Polypeptide in targeted combination with SOX2 protein and application thereof
By targeting and disrupting the interaction domain of the SOX2 protein by a peptide, the problem of chemotherapy resistance in lung squamous cell carcinoma was solved, achieving enhanced efficacy of chemotherapy drugs and safe tumor treatment.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-09-23
- Publication Date
- 2026-03-10
AI Technical Summary
There is a lack of effective methods to reverse chemotherapy resistance in lung squamous cell carcinoma in the current technology, and strategies targeting SOX2 protein have problems such as low tissue specificity, poor biological safety and high cost. Directly inhibiting or degrading SOX2 poses safety risks.
To develop a peptide that targets and binds to the SOX2 protein, thereby inhibiting its phase separation by recognizing and disrupting the interaction domains of the SOX2 protein and avoiding affecting its transcriptional activation function, and to combine it with a transmembrane peptide to assist in cell entry, for use in the preparation of a drug for adjuvant therapy of squamous cell carcinoma.
It effectively reverses tumor chemotherapy resistance, enhances the efficacy of chemotherapy drugs, avoids the impact on the normal function of the organism, and provides a safe and low-cost treatment option.
Smart Images

Figure CN121627901A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the technical field of biological medicine, and particularly relates to a polypeptide for targeting binding to SOX2 protein and application thereof. BACKGROUND
[0002] According to the latest survey data of the World Health Organization (WHO), the morbidity and mortality of lung cancer in the world are both ranked first among malignant tumors, so the basic mechanism and prevention and treatment of lung cancer have extremely high research significance. According to the WHO classification standard of lung tumor tissue, lung cancer is mainly divided into two types of non-small cell lung cancer (NSCLC) and small cell lung cancer (SCLC), among which non-small cell lung cancer is the most common, accounting for 80% to 85% of the proportion. And non-small cell lung cancer is mainly divided into lung adenocarcinoma (LAUD), lung squamous cell carcinoma (LSCC), large cell carcinoma and other relatively rare classifications. With the clinical application of tyrosine kinase inhibitors (TKIs) and immune checkpoint inhibitors (ICIs), the treatment of LAUD patients has made great progress in the past two decades. However, due to the lack of suitable treatment targets, few LSCC patients benefit from these revolutionary treatments, and chemotherapy is still the main treatment method for LSCC patients, and overcoming the chemotherapy resistance of LSCC patients is the main challenge in the treatment process.
[0003] The mechanism of lung squamous cell carcinoma chemotherapy resistance is complex, including that the chemotherapeutic drugs can be actively effluxed by tumor cells to reduce the accumulation of drugs in cells; activation of DNA repair pathways; up-regulation of anti-apoptotic protein expression; regulation of tumor stem cells; abnormal metabolism and tumor microenvironment; tumor cells induce metastasis and drug resistance by escaping immune surveillance, etc. However, in the past few decades, there is still a lack of effective means to overcome chemotherapy resistance, and it is urgent to develop new strategies to reverse the chemotherapy resistance of LSCC.
[0004] SRY-BOX Transcription Factor 2 (SOX2) is an important member of the SOX transcription factor family, which plays a crucial role in early embryonic development and embryonic stem cell pluripotency, and can affect the physiological function of cells by binding to specific DNA sequences to regulate the transcription of specific genes (1)Mutations in SOX2 gene can cause optic nerve hypoplasia and small eye syndrome and a series of nervous system diseases, which further indicates the importance of SOX2 in maintaining the normal function of the nervous system (2) In recent years, studies have also found that there is a high frequency of SOX2 amplification in various squamous cell carcinomas such as lung squamous carcinoma and head and neck squamous carcinoma, which means that SOX2 plays an important regulatory role in the development of these tumors (3) Therefore, SOX2 is a potential LSCC regulatory factor, and new treatment strategies can be developed targeting SOX2 to reverse the chemoresistance of LSCC patients.
[0005] However, due to the disordered domain of SOX2 as a transcription factor, and the lack of a pocket for binding to small molecule ligands, it is considered not to be a drug target. There are currently several strategies for targeting SOX2, including: a, using artificial transcription factors (ATF) based on zinc fingers to directly target the SOX2 gene to regulate the expression of endogenous SOX2; b, generating short peptide aptamers to bind to SOX2 protein, thereby targeting the binding of SOX2 to DNA and inhibiting the transcriptional activity of SOX2; c, using small molecule inhibitors of the upstream signaling pathway that regulates SOX2 expression to indirectly inhibit the function of SOX2; d, inhibiting the ubiquitination degradation of SOX2 transcriptional repressor to specifically reduce SOX2 transcription; e, developing protein hydrolysis targeting chimera (PROTAC) to directly degrade SOX2. Although these attempts have achieved some success, there are still problems such as low tissue specificity, poor biological safety, and high cost. In addition, due to the important physiological function of SOX2 in the body, directly degrading or inhibiting its transcriptional activation function poses a significant safety risk. Overall, the effect of SOX2 targeting intervention strategies is still not satisfactory (4) Therefore, it is urgent to find other ways to intervene in SOX2 cancer treatment. There have been reports that many proteins undergo phase separation (5) in cells, which regulate various molecular biological processes such as gene transcription and chromatin structure formation (6-8) In addition, some proteins can interact with drugs through phase separation, thereby affecting the therapeutic effect of drugs, which reveals a new mechanism of protein physicochemical properties in tumor drug resistance (9,10) Studies have found that SOX2 can undergo phase separation (11) in vitro, which suggests that SOX2 protein can be intervened through its phase separation characteristics, but there have been no reports on the interaction of SOX2 protein with drugs through phase separation affecting the efficacy of chemotherapeutic drugs.
[0006] Novel peptide-based targeted small molecule drugs not only possess numerous advantages such as low cost, low molecular weight, good biocompatibility, strong penetration, and no potential immune system response, but also exhibit rapid in vivo metabolism and a simple production process. (12) Therefore, these drugs show great potential in targeted cancer therapy and cancer screening, and are expected to become a new method for treating cancer, and may even replace traditional antibody-based medical tools. Currently, a very small number of studies have reported that small peptides developed targeting SOX2 can inhibit tumor progression; however, the possibility that they may affect the transcriptional activation function of SOX2 cannot be ruled out. (13-15) Patent document CN116724053A discloses immunotherapy targeting the SOX2 antigen and specifically discloses several peptides that can be used for immunotherapy of cancers related to SOX2 antigen expression or activity. However, it does not disclose whether these peptides affect the transcriptional activation effect of SOX2. Patent document CN109942688A discloses the synthesis and application of peptide drugs targeting and binding to the SOX2 protein. Specifically, it discloses the peptide drug Peptide 42, which targets and binds to the Sox2 protein, for inhibiting the malignant process of tumor cells, inhibiting tumor initiation, and for preparing a therapeutic drug for esophageal squamous cell carcinoma. However, it does not disclose whether these peptides affect the transcriptional activation effect of SOX2.
[0007] Therefore, there is an urgent need to develop a small peptide that does not affect the transcriptional activation function of SOX2 and can be used to reverse chemotherapy resistance in squamous cell carcinoma. Summary of the Invention
[0008] Therefore, the technical problem to be solved by the present invention is to provide a polypeptide that targets and binds to the SOX2 protein and its uses. The polypeptide has the effect of disrupting the phase separation of the SOX2 protein without affecting the transcriptional activation function of SOX2. It can be used to reverse chemotherapy resistance in tumors such as squamous cell carcinoma and can be used to prepare drugs for adjuvant treatment of squamous cell carcinoma.
[0009] Therefore, the present invention provides the following technical solution:
[0010] A polypeptide that targets and binds to the SOX2 protein, the polypeptide having an amino acid sequence as shown in SEQ ID NO.1, or having at least 85%, 90%, 95%, or 99% sequence identity with the amino acid sequence shown.
[0011] As used in this article, the term “sequence identity” refers to the percentage of sequence identity between two polypeptide sequences or two nucleic acid sequences.
[0012] In some preferred embodiments, the polypeptide has an amino acid sequence as shown in SEQ ID NO.1, or has at least 85%, 87%, 88%, 90%, 95%, 97%, 98%, 99%, or 99.9% sequence identity with the amino acid sequence shown.
[0013] In one embodiment of the present invention, one end of the polypeptide may be coupled with a membrane-penetrating peptide, which may be a conventional cell-penetrating peptide in the art, to facilitate the polypeptide's passage across the cell membrane into the cell interior, such as H7R8, HIV-I TAT(48-60), TAT(47-57), TAT(48-57), and R9-Tat in the prior art. Further, the membrane-penetrating peptide has the amino acid sequence shown in SEQ ID NO.2; and / or, the membrane-penetrating peptide is coupled to the C-terminus of the polypeptide.
[0014] This invention also provides any of the following biomaterials:
[0015] (1) A nucleic acid molecule, wherein the nucleic acid molecule encodes the polypeptide that targets and binds to the SOX2 protein;
[0016] (2) An expression cassette, recombinant vector, recombinant cell or recombinant bacteria containing the nucleic acid molecule described in (1);
[0017] (3) Peptide derivatives, which are obtained by modifying the peptides that target and bind to the SOX2 protein.
[0018] As used herein, "vector" refers to a construct capable of delivering, preferably expressing in, a host cell, one or more target genes or sequences. Vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, granules, phage vectors, DNA or RNA expression vectors bound to cationic condensers, and DNA or RNA expression vectors encapsulated in liposomes.
[0019] As used in this article, the term "nucleic acid molecule" includes DNA molecules or RNA molecules. DNA molecules can be single-stranded or double-stranded.
[0020] Due to the degeneracy of the genetic code, a large number of nucleic acid molecules that can be used to encode the polypeptides of this invention can be obtained. Therefore, given the identification of a specific amino acid sequence, those skilled in the art can easily prepare any number of different nucleic acids by modifying the sequence of one or more codons without altering the amino acid sequence encoding the protein. More preferred polynucleotides can be selected through codon optimization based on the preferences of the host cells used in the actual preparation process.
[0021] The nucleic acid molecules described can be obtained using conventional methods, such as PCR amplification or artificial synthesis. Currently, the nucleic acid molecule sequences can be obtained entirely through chemical synthesis.
[0022] The host cells used in the recombinant cells or recombinant bacteria of this invention can be prokaryotic cells, lower eukaryotic cells, or higher eukaryotic cells. Prokaryotic cells include bacterial cells, lower eukaryotic cells include yeast cells, and higher eukaryotic cells include mammalian cells. Representative examples include Escherichia coli and yeast cells.
[0023] Transforming a vector into host cells to obtain recombinant cells or bacteria can be performed using conventional methods well-known to those skilled in the art. Examples include the CaCl2 method, electroporation, calcium phosphate co-precipitation, and conventional mechanical methods such as microinjection, electroporation, and liposome packaging. The resulting transformants can be cultured using conventional methods well-known to those skilled in the art, and the culture medium can be a standard culture medium. The peptides produced by the transformants can be separated and purified using physical and chemical methods, such as salting out, centrifugation, cell disruption, and chromatography.
[0024] The present invention provides that the said polypeptide or the said biomaterial has any of the following uses:
[0025] (1) Application in inhibiting phase separation of SOX2 protein;
[0026] (2) Use in the preparation of drugs for adjuvant therapy of tumors;
[0027] (3) Use in the preparation of drugs for treating tumors by combining antitumor drugs;
[0028] (4) Use in the preparation of drugs that reverse the phase separation of SOX2 proteins;
[0029] (5) Use in the preparation of drugs for the treatment or adjuvant treatment of tumors that highly express SOX2 protein.
[0030] As an embodiment of the present invention, the SOX2 protein phase separation includes in vitro SOX2 protein phase separation or intracellular SOX2 protein phase separation.
[0031] As an embodiment of the present invention, the cells include normal cells or tumor cells; optionally, the tumor cells include squamous cell carcinoma; optionally, the squamous cell carcinoma includes lung squamous cell carcinoma, head and neck squamous cell carcinoma, esophageal squamous cell carcinoma, cervical cancer or skin squamous cell carcinoma.
[0032] As an embodiment of the present invention, the tumor is squamous cell carcinoma;
[0033] As an embodiment of the present invention, the squamous cell carcinoma includes lung squamous cell carcinoma, head and neck squamous cell carcinoma, esophageal squamous cell carcinoma, cervical cancer, or skin squamous cell carcinoma.
[0034] As an embodiment of the present invention, the antitumor drug includes chemotherapy drugs, antibodies, immunomodulatory drugs, nucleic acid drugs, or physical therapy drugs;
[0035] As an embodiment of the present invention, the chemotherapy drug includes alkylating agents, antimetabolites, antibiotics, alkaloids, hormones, or other types of chemotherapy drugs; further, as a more preferred embodiment of the present invention, the antitumor drug includes at least one of cisplatin, carboplatin, lobaplatin, nedaplatin, oxaliplatin, gemcitabine, paclitaxel, docetaxel, cabazitaxel, etoposide, mitoxantrone, cyclophosphamide, and ifosfamide.
[0036] The present invention provides a pharmaceutical composition for treating squamous cell carcinoma, comprising the aforementioned peptide that targets and binds to the SOX2 protein and a chemotherapeutic agent, and optionally pharmaceutically acceptable excipients.
[0037] As used in this article, "pharmaceutically acceptable" means that the carrier, diluent, or excipient is compatible with the other components of the formulation and is substantially harmless to the recipient.
[0038] As an embodiment of the present invention, the squamous cell carcinoma includes squamous cell carcinoma of the lung, squamous cell carcinoma of the head and neck, squamous cell carcinoma of the esophagus, squamous cell carcinoma of the cervix, or squamous cell carcinoma of the skin.
[0039] As an embodiment of the present invention, the chemotherapy drug includes at least one of cisplatin, carboplatin, lobaplatin, nedaplatin, oxaliplatin, gemcitabine, paclitaxel, docetaxel, cabazitaxel, etoposide, mitoxantrone, cyclophosphamide, and ifosfamide.
[0040] As an implementable method, the excipients include any one or a combination of at least two of the following: carrier, diluent, excipient, filler, binder, wetting agent, disintegrant, emulsifier, cosolvent, solubilizer, osmotic pressure regulator, surfactant, coating material, colorant, pH adjuster, antioxidant, antibacterial agent, or buffer.
[0041] As an implementable method, the dosage form of the pharmaceutical composition includes liquid, semi-solid, or solid forms;
[0042] As an implementable method, the dosage form of the pharmaceutical composition includes tablets, capsules, pills, oral liquid preparations, granules, or powders.
[0043] The technical solution of this invention has the following advantages:
[0044] 1. The present invention provides a polypeptide that targets and binds to SOX2 protein, the polypeptide having an amino acid sequence as shown in SEQ ID NO.1, or having at least 85%, 90%, 95%, or 99% sequence identity with the amino acid sequence shown therein; the present invention first identifies a key structural domain that mediates the self-interaction of SOX2 protein, and analysis reveals that this structural domain contains features capable of forming protein secondary structures, and further research reveals that this structural domain contains multiple amino acid sequences that can respectively form the basic recognition element α-helix for protein-protein interactions. Through screening and experimental verification, this invention has discovered that the polypeptide (α-helix 1) can competitively bind to SOX2, thereby disrupting the self-interaction of SOX2 and inhibiting the phase separation of SOX2 in vitro or intracellularly. Further verification has shown that the polypeptide's inhibition of SOX2 phase separation can prevent the formation of droplets due to phase separation, thus preventing droplets from encapsulating chemotherapeutic drugs and affecting their efficacy, which could lead to tumor cell tolerance to chemotherapeutic drugs. Furthermore, the polypeptide does not affect the transcriptional activation function of SOX2 as a transcription factor, and therefore does not affect SOX2's regulation of normal physiological functions, such as its high expression in organs like the human eye. Therefore, the polypeptide of this invention can reverse chemotherapy resistance in tumors such as squamous cell carcinoma by inhibiting SOX2 phase separation, and can thus be used as an adjunct therapy for tumors such as squamous cell carcinoma, without significant toxic side effects on various organs of the organism.
[0045] 2. This invention provides a polypeptide that targets and binds to the SOX2 protein, wherein one end of the polypeptide is coupled with a membrane-penetrating peptide having the amino acid sequence shown in SEQ ID NO.2. To facilitate the entry of the small peptide α-helix 1 into cells, this invention fuses a membrane-penetrating peptide sequence that facilitates cell entry to its C-terminus, resulting in a fused polypeptide. Immunoprecipitation experiments showed that this fused polypeptide can disrupt the self-interactions of the SOX2 protein. In vitro protein-induced phase separation systems and live-cell SOX2 droplet imaging experiments showed that this fused polypeptide can disrupt the SOX2 phase separation. Attached Figure Description
[0046] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.
[0047] Figure 1 This refers to the results of the protein in vitro binding experiment in Example 1 of this invention;
[0048] Figure 2This refers to the results of the Flag immunoprecipitation experiment in Example 1 of this invention;
[0049] Figure 3 This refers to the Flag immunoprecipitation experiment results in Example 2 of this invention;
[0050] Figure 4 This is the purification result of prokaryotic expression and purification of SOX2-mCherry protein in Example 3 of this invention;
[0051] Figure 5 The results of in vitro detection of the effect of the fusion peptide on the separation of the SOX2 phase are shown in Example 3 of this invention; in the figure, Figure A is the confocal microscopy imaging result, Figure B is the quantitative result of the droplet area in Figure A, and Figure C is the quantitative result of the droplet number in Figure A.
[0052] Figure 6 The results show the effect of the fusion peptide in lung squamous cell carcinoma cells on the separation of the SOX2 phase in Example 4 of this invention; in the figure, A is the confocal microscopy imaging result, B is the quantitative result of the droplet area in A, and C is the quantitative result of the droplet number in A.
[0053] Figure 7 This is the result of detecting the effect of the fusion peptide on SOX2 transcriptional activation activity in Example 5 of this invention;
[0054] Figure 8 This is the result of the fusion peptide in Example 6 of the present invention reversing the phase separation of SOX2 protein promoted by chemotherapeutic drugs in vitro; in the figure, A is the result of confocal microscopy imaging, B is the quantitative result of the number of droplets in A, and C is the quantitative result of the droplet area in A.
[0055] Figure 9 This is the result of the fusion peptide in lung squamous cell carcinoma cells reversing the chemotherapy drug to promote the phase separation of SOX2 protein in Example 7 of the present invention; in the figure, A is the result of confocal microscopy imaging, B is the quantitative result of droplet area in A, and C is the quantitative result of droplet number in A.
[0056] Figure 10 This is the result of the effect of the fusion peptide inhibitory chemotherapy drug on the SOX2 protein and RNA levels of lung squamous cell carcinoma cells in Example 8 of the present invention; Figure A shows the detection results of the fusion peptide inhibitory chemotherapy drug on the SOX2 protein level of lung squamous cell carcinoma cells, and Figure B shows the detection results of the fusion peptide inhibitory chemotherapy drug on the SOX2 protein mRNA level of lung squamous cell carcinoma cells.
[0057] Figure 11 This is the adjuvant therapeutic effect of the fusion peptide in Example 9 of the present invention on chemotherapy for lung squamous cell carcinoma with high expression of SOX2; Figure A in the figure shows the measurement results of the xenografts in each group of animals, and Figure B shows the tumor growth curves of the xenografts in each group of animals.
[0058] Figure 12 These are the HE staining results of the transplanted tumors in each group of animals in Example 9 of this invention;
[0059] Figure 13 These are the results of hematoxylin-eosin staining of the kidneys, livers, and brains of the animals in each group in Example 9 of this invention. Detailed Implementation
[0060] The following embodiments are provided to better understand the present invention and are not limited to the preferred embodiments described. They do not constitute a limitation on the content and scope of protection of the present invention. Any product that is the same as or similar to the present invention, derived by any person under the guidance of the present invention or by combining the features of the present invention with other prior art, falls within the protection scope of the present invention.
[0061] For experiments not specifically described in the examples, the procedures or conditions should be followed according to the conventional experimental procedures described in the literature in this field. Reagents or instruments whose manufacturers are not specified are all commercially available conventional reagent products.
[0062] pGEX-4T-2 vector was purchased from Miaoling Biotechnology;
[0063] pSin vector was purchased from Miaoling Biotechnology;
[0064] pET-28a vector was purchased from Miaoling Biotechnology;
[0065] The pcDNA3.1 vector was purchased from Miaoling Biotechnology;
[0066] The pcDNA3.1 Gal4 DBD vector was purchased from Miaoling Biotechnology.
[0067] pRL-TK was purchased from Miaoling Biotechnology;
[0068] GAL4 UAS-Luciferase reporter was purchased from Miaoling Biotechnology;
[0069] LB liquid culture medium formula: tryptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L;
[0070] BCA protein concentration assay kit was purchased from Theromo Fisher.
[0071] Glutathione magnetic beads were purchased from Yisheng Biotechnology Co., Ltd.
[0072] Flag M2 magnetic beads were purchased from Sigma-Aldrich.
[0073] SK-MES-1 cells were purchased from the Kunming Cell Bank of the Chinese Academy of Sciences.
[0074] NCI-H520 cells were purchased from the Kunming Cell Bank of the Chinese Academy of Sciences.
[0075] PEI was purchased from Polysciences;
[0076] Lipo2000 was purchased from Shanghai Sangon Biotech.
[0077] HEPES, or 4-hydroxyethylpiperazine ethanesulfonic acid, is a Chinese name for this substance.
[0078] EDTA's Chinese name is ethylenediaminetetraacetic acid;
[0079] SDS stands for sodium dodecyl sulfate.
[0080] The Chinese name for DTT is dithiothreitol.
[0081] DMSO is also known as dimethyl sulfoxide.
[0082] As used in this article, α-helix1 can be replaced with α-helix1 polypeptide, α-helix1 protein, and similarly with α-helix2, α-helix3, SOX2, Flag-SOX2, HA-SOX2, and 6×His helix 1-3. The α-helix1 gene or α-helix1 gene fragment represents the gene encoding α-helix1, and similarly with α-helix2, α-helix3, SOX2, Flag-SOX2, HA-SOX2, and 6×Hishelix 1-3.
[0083] As used in this article, α-helix1-3 represents α-helix1, α-helix2, and α-helix3, and similarly, 6×Hishelix 1-3 represents 6×His helix 1, 6×His helix 2, and 6×His helix 3, and pGEX-4T-2GST-α-helix 1~3 represents pGEX-4T-2GST-α-helix 1, pGEX-4T-2GST-α-helix 2, and pGEX-4T-2GST-α-helix 3.
[0084] The "protease inhibitor" used in this article is a mixture of six broad-spectrum protease inhibitors, purchased from Selleck, Protease Inhibitor Cocktail, catalog number B14001, and used at a final concentration of 1:100 by volume.
[0085] The “optimized culture medium” used in this article is Opti-MEM serum-reduced medium, Gibco, catalog number 31985070.
[0086] Example 1: α-helix 1 targets and binds to SOX2 protein and inhibits SOX2 protein phase separation.
[0087] 1. Obtaining α-helix 1-3
[0088] This invention first identifies a key structural domain mediating the self-interactions of the SOX2 protein. Analysis revealed that this domain contains features capable of forming protein secondary structures. This invention found that this domain contains multiple amino acid sequences that can form the basic recognition element α-helix for protein-protein interactions. Three of these amino acid sequences were selected and denoted as follows:
[0089] α-helix1: The amino acid sequence is AFMVWSRGQRRKMAQE, see SEQ ID NO.1 in the sequence listing;
[0090] α-helix2: The amino acid sequence is NSEISKRLGAEWKL, see SEQ ID NO.2;
[0091] α-helix3: The amino acid sequence is ETEKRPFIDEAKRLRALHMKE, see SEQ ID NO.3.
[0092] SOX2 protein: The amino acid sequence is shown in SEQ ID NO.4.
[0093] The gene encoding α-helix1 is: gccttcatggtgtggtcccgcgggcagcggcgcaagatggcccaggag, see SEQ ID NO.5 in the sequence listing.
[0094] The gene encoding α-helix2 is: aactcggagatcagcaagcgcctgggcgccgagtggaaactt, see SEQ ID NO.6 in the sequence listing.
[0095] The gene encoding α-helix3 is: gagacggagaagcggccgttcatcgacgaggctaagcggctgcgagcgctgcacatgaaggag, see SEQ ID NO.7 in the sequence listing.
[0096] The gene encoding the SOX2 protein is shown in SEQ ID NO.8 of the sequence listing.
[0097] 6×His helix 1-3 consists of 6 histidine residues (HHHHHH) added to the N-terminus of the amino acid sequences of α-helix1, α-helix2, and α-helix3 (SEQ ID NO.1, SEQ ID NO.2, and SEQ ID NO.3), respectively (see SEQ ID NO.9 in the sequence listing). The gene sequence with 6 histidine residues is caccaccaccaccaccac (see SEQ ID NO.10 in the sequence listing). The coding genes of 6×Hishelix 1-3 are the gene sequences with the aforementioned 6 histidine residues added to the 5' end of the coding genes of α-helix1, α-helix2, and α-helix3 (SEQ ID NO.5, SEQ ID NO.6, and SEQ ID NO.7).
[0098] Flag-SOX2 is formed by adding the amino acid sequence DYKDDDDK to the N-terminus of the SOX2 protein amino acid sequence (SEQ ID NO.4), as shown in SEQ ID NO.11 of the sequence listing. The coding gene sequence of the Flag protein is gattacaaggatgacgacgataag, as shown in SEQ ID NO.12 of the sequence listing. The coding gene sequence of Flag-SOX2 is formed by adding the aforementioned coding gene of the Flag protein to the 5' end of the coding gene of the SOX2 protein (SEQ ID NO.8).
[0099] HA-SOX2 is formed by adding the amino acid sequence YPYDVPDYA to the N-terminus of the SOX2 protein amino acid sequence (SEQ ID NO.4), as shown in SEQ ID NO.13 of the sequence listing. The coding gene sequence for the HA protein is tacccatacgatgttccagattacgct, as shown in SEQ ID NO.14 of the sequence listing. The coding gene sequence for HA-SOX2 is formed by adding the aforementioned coding gene for the HA protein to the 5' end of the coding gene for the SOX2 protein (SEQ ID NO.8).
[0100] 2. Construction of expression vectors for SOX2 and α-helix 1-3
[0101] The HMG domain of α-helix 1-3 and SOX2 proteins (amino acid sequence shown in SEQ ID NO. 15, encoding gene shown in SEQ ID NO. 16), amplified using phanta DNA polymerase, was then subjected to homologous recombination with the pGEX-4T-2 vector digested with BamHI and EcoRI (using a kit from YEASEN). Universal One Step Cloning Kit (catalog number 10922ES20); 6× His helix 1-3 gene fragments, Flag-SOX2 gene fragments, and HA-SOX2 gene fragments amplified using phanta DNA polymerase were homologously recombinated with pSin vector digested with BamHI and EcoRI (using YEASEN Hieff kit). Universal One Step Cloning Kit (catalog number 10922ES20) was used; the homologous recombination product was then transformed into E. coli (DH5α) competent cells, and positive clones were screened by ampicillin resistance plates. The single colonies were verified by Sanger DNA sequencing; the sequencing results were compared with BLAST to obtain the correctly sequenced strains. After expansion culture, the recombinant plasmids pGEX-4T-2GST-HMG, pGEX-4T-2GST-α-helix 1, pGEX-4T-2GST-α-helix 2, pGEX-4T-2GST-α-helix 3, pSin 6×His helix 1, pSin 6×Hishelix 2, pSin 6×His helix 3, pSin Flag-SOX2, and pSin HA-SOX2 were extracted and stored at -20℃ for long-term storage.
[0102] 3. Prokaryotic expression and purification of GST-HMG or GST-α-helix 1-3 proteins
[0103] The pGEX-4T-2GST-HMG or pGEX-4T-2GST-α-helix 1-3 vectors constructed in step 2, along with the control (empty pGEX-4T-2 vector, which only expresses GST protein), were transformed into BL21 competent cells. After plating and culturing for 12 hours, one single colony was picked and transferred to 10 mL of LB broth containing 50 μg / mL ampicillin. After culturing at 37°C with shaking for 4 hours, the cells were transferred at a 1:100 volume ratio to 300 mL of LB broth containing 50 μg / mL ampicillin. The cells were then cultured at 37°C with shaking at 200 rpm until OD (out of control) was reached. 600At a concentration of 0.6, add isopropyl thiogalactoside (IPTG, final concentration 0.5 mM), and induce induction at 16°C for 12 hours on a shaker. Collect bacterial cells by centrifugation at 4000g for 10 min, wash the cells once with PBS, and resuspend the cells in PBS containing 10 times the cell weight of the PBS containing a protease inhibitor (final concentration diluted 1:100). Disrupt the cells using an autoclave at 1000 Pa. Centrifuge at 4°C, 12000g for 40 min, and collect the supernatant. Add the supernatant to 5 mL of equilibrated glutathione agarose gel, and incubate the mixture at 4°C for 2 hours. After the liquid has drained, wash with 10 times the volume of PBS. Add 5 mL of elution buffer (10 mM reduced glutathione, protease inhibitor (final concentration diluted 1:100)), incubate for 10 minutes, and collect the eluent. Transfer the eluent to a 10 kDa dialysis bag and dialyze with protein storage buffer (25 mM HEPES, pH 10). The protein solution was dialyzed at 4°C for 9 hours using 7.5% NaCl (500 mM NaCl, 10% glycerol). The dialyzed protein solution was then centrifuged at 4°C and 4200 g using a 10 kDa ultrafiltration tube to concentrate the protein solution to 2 mL. The concentration of the protein concentrate was determined using a BCA protein concentration assay kit. The purified protein was aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C to obtain GST-HMG protein, GST-α-helix 1-3 protein, or control GST protein.
[0104] 4. Protein in vitro binding assay (GST pull-down)
[0105] (1) Take 200 μg of GST-HMG protein, GST-α-helix 1-3 protein or control GST protein and 30 μL of pre-washed glutathione magnetic beads respectively, and add the volume to 600 μL with IP buffer (50 mM Tris (pH 7.4), 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, protease inhibitor (final concentration is diluted at a volume ratio of 1:100)). After incubating at 4℃ for 12 hours, wash the magnetic beads 3 times with IP buffer for 10 min each time to finally obtain glutathione magnetic beads that bind to GST-HMG protein, GST-α-helix 1-3 protein or control GST protein.
[0106] (2) Seed SK-MES-1 cells into 10cm plates. Collect cells when the cell density reaches 90%. Wash cells with PBS and lyse them with lysis buffer (50mM Tris (pH 7.4), 1mM EDTA, 150mM NaCl, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and protease inhibitor (final concentration diluted 1:100 by volume). Incubate on ice for 30 minutes, then centrifuge at 4°C and 12000g for 10 minutes. Collect the supernatant and use Nanodrop. After determining the protein concentration using A280, the supernatant containing 500 μg of protein was added to the glutathione magnetic beads pre-bound with protein obtained in step (1). The volume was increased to 500 μL with IP buffer. After incubation at 4°C for 12 hours, the magnetic beads were washed four times with IP buffer for 10 minutes each time. Loading buffer was added, and the mixture was boiled at 99°C for 10 minutes to denature the protein. Western blot and Coomassie brilliant blue staining were then performed for detection.
[0107] 5. Immunoprecipitation assay for lung squamous cell carcinoma cells and Flag cells.
[0108] (1) Seed SK-MES-1 cells into 10cm plates and transfect them after the cell density reaches 70%. Take 2.5μg of pSin 6×His Helix1 / 2 / 3 or pSin 6×His (control, pGEX 4T-2 only inserts the gene sequence of 6 histidine 6×His) and 2.5μg of pSin HA-SOX2 and 2.5μg of pSin Flag-SOX2 vectors into 1mL of optimized medium, vortex and mix well, let stand for 5 minutes, add 30μL of PEI, vortex and mix well, let stand for 10 minutes, add to a culture dish (containing SK-MES-1 cells after the cell density reaches 70%), culture at 37℃ and 5% CO2 for 12 hours, change the medium, and collect the cells after 36 hours.
[0109] (2) Flag Immunoprecipitation
[0110] After washing the cells collected in step (1) with PBS, lyse them with lysis buffer (50 mM Tris (pH 7.4), 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and protease inhibitor (final concentration diluted 1:100 by volume)). Incubate on ice for 30 minutes, then centrifuge at 2,000 g for 10 minutes at 4°C. Collect the supernatant, determine the protein concentration using a Nanodrop A280, and transfer the supernatant containing 500 μg of protein to pre-washed Flag M2 magnetic beads. Make up the volume to 500 μL with lysis buffer and incubate at 4°C for 16 hours. Wash with immunoprecipitation washing buffer (50 mM Tris (pH 7.4), 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and protease inhibitor (final concentration diluted 1:100 by volume)). Wash four times with SDS (protease inhibitor), each wash lasting 10 minutes. Add loading buffer, boil at 99°C for 10 minutes to denature, and then perform Western blot analysis.
[0111] 6. Experimental Results
[0112] Results of in vitro protein binding experiments as follows Figure 1 As shown, GST, GST-HMG, and GST-helix1-3 were first bound to a glutathione agarose gel, and then the supernatant (expressing SOX2 protein) of Sk-MES-1 cells after lysis and centrifugation was added for incubation (GST pull-down). Western blotting was used to detect whether GST, GST-HMG, and GST-helix1-3 could pull down SOX2, in order to detect whether GST, GST-HMG, and GST-helix1-3 could interact with SOX2 (see the upper part of the figure). The lower part of the figure shows Coomassie brilliant blue staining, indicating that the amount of different proteins with GST tags in the GST pull-down system is equivalent. The results show that HMG and α-helix 1, α-helix 2, and α-helix 3 can all interact with SOX2 protein.
[0113] The results of the Flag immunoprecipitation assay are as follows: Figure 2As shown in Figure IP, which represents immunoprecipitation, the first and second rows from top to bottom are for detecting whether HA-SOX2 was pulled down after IP and the enrichment effect of the flag beads. In the first row, it shows the detection of HA protein after IP. HA protein and SOX2 protein are expressed in fusion. The first, third, and fourth columns from left to right all show the expression of HA protein, indicating that flag-SOX2 can bind to HA-SOX2, suggesting that SOX2 has an internal interaction. The HA protein band detected in the second column is faint, indicating that transiently switching α-helix 1 prevents flag-SOX2 from binding to HA-SOX2, showing that α-helix 1 can disrupt the SOX2 internal interaction, while transiently switching α-helix 2 and α-helix 3 cannot disrupt the SOX2 interaction. The input in the figure shows that the supernatant after centrifugation of the protein lysis buffer used for immunoprecipitation does indeed express flag-SOX2 and HA-SOX2 proteins.
[0114] Example 2, Fusion Peptide Hx1 R8 Disruption of SOX2 protein self-interactions
[0115] 1. Synthesis of fusion peptides
[0116] The polypeptide sequence, AFMVWSRGQRRKMAQE, is coupled at its C-terminus to a transmembrane peptide sequence consisting of eight arginine residues (R8), as shown in SEQ ID NO.17, and is referred to as Hx1. R8 After conjugation, the specific targeting sequence can cross the cell membrane and enter the cell under the guidance of the transmembrane peptide R8. Simultaneously, a mutant polypeptide sequence GGGGGSRGGRRGGGGG, which cannot form α-helix, was designed and conjugated with a transmembrane peptide sequence consisting of eight arginine residues (R8) to obtain a mutant polypeptide named Hx1Mut. R8 The sequence is shown in SEQ ID NO.18. The polypeptide Hx1 described in this invention... R8 and Hx1 Mut R8 Synthesized by GenScript Inc.
[0117] 2. Transfection of lung squamous cell carcinoma cells and treatment with fusion peptides
[0118] SK-MES-1 cells were seeded into 10cm dishes and transfected after reaching 70% confluency. 5 μg of pSin HA-SOX2 and pSin flag-SOX2 plasmids were added to 1 mL of optimized culture medium, vortexed, and incubated for 5 minutes. 40 μL of PEI was added, vortexed, and incubated for 10 minutes. The mixture was then transferred to culture dishes and incubated at 37°C and 5% CO2 for 12 hours. The medium was changed, and after 36 hours, 10 μM of the fusion peptide (Hx1) was added. R8 Or Hx1 MutR8 Meanwhile, a control group was set up with an equal volume of PBS (pH 7.2), and cells were collected after culturing for 12 hours.
[0119] 3. Flag Immunoprecipitation
[0120] Cells were washed with PBS and lysed with lysis buffer (50 mM Tris (pH 7.4), 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and protease inhibitor (final concentration: 1:100 volume dilution)). After incubation on ice for 30 minutes, the cells were centrifuged at 12000g for 10 minutes at 4°C. The supernatant was collected, and protein concentration was determined using a Nanodrop A280. A supernatant containing 500 μg of protein was transferred to pre-washed Flag M2 magnetic beads, and the volume was brought up to 500 μL with lysis buffer. The cells were incubated at 4°C for 16 hours. Immunoprecipitation washing buffer (50 mM Tris (pH 7.4), 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and protease inhibitor (final concentration: 1:100 volume dilution)) was used. Wash four times with SDS and protease inhibitor (final concentration diluted 1:100 by volume), each wash lasting 10 minutes; add loading buffer, boil at 99°C for 10 minutes for denaturation, and then perform Western blot detection.
[0121] 4. Experimental Results
[0122] Experimental results are as follows Figure 3 As shown, the mutant Hx1 Mut R8 The effect of SOX2 self-interaction is seen in the first and second lanes of the first row, where the intensity is similar. The third lane has an intensity of Hx1. R8 It is significantly weaker than the first and second lanes, so the mutant Hx1Mut R8 It has no effect on the interaction between SOX2 and itself, while Hx1 R8 Significantly disrupts SOX2 interactions. This indicates that SOX2 itself interacts with each other, and the addition of the fusion peptide Hx1... R8 Cell treatment resulted in Flag-SOX2 being unable to bind to HA-SOX2, indicating that the interaction between SOX2 was disrupted; while the addition of the fusion peptide mutant Hx1 Mut R8 The treatment had no effect on the interaction of the SOX2 protein itself.
[0123] Example 3, Fusion polypeptide Hx1 R8 Inhibit the in vitro phase separation of SOX2 protein
[0124] 1. Synthesis of fusion peptides
[0125] Same as "1. Synthesis of fusion polypeptide" in Example 2.
[0126] 2. Construct the pET 28a 6×His SOX2-GS linker-mCherry expression plasmid
[0127] The SOX2-GS linker-mCherry gene fragment amplified using phanta DNA polymerase (formulated by sequentially linking the GS linker coding gene and the mCherry coding gene to the 3' end of the SOX2 coding gene SEQ ID NO. 8, as shown in SEQ ID NO. 19 and the mCherry coding gene in SEQ ID NO. 20, with a 6-histidine-added coding gene SEQ ID NO. 10 at the 5' end) was homologously recombinated with the pET-28a vector digested with BamHI and EcoRI (using a kit from YEASEN). Universal One Step Cloning Kit (catalog number 10922ES20); then the homologous recombination product was transformed into E. coli (DH5α) competent cells, positive clones were screened by kanamycin resistance plates, and the single clones were verified by Sanger DNA sequencing; the sequencing results were compared with BLAST to obtain the correctly sequenced strains, and after expansion culture, the plasmid pET 28a 6×His SOX2-GS linker-mCherry was extracted and stored at -20℃ for long-term storage.
[0128] 3. Prokaryotic expression and purification of SOX2-mCherry protein
[0129] After transforming the pET 28a 6×His SOX2-GS linker-mCherry plasmid into BL21 competent cells, the cells were plated and cultured for 12 hours. One single colony was picked and transferred to 10 mL of LB broth containing 50 μg / mL kanamycin. After culturing at 37°C with shaking for 4 hours, the cells were transferred at a 1:100 ratio to 300 mL of LB broth containing 50 μg / mL kanamycin and cultured at 37°C with shaking at 200 rpm until OD (outcome limit). 600At a concentration of 0.6, add isopropyl thiogalactoside (IPTG, final concentration 0.5 mM), and induce on a shaker at 16°C for 12 hours. Collect bacterial cells by centrifugation at 4000g for 10 min, wash the cells once with PBS, and resuspend the cells in binding buffer (50 mM Tris HCl (pH 7.9), 500 mM NaCl, 10 mM imidazole, and protease inhibitor (final concentration diluted 1:100 by volume) at 10 times the cell weight. Disrupt the cells using a high-pressure homogenizer at 1000 Pa, centrifuge at 4°C and 12000g for 40 min, and collect the supernatant. Add the supernatant to 5 mL of equilibrated Ni-NTA agarose gel, incubate the mixture at 4°C for 2 hours, and after the liquid has drained, add 50 mL of binding buffer. After the liquid has drained, add 25 mL of 30 mM imidazole elution buffer, incubate for 5 minutes, and collect the elution buffer. Add 25 mL of... Elution buffer: Add 50 mM imidazole, incubate for 5 minutes, and collect the eluent. Add 5 mL of 100 mM imidazole, incubate for 10 minutes, and collect the eluent. Add 5 mL of 300 mM imidazole, incubate for 10 minutes, and collect the eluent. Add 5 mL of 500 mM imidazole, incubate for 10 minutes, and collect the eluent. Take 20 μL of the eluent at different imidazole concentrations, perform SDS-PAGE, and stain with rapid Coomassie brilliant blue to detect the protein purification effect. The purification results are as follows: Figure 4 As shown, the eluent containing the target band was placed in a 10kDa dialysis bag and dialyzed at 4°C for 9 hours with protein storage buffer (25mM HEPES (pH 7.5), 500mM NaCl, 10% glycerol). The dialyzed protein solution was centrifuged at 4°C and 4200g using a 10kDa ultrafiltration tube to concentrate the protein solution to 2mL. The concentration of the protein concentrate was determined using a BCA protein concentration assay kit. The purified protein was aliquoted, flash-frozen in liquid nitrogen, and stored at -80°C.
[0130] 4. In vitro detection of the effect of fusion peptides on SOX2 phase separation
[0131] The salt concentration of the SOX2-mCherry protein stock solution was adjusted to 150 mM using low-salt buffer (25 mM HEPES (pH 7.5), 1 mM DTT), and then 0.25 μM fusion peptide Hx1 was added. R8 Or the mutant Hx1 Mut R8 Meanwhile, a control group was set up with an equal volume of purified water. After standing at room temperature for 5 minutes, the liquid was carefully added to the imaging slide and imaged using a Zeiss LSM900 confocal microscope (63× oil immersion). Fifteen fields of view were selected for each condition, and FIJI was used to perform statistical analysis and image processing on the size and area of the droplets.
[0132] 5. Experimental Results
[0133] Experimental results are as follows Figure 5 As shown in Figures A, B, and C, the fusion peptide mutant Hx1Mut was added. R8 The study had no significant effect on the size of the protein droplets or the number of droplets per field of view, indicating that the fusion peptide mutant Hx1 Mut... R8 The addition of the fusion peptide Hx1 had no effect on the phase separation of the SOX2 protein in vitro; compared with the control group, the addition of the fusion peptide Hx1... R8 The size of the protein droplets decreased significantly, and the number of droplets per field of view decreased significantly, indicating that the fusion peptide Hx1... R8 It can significantly inhibit the phase separation of SOX2 protein in vitro.
[0134] Example 4, Fusion Peptide Hx1 R8 Inhibition of phase separation of SOX2 protein in lung squamous cell carcinoma cells
[0135] 1. Synthesis of fusion peptides
[0136] Same as "1. Synthesis of fusion polypeptide" in Example 2.
[0137] 2. Construct the pcDNA3.1 SOX2-GS linker-eGFP expression plasmid
[0138] The SOX2-GS linker-eGFP gene fragment amplified by phanta DNA polymerase (which consists of the Gs linker coding gene and the eGFP coding gene sequentially linked to the 3' end of the SOX2 coding gene SEQ ID NO. 8, as shown in SEQ ID NO. 19 and the eGFP coding gene in SEQ ID NO. 21) was homologously recombined with the pcDNA3.1 vector digested with BamHI and XhoI (using the YEASEN Hieff kit). The Universal One Step Cloning Kit (catalog number 10922ES20) was used to transform homologous recombination products into E. coli (DH5α) competent cells. Positive clones were screened using ampicillin-resistant plates, and single-clone colonies were verified by Sanger DNA sequencing. The sequencing results were compared with BLAST to obtain the correctly sequenced strains. After expansion culture, the plasmid pcDNA3.1SOX2-GS linker-eGFP was extracted and stored at -20℃ for long-term storage.
[0139] 3. Construction of SK-MES-1 lung squamous cell carcinoma cell line transiently overexpressing SOX2-eGFP
[0140] SK-MES-1 cells were seeded into 6-well plates. When the cell density reached about 50%, 1 ng of pcDNA3.1 SOX2-GS linker-eGFP expression plasmid and 200 μL of optimized culture medium were added, vortexed and mixed, and allowed to stand for 5 minutes. Then, 4 μL of PEI was added, vortexed and mixed, and allowed to stand for 10 minutes. The mixture was then added to the well plates. The medium was changed 12 hours after transfection. After 36 hours, the cells were digested, and 20,000 cells per well were seeded into 8-well plates.
[0141] 4. Detection of the effect of fusion peptide on SOX2 protein phase separation in lung squamous cell carcinoma cells.
[0142] SK-MES-1 cells transfected with pcDNA3.1 SOX2-GS linker-eGFP expression plasmid were cultured in eight-well plates until they reached approximately 80% cell density. Then, a final concentration of 10 μM fusion peptide Hx1 was added. R8 Or the mutant Hx1 Mut R8 Meanwhile, a control group was set up with an equal volume of purified water. After culturing at 37°C and 5% CO2 for 12 hours, images were taken using a Zeiss LSM900 confocal microscope (63× oil immersion). 10-15 cells were selected for each condition and photographed. FIJI was used to statistically analyze the size and area of the droplets and perform image processing.
[0143] 5. Experimental Results
[0144] Experimental results are as follows Figure 6 As shown, the fusion peptide mutant Hx1 Mut was added. R8 The size of the protein droplets and the number of droplets in a single cell nucleus did not change significantly, indicating that the fusion peptide mutant Hx1Mut... R8 The addition of the fusion peptide Hx1 had no effect on the phase separation of SOX2 protein in lung squamous cell carcinoma cells; compared with the control group, the addition of the fusion peptide Hx1... R8 The treatment resulted in a significant reduction in the droplet size of protein SOX2 and a significant reduction in the number of droplets per cell, indicating that the fusion peptide Hx1... R8 It can significantly inhibit phase separation of SOX2 protein in lung squamous cell carcinoma cells.
[0145] Example 5: Fusion peptide Hx1 R8 It does not affect SOX2 transcriptional activation activity.
[0146] 1. Synthesis of fusion peptides
[0147] Same as "1. Synthesis of fusion polypeptide" in Example 2.
[0148] 2. Construct the pcDNA3.1 Gal4 DBD-SOX2 expression plasmid
[0149] The SOX2 gene fragment amplified by phanta DNA polymerase (as shown in SEQ ID NO. 8) and the pcDNA3.1 Gal4 DBD vector digested with BamHI and HindIII were homologously recombined (using the YEASEN Hieff kit). The Universal One Step Cloning Kit (catalog number 10922ES20) was used to transform homologous recombination products into E. coli (DH5α) competent cells. Positive clones were screened using ampicillin-resistant plates, and single-clone colonies were verified by Sanger DNA sequencing. The sequencing results were compared with BLAST to obtain the correctly sequenced strains. After expansion culture, the plasmid pcDNA3.1 Gal4 DBD-SOX2 was extracted and stored at -20℃ for long-term storage.
[0150] 3. Transiently transfected NCI-H520 lung squamous cell carcinoma cell line
[0151] NCI-H520 cells were seeded into 6-well plates. Transfection was performed when the cell density approached 50%. 3 ng of the internal control plasmid pRL-TK, 1.5 μg of GAL4 UAS-Luciferase reporter, and 1.5 μg of pcDNA3.1 Gal4 DBD-SOX2 expression plasmid (or empty vector plasmid pcDNA3.1 Gal4 DBD, expressing only Gal4 DBD) were mixed with 250 μL of optimized medium. After vortexing, the mixture was allowed to stand for 5 min to obtain mixture 1. 10 μL of Lipo2000 was mixed with 250 μL of optimized medium. After vortexing, the mixture was allowed to stand for 5 min to obtain mixture 2. Mixtures 1 and 2 were combined and allowed to stand for 5 min. The mixture was then slowly added dropwise to 6-well plates that had been pre-treated with fresh medium. After 8 hours, the medium was replaced with a solution containing a final concentration of 10 μM fusion peptide Hx1. R8 Or the mutant Hx1 Mut R8 Cells were cultured in RPMI 1640 medium (10% FBS), while a control group was prepared with an equal volume of PBS (pH 7.2). Cells were collected 36 hours after transfection for luciferase activity assay.
[0152] 4. Experimental Results
[0153] Experimental results are as follows Figure 7 As shown, the fusion peptide Hx1 was added. R8 Or the mutant Hx1 Mut R8 The luciferase activity of the fusion peptide Hx1 was not significantly different from that of the control group, indicating that the luciferase activity of the fusion peptide Hx1 was not significantly different from that of the control group. R8 It has no effect on the function of SOX2 as a transcription factor to activate gene transcription.
[0154] Example 6, Fusion peptide Hx1 R8 In vitro reversal of the chemotherapeutic effect on the phase separation of SOX2 protein
[0155] 1. Synthesis of fusion peptides
[0156] Same as "1. Synthesis of fusion polypeptide" in Example 2.
[0157] 2. Construct the pET 28a 6×His SOX2-GS linker-mCherry expression plasmid
[0158] Same as in Example 3, "2. Construct pET 28a 6×His SOX2-GS linker-mCherry expression plasmid".
[0159] 3. Prokaryotic expression and purification of SOX2-mCherry protein
[0160] Same as in Example 3, "3. Prokaryotic expression and purification of SOX2-mCherry protein".
[0161] 4. In vitro detection of the effect of fusion peptides on the promotion of SOX2 protein phase separation by chemotherapeutic drugs.
[0162] The salt concentration of the SOX2-mCherry protein stock solution was adjusted to 150 mM using a low-salt buffer (25 mM HEPES (pH 7.5), 1 mM DTT), and divided into 5 groups:
[0163] Group a: DMSO solvent was added to the SOX2-mCherry protein stock solution, and the final concentration of the SOX2-mCherry protein solution was 0.25 μM.
[0164] Group B was incubated for 5 minutes with a final concentration of 100 μM chemotherapy drug (Cou-platin, green fluorescent coumarin cisplatin) and a final concentration of 0.25 μM SOX2-mCherry protein solution.
[0165] Group C was incubated for 5 minutes with a final concentration of 100 μM chemotherapy drug (Cou-platin, green fluorescent coumarin cisplatin) and a final concentration of 0.25 μM SOX2-mCherry protein solution. Then, an equal volume of purified water (and the mutant Hx1Mut added in group D) was added. R8 Or the fusion peptide Hx1 added to group e R8 (The volumes are the same);
[0166] Group d was incubated for 5 minutes with a final concentration of 100 μM chemotherapeutic agent (Cou-platin, green fluorescent coumarin cisplatin) and a final concentration of 0.25 μM SOX2-mCherry protein solution, followed by the addition of a final concentration of 0.25 μM mutant Hx1 Mut.R8 ;
[0167] Group e was incubated for 5 minutes with a final concentration of 100 μM chemotherapeutic agent (Cou-platin, green fluorescent coumarin cisplatin) and a final concentration of 0.25 μM SOX2-mCherry protein solution, followed by the addition of a final concentration of 0.25 μM fusion peptide Hx1. R8 ;
[0168] After each group was allowed to stand at room temperature for 5 minutes, the liquid was carefully added to the imaging slide. Before and after the addition of the fusion peptide, the images were taken using a Zeiss LSM900 confocal microscope (63× oil immersion). Fifteen fields of view were selected for each condition. The size and area of the droplets were statistically analyzed and the images were processed using FIJI.
[0169] 5. Experimental Results
[0170] Experimental results are as follows Figure 8 As shown in Figures A, B, and C, compared to group a, the area and number of SOX2 protein droplets significantly increased after the addition of chemotherapy drugs, indicating that chemotherapy drugs promote the phase separation of SOX2 proteins. Further addition of the fusion peptide Hx1... R8 The size of the protein droplets decreased significantly, and the number of droplets per field of view decreased significantly, indicating that the fusion peptide Hx1... R8 It can significantly reverse the effect of chemotherapy drugs on the phase separation of SOX2 protein; while the addition of the fusion peptide mutant Hx1 Mut R8 The study had no significant effect on protein droplet size or the number of droplets per field of view, indicating that the fusion peptide mutant Hx1 Mut... R8 The effect of chemotherapy drugs on the phase separation of the SOX2 protein is irreversible.
[0171] Example 7, Fusion Peptide Hx1 R8 Reversing the effect of chemotherapy-induced SOX2 protein phase separation in lung squamous cell carcinoma cells
[0172] 1. Synthesis of fusion peptides
[0173] Same as "1. Synthesis of fusion polypeptide" in Example 2.
[0174] 2. Construct the pcDNA3.1 SOX2-GS linker-eGFP expression plasmid
[0175] Same as in Example 4, "2. Construct pcDNA3.1 SOX2-GS linker-eGFP expression plasmid".
[0176] 3. Construction of SK-MES-1 lung squamous cell carcinoma cell line transiently overexpressing SOX2-eGFP
[0177] Same as in Example 4, “Construction of SK-MES-1 lung squamous cell carcinoma cell line with transient overexpression of SOX2-eGFP”.
[0178] 4. Detection of the effect of fusion peptide on SOX2 protein phase separation in lung squamous cell carcinoma cells.
[0179] SK-MES-1 cells transiently transfected with the pcDNA3.1 SOX2-GS linker-eGFP expression plasmid were divided into 5 groups after reaching approximately 80% confluence in eight-well plates:
[0180] Group A was incubated for 48 hours at 37°C and 5% CO2 with an equal volume of DMSO solvent (the same volume as the chemotherapy drug added in Group B).
[0181] Group B was incubated for 48 hours at 37°C and 5% CO2 with a final concentration of 2 μM chemotherapy drug (cisplatins).
[0182] Group C was incubated for 48 hours at 37°C and 5% CO2 with a final concentration of 2 μM chemotherapeutic agent (cisplatin). An equal volume of water was then added (compared to the 10 μM Hx1 mutant added in group D). R8 (equal volume);
[0183] Group d was incubated with a final concentration of 2 μM chemotherapy drug (cisplatin) at 37°C and 5% CO2 for 48 hours, followed by the addition of a final concentration of 10 μM mutant Hx1 Mut. R8 ;
[0184] Group e was incubated with a final concentration of 2 μM chemotherapy drug (cisplatin) at 37°C and 5% CO2 for 48 hours, followed by the addition of a final concentration of 10 μM fusion peptide Hx1. R8 ;
[0185] After culturing at 37℃ and 5% CO2 for 12 hours, the above groups were imaged using a Zeiss LSM900 confocal microscope (63× oil immersion). 10-15 cells were selected for each condition for imaging, and the size and area of the droplets were statistically analyzed and processed using FIJI.
[0186] 5. Experimental Results
[0187] Experimental results are as follows Figure 9 As shown in Figures A, B, and C, compared to group a, the area and number of intracellular SOX2 protein droplets were significantly increased after chemotherapy treatment. Further addition of the fusion peptide Hx1... R8The protein droplet size was significantly reduced, and the number of droplets in a single cell nucleus was significantly reduced, indicating that the fusion polypeptide Hx1... R8 It can significantly reverse the effect of chemotherapy drugs on the promotion of SOX2 protein phase separation in lung squamous cell carcinoma cells; the addition of the fusion peptide mutant Hx1 Mut R8 It had no significant effect on protein droplet size or the number of droplets in a single cell nucleus, indicating that the fusion peptide mutant Hx1 Mut... R8 The effect of chemotherapy drugs on the phase separation of the SOX2 protein is irreversible.
[0188] Example 8, Fusion Peptide Hx1 R8 Inhibit the upregulation of SOX2 protein levels in lung squamous cell carcinoma cells by chemotherapy drugs
[0189] 1. Synthesis of fusion peptides
[0190] Same as "1. Synthesis of fusion polypeptide" in Example 2.
[0191] 2. Treatment of lung squamous cell carcinoma cells with fusion peptides
[0192] NCI-H520 cells were seeded in 6-well plates and cultured at 37°C and 5% CO2. When the cell density reached 40%, cisplatin (2 μM) and fusion peptide Hx1 (10 μM) were added. R8 Or the mutant Hx1 Mut R8 After co-treatment for 48 hours (using H520 medium), cells were harvested.
[0193] 3. Protein extraction and detection
[0194] Cells were washed with PBS and lysed with RIPA buffer (50 mM Tris HCl (pH 8.0), 1 mM EDTA, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 0.1% sodium deoxycholate, and protease inhibitor (final concentration diluted 1:100 by volume). After incubation on ice for 30 minutes, the cells were centrifuged at 12000g for 10 minutes at 4°C. The supernatant was collected, and protein concentration was determined using a Nanodrop A280 followed by Western blotting. RNA was extracted using an RNA extraction kit (Magen, RaPure Total RNA Micro Kit, catalog number R4012-03). RNA was then extracted using a reverse osmosis kit (Vazyme Biotech). III. RT SuperMix for qPCR (+gDNA wiper, catalog number R323-01) was used for reverse transcription. Then, the mRNA level of SOX2 was detected using a qPCR detection kit (SYBR Green, Genstar, SYBR Green PCR Mix, catalog number A301-01).
[0195] 4. Experimental Results
[0196] Experimental results are as follows Figure 10 As shown in Figure A, the addition of the fusion peptide Hx1 in the absence of chemotherapy drugs... R8 The downregulation of SOX2 protein levels is due to Hx1. R8 It inhibited the formation of SOX2 droplets, suppressed the phase separation of SOX2, and disrupted aggregation, while the fusion peptide mutant Hx1 Mut R8 This has no effect on SOX2 protein levels; however, under chemotherapy treatment, SOX2 protein levels are upregulated, and the fusion peptide Hx1 is affected. R8 When used in combination with chemotherapy drugs, it significantly inhibited the promotion of SOX2 protein levels by chemotherapy drugs, while the fusion peptide mutant Hx1 Mut R8 The combination chemotherapy group had no effect on SOX2 protein levels.
[0197] like Figure 10 As shown in Figure B, the addition of the fusion peptide Hx1 in the absence of chemotherapy drugs... R8 and Hx1 Mut R8 No effect on the mRNA level of SOX2 protein; no effect on the mRNA level of SOX2 under chemotherapy drug treatment, fusion peptide Hx1 R8 and Hx1 Mut R8 When used in combination with chemotherapy drugs, it had no effect on SOX2 mRNA levels, indicating that the fusion peptide Hx1 alone could not affect its efficacy. R8 and fusion peptide mutant Hx1 R8 When used in combination with cisplatin, it had no effect on SOX2 transcription.
[0198] Example 9, Fusion polypeptide Hx1 R8 Adjuvant therapy effect of chemotherapy for lung squamous cell carcinoma with high SOX2 expression
[0199] 1. Method
[0200] Six- to eight-week-old female BALB / c nude mice were used. 4 million NCI-H520 cells were subcutaneously injected into the right scapular region of the mice, and observation continued until the tumor reached 100 mm in size. 3Experiment begins; intraperitoneal injections of physiological saline (Vehicle), cisplatin (CDDP), and Hx1 Mut are administered respectively. R8 Hx1 R8 Hx1 Mut R8 Combined use of cisplatin (Hx1 Mut) R8 -CDDP) or Hx1 R8 Combined use of cisplatin (Hx1) R8 -CDDP), inject saline dose (same volume as cisplatin and fusion peptide), cisplatin dose 1 mg / kg (body weight), Hx1 Mut R8 Dosage 5 mg / kg (body weight), Hx1 R8 Dosage 5 mg / kg (body weight), Hx1 Mut R8 The combined cisplatin dose was Hx1 Mut R8 5 mg / kg (body weight) and cisplatin 1 mg / kg (body weight), Hx1 R8 The combined cisplatin dose was Hx1. R8 5 mg / kg (body weight) and cisplatin 1 mg / kg (body weight), cisplatin was injected once a week, and the fusion peptide was injected every other day. Tumor bearing was measured daily; the longest side of the tumor in the control group (Vehicle) reached 1500 mm. 3 Euthanasia was performed, and tumor growth curves were calculated. Hematoxylin-eosin staining was performed on the transplanted tumors and on the kidneys, liver, and brains of the treated mice.
[0201] 2. Experimental Results
[0202] Experimental results are as follows Figure 11 As shown in Figures A and B, compared to cisplatin injection alone, the fusion peptide Hx1... R8 Combination therapy with cisplatin significantly improved the efficacy of cisplatin (P = 0.0179), significantly slowed tumor growth, reduced tumor weight, caused extensive necrosis in xenograft tumors, significantly promoted apoptosis, and enhanced the tumor-killing effect of cisplatin. The fusion peptide mutant Hx1 Mut... R8 Combination therapy with cisplatin did not enhance the efficacy of cisplatin (P > 0.05).
[0203] Experimental results are as follows Figure 12 The H&E staining results of the xenografts shown indicate that, compared with cisplatin injection alone, Hx1 injection... R8 Extensive necrosis of xenografts treated with cisplatin showed that Hx1 R8 The combined use of cisplatin significantly promoted cell apoptosis and enhanced the antitumor effect of cisplatin.
[0204] Experimental results are as follows Figure 13As shown, the brain structure of mice in each group was normal, with no significant differences observed. Liver staining results showed that the size of liver lobules was relatively uniform across groups, hepatic cords were arranged radially, cell morphology was consistent, no inflammatory cells or abnormal material accumulation were observed, and no thrombosis or other abnormalities were observed in the central vein. In the kidneys of mice in each group, nephrons were evenly distributed in the cortical area, glomeruli were normal in morphology without abnormal proliferation, renal tubules were normal in morphology without tubular structures, and there were no inflammatory cells or fibrosis in the interstitium. This indicates that the fusion polypeptide Hx1... R8 It is secure.
[0205] References involved in this invention:
[0206] 1. Schepers GE, Teasdale RD, Koopman P. Twenty pairs of sox: extent, homology, and nomenclature of the mouse and human sox transcription factor genefamilies. Dev Cell 2002; 3:167-70.
[0207] 2.Bertolini JA,Favaro R,Zhu Y,Pagin M,Ngan CY,Wong CH,et al.Mapping the Global Chromatin Connectivity Network for Sox2 Function inNeural StemCell Maintenance.Cell Stem Cell 2019;24:462-76 e6.
[0208] 3.Bass AJ,Watanabe H,Mermel CH,Yu S,Perner S,Verhaak RG,et al.SOX2 isan amplified lineage-survival oncogene in lung and esophagealsquamous cellcarcinomas.Nat Genet 2009;41:1238-42.
[0209] 4.Huser L, Novak D, Umansky V, Altevogt P, Utikal J. Targeting SOX2inanticancer therapy. Expert Opin Ther Targets 2018;22:983-91.
[0210] 5.Tsang B,Pritisanac I,Scherer SW,Moses AM,Forman-KayJD.PhaseSeparation as a Missing Mechanism for Interpretation of DiseaseMutations.Cell 2020;183:1742-56.
[0211] 6.Hnisz D,Shrinivas K,Young RA,Chakraborty AK,Sharp PA.APhaseSeparation Model for Transcriptional Control.Cell 2017;169:13-23.
[0212] 7.Mehta S,Zhang J.Liquid-liquid phase separation drives cellularfunctionand dysfunction in cancer.Nat Rev Cancer 2022;22:239-52.
[0213] 8.Tong X,Tang R,Xu J,Wang W,Zhao Y,Yu X,et al.Liquid-liquidphaseseparation in tumor biology.Signal Transduct Target Ther 2022;7:221.
[0214] 9.Wang T,Shi S,Shi Y,Jiang P,Hu G,Ye Q,et al.Chemical-inducedphasetransition and global conformational reorganization of chromatin.NatCommun2023;14:5556.
[0215] 10.Klein IA,Boija A,Afeyan LK,Hawken SW,Fan M,Dall'Agnese A,etal.Partitioning of cancer therapeutics in nuclear condensates.Science2020;368:1386-92.
[0216] 11. Boija A, Klein IA, Sabari BR, Dall'Agnese A, Coffey EL, Zamudio AV, et al. Transcription Factors Activate Genes through the Phase-Separation Capacity of Their Activation Domains. Cell 2018;175:1842-55.e16.
[0217] 12. Wang L, Wang N, Zhang W, Cheng X, Yan Z, Shao G, et al. Therapeuticpeptides: current applications and future directions. Signal Transduct TargetTher 2022;7:48.
[0218] 13. Liu K, Xie F, Zhao T, Zhang R, Gao A, Chen Y, et al. Targeting SOX2Protein with Peptide Aptamers for Therapeutic Gains against EsophagealSquamous Cell Carcinoma. Mol Ther 2020; 28:901-13.
[0219] 14. Liu, Kuan-chan; Xie, Fu-an; Lin, Bao-shun; Zhang, Rui; Xiao, Zhang-wu; Hu, Qiong, et al. Candidate peptide aptamers for Sox2CDP binding domain. 2017.
[0220] 15. Liu Kuanchan, Xie Fuan, Zhao Tingting, Zhang Rui, Xiao Zhangwu, Lin Baoshun, et al. Synthesis and application of peptide drugs targeting Sox2 protein.
[0221] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art will recognize that other variations or modifications can be made based on the above description. It is neither necessary nor possible to exhaustively list all possible implementations here. However, obvious variations or modifications derived therefrom are still within the scope of protection of this invention.
Claims
1. A polypeptide that binds to a SOX2 protein with target specificity, characterized in that, The polypeptide has an amino acid sequence as shown in SEQ ID NO. 1, or has at least 85%, 90%, 95% or 99% sequence identity with the amino acid sequence.
2. The polypeptide targeted to bind to a SOX2 protein according to claim 1, wherein, One end of the polypeptide is coupled with a transmembrane peptide.
3. The polypeptide targeted to bind to a SOX2 protein according to claim 2, wherein, The transmembrane peptide has an amino acid sequence as shown in SEQ ID NO.
2. And / or, the transmembrane peptide is coupled at the C-terminal of the polypeptide.
4. Any of the following biological materials: (1) a nucleic acid molecule encoding the polypeptide of any of claims 1-3 for targeting binding to SOX2 protein; (2) an expression cassette, a recombinant vector, a recombinant cell or a recombinant bacteria containing the nucleic acid molecule of (1); (3) a polypeptide derivative modified from the polypeptide of any of claims 1-3 for targeting binding to SOX2 protein.
5. Use of the polypeptide of any of claims 1-3 or the biological material of claim 4 for any of the following purposes: (1) for inhibiting phase separation of SOX2 protein; (2) for preparing a drug for assisting in treating tumors; (3) for preparing a drug for treating tumors in combination with an anti-tumor drug; (4) for preparing a drug for reversing phase separation of SOX2 protein; (5) for preparing a drug for treating or assisting in treating tumors with high expression of SOX2 protein.
6. Use according to claim 5, characterized in that, The phase separation of SOX2 protein includes in vitro phase separation of SOX2 protein or intracellular phase separation of SOX2 protein. Optionally, the cell includes a normal cell or a tumor cell; optionally, the tumor cell includes squamous cell carcinoma; optionally, the squamous cell carcinoma includes lung squamous carcinoma, head and neck squamous carcinoma, esophageal squamous carcinoma, cervical cancer or skin squamous carcinoma.
7. Use according to claim 5, characterized in that, The tumor is squamous cell carcinoma; Optionally, the squamous cell carcinoma includes lung squamous carcinoma, head and neck squamous carcinoma, esophageal squamous carcinoma, cervical cancer or skin squamous carcinoma; Optionally, the anti-tumor drug includes a chemotherapy drug, an antibody, an immune drug or a nucleic acid drug or a physical treatment drug; Optionally, the chemotherapy drug includes an alkylating agent, an anti-metabolite chemotherapy drug, an antibiotic chemotherapy drug, a plant alkaloid drug, a hormone drug or other chemotherapy drugs; Optionally, the anti-tumor drug includes at least one of cisplatin, carboplatin, lobaplatin, nedaplatin, oxaliplatin, gemcitabine, paclitaxel, docetaxel, cabazitaxel, etoposide, mitoxantrone, cyclophosphamide and ifosfamide.
8. A pharmaceutical composition for the treatment of squamous cell carcinoma, characterized by comprising the compound of claim 1. A pharmaceutical composition for resisting squamous cell carcinoma, comprising the polypeptide of any of claims 1-3 for targeting binding to SOX2 protein and a chemotherapy drug, and optionally a pharmaceutically acceptable excipient.
9. The pharmaceutical composition for resisting squamous cell carcinoma according to claim 8, wherein: The squamous cell carcinoma includes lung squamous carcinoma, head and neck squamous carcinoma, esophageal squamous carcinoma, cervical cancer or skin squamous carcinoma; And / or, the chemotherapy drug includes at least one of cisplatin, carboplatin, lobaplatin, nedaplatin, oxaliplatin, gemcitabine, paclitaxel, docetaxel, cabazitaxel, etoposide, mitoxantrone, cyclophosphamide and ifosfamide. and / or the adjuvant includes any one or a combination of at least two of a carrier, a diluent, an excipient, a filler, a binder, a wetting agent, a disintegrant, an emulsifier, a co-solvent, a solubilizer, an osmotic pressure adjusting agent, a surfactant, a coating material, a coloring agent, a pH adjusting agent, an antioxidant, a bacteriostatic agent, or a buffer; and / or the dosage form of the pharmaceutical composition includes a liquid, a semi-solid, or a solid form. 10.The pharmaceutical composition for use against squamous cell carcinoma according to claim 8 or 9, wherein, the dosage form of the pharmaceutical composition includes a tablet, a capsule, a pill, an oral liquid preparation, a granule, or a powder.
Citation Information
Patent Citations
Immunotherapy targeting SOX2 antigens
CN116724053A
Synthesis and application of polypeptide drug in targeted combination with Sox2 protein
CN109942688A
Polypeptide in targeted binding with binding domain in Sox2-CDP protein compound on CDP as well as synthesis method and application of polypeptide
CN113861276A