sequence shown in SEQ ID NO: 6, and the overall amino acid sequence of the fusion protein is completely identical to the sequence shown in SEQ ID NO: 7; and the EC50 value of the fusion protein for stimulating natural killer cell proliferation is 80-100 ng / mL.

4. An isolated nucleic acid, comprising, The nucleic acid encodes the CD40L-IL15 fusion protein of any one of claims 1-3, and the nucleotide sequence thereof has at least 90% identity with the sequence shown in SEQ ID NO: 8; and the nucleic acid sequence is codon-optimized in a direction suitable for the codon bias of a mammalian host cell; the nucleic acid sequence does not contain complex secondary structures affecting mRNA stability, and codons matching the amino acid sequences of the linkers are added between the coding sequences of the respective functional domains, ensuring correct expression of the linkers and not affecting the reading frames of the adjacent functional domains.

5. A recombinant vector, characterized in that, The recombinant vector comprises the isolated nucleic acid of claim 4, and the recombinant vector is a recombinant expression vector, and the backbone plasmid thereof is pcDNA3.4; the nucleic acid is subcloned into the multiple cloning site of the pcDNA3.4 vector by enzyme digestion and ligation, and a CMV promoter is connected in series upstream of the insertion site, and a BGH poly(A) tailing signal is connected in series downstream of the insertion site; the vector further contains an ampicillin resistance gene as a screening marker, and an SV40 replication origin.

6. A transformant characterized in that, The transformant comprises the isolated nucleic acid of claim 4 or the recombinant vector of claim 5, and the host cell of the transformant is a CHO-S cell; when the CHO-S cell is transfected with the recombinant vector and cultured in an ExpiCHO medium containing 10% inactivated fetal bovine serum at 37°C, 8% CO2, and a rotation speed of 80 rpm, the secretory expression amount of the fusion protein reaches 50-80 mg / L; and after the transformant is cloned and screened by the limiting dilution method, a stable expression strain is obtained.

7. A method of making a CD40L-IL15 fusion protein, characterized in that, The method comprises the following steps: (1) Plasmid preparation: the nucleic acid sequence of claim 4, which has at least 95% identity with the sequence shown in SEQ ID NO: 8, is synthesized, and is subcloned into a pcDNA3.4 vector; an endotoxin-free plasmid extraction kit is used to prepare a transfection-grade plasmid, and the plasmid purity (A260 / A280) is 1.8-2.0; (2) Cell preparation: 1 day before transfection, CHO-S cells were passaged at a density of 3 x 10 6 -4 x 10 6 cells / mL and incubated overnight at 37°C, 8% CO2, 80 rpm shaking. When the cell density reached 7 x 10 6 -1 x 10 7 cells / mL, transfection was performed. (3) Transfection operation: dilute the CHO-S cells to 6 x 10 6 cells / mL with fresh pre-warmed ExpiCHO medium; calculate the amount of plasmid according to the transfection volume of 1.0 pg / mL, and dilute the transfection reagent ExpiFectamine CHO and the plasmid at a volume ratio of 12.5:1, respectively, then mix them and incubate at room temperature for 1-5 minutes to form a transfection complex; slowly add the transfection complex to the cell suspension and continue to culture at 37°C, 8% CO2, 80 rpm. (4) Culture and feeding: on the first day and the fifth day after transfection, an ExpiCHO enhancer and an ExpiCHO feed are respectively added to the culture system at a culture volume of 0.12% and 5%, respectively; (5) Purification and Harvest: The cell culture supernatant was collected after 10 days of culture, filtered through a 0.22 μm filter membrane, and then loaded onto a MabSelect SuRe LX affinity chromatography column. Elution was performed using a 50 mM citrate buffer, and the eluate was further purified by Superdex 200 gel filtration chromatography. The final product had a purity of ≥ 95% and an amino acid sequence with a consistency of ≥ 98% with the sequence shown in SEQ ID NO:

7. TM LX affinity chromatography column, elution was performed using a 50 mM citrate buffer, and the eluate was further purified by Superdex 200 gel filtration chromatography. The final product had a purity of ≥ 95% and an amino acid sequence with a consistency of ≥ 98% with the sequence shown in SEQ ID NO:

7.

8. A pharmaceutical composition, characterized by, The pharmaceutical composition comprises the CD40L-IL15 fusion protein of any one of claims 1-3, which has at least 90% identity with the sequence shown in SEQ ID NO: 7, and a pharmaceutically acceptable carrier; the concentration of the fusion protein in the pharmaceutical composition is 0.5-2 mg / mL, the single dose is 1 mg / kg; the pharmaceutically acceptable carrier is selected from one or more of physiological saline, phosphate buffer, 5%-10% sucrose solution; the pharmaceutical composition can also contain a combination therapy component selected from a PD-1 antibody, a chemotherapeutic agent or an oncolytic virus, wherein the molar ratio of the PD-1 antibody to the fusion protein is 1:1-1:

2.

9. Use of the CD40L-IL15 fusion protein according to any one of claims 1 to 3, the isolated nucleic acid according to claim 4, the recombinant vector according to claim 5, the transformant according to claim 6 or the pharmaceutical composition according to claim 8 for the manufacture of a medicament for the treatment of a tumor, characterized in that, The tumor is a solid tumor or a hematopoietic system malignant tumor, the solid tumor includes melanoma, colorectal cancer, pancreatic ductal adenocarcinoma, and the hematopoietic system malignant tumor includes diffuse large B-cell lymphoma; the drug is administered by intravenous injection, the administration frequency is once every 2 days, and 5 consecutive administrations constitute a treatment cycle; in the melanoma model, after one treatment cycle, the tumor volume of the administration group is reduced by 60%-70% compared with the control group, and the amino acid sequence of the fusion protein used has at least 95% identity with the sequence shown in SEQ ID NO:

7.

10. A kit characterized in that, The kit comprises the CD40L-IL15 fusion protein of any one of claims 1-3 or the pharmaceutical composition of claim 8; the kit further comprises a drug delivery device and an instruction manual, the drug delivery device is selected from a 1 mL or 2 mL disposable intravenous injection syringe equipped with a 0.22 μm filter needle; the storage condition of the fusion protein is recorded in the instruction manual as 2-8℃, light-protected storage and non-freezing, room temperature equilibration for 15-30 minutes before administration, the administration sequence when combined with a PD-1 antibody is to inject the fusion protein first and inject the PD-1 antibody 24 hours later, and the adverse reaction treatment scheme includes that acetaminophen can be given when low fever occurs.

Images