Anti-tumor enhanced neurotoxicity-free VSV vector recombinant oncolytic virus
By replacing the G protein of VSV with the G protein of Luyovirus and inserting the IFN-β gene, the constructed VSV-LUJG-IFN-β recombinant oncolytic virus solves the neurotoxicity problem of VSV, achieving both safety and tumor suppression effects, and is suitable for the treatment of various tumor types.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-04
- Publication Date
- 2026-03-10
AI Technical Summary
Existing oncolytic virus vectors, such as vesicular stomatitis virus (VSV), have neurotoxicity issues, especially when administered via the central nervous system, leading to severe encephalitis. Furthermore, current technologies have not yet developed novel oncolytic viruses that combine non-neurotoxicity, specific tumor targeting, and highly efficient immune activation.
By using reverse genetics, the G protein-coding gene of wild-type VSV was replaced with the G protein-coding gene of Luyovirus, and a gene encoding the anti-tumor enhancing factor IFN-β was inserted into the VSV vector genome to construct a recombinant oncolytic virus VSV-LUJG-IFN-β with anti-tumor enhancement and no neurotoxicity.
It achieves non-neurotoxicity, good safety, and strong tumor suppression effect. The virus replicates efficiently on Vero cells with high titers, significantly inhibits tumor growth in immunocompetent mouse homologous xenograft models, prolongs the survival of tumor-bearing mice, and has no significant neurotoxic symptoms.
Smart Images

Figure CN121628846A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of biomedical technology, and in particular to a non-neurotoxic VSV vector recombinant oncolytic virus with enhanced antitumor activity. Background Technology
[0002] Malignant tumors are among the major diseases that seriously threaten human health and life, with their incidence increasing year by year, making them a major global public health problem. For a long time, surgery, radiotherapy, and chemotherapy have been routine treatments for tumors, but their efficacy is limited and their side effects are significant for patients with advanced or metastatic cancer. In recent years, immune checkpoint inhibitors (ICIs) have made breakthroughs in some cancers, but low response rates and primary drug resistance remain significant challenges. Therefore, the development of novel, highly effective, and safe anti-tumor therapies is urgently needed.
[0003] Oncolytic viruses are viruses capable of selectively infecting and lysing malignant tumor cells while simultaneously stimulating the body's anti-tumor immune response. By modifying the viral genome through genetic engineering to load specific targeting elements or immunomodulatory factors, their tumor specificity and therapeutic efficacy can be significantly enhanced. Currently, several oncolytic virus products have been approved for clinical use globally. For example, T-VEC, based on herpes simplex virus type I, was approved by the US FDA in 2015 for the treatment of advanced melanoma. Furthermore, a large number of oncolytic virus candidates are in various stages of clinical trials, covering multiple solid tumor types such as lung cancer, colorectal cancer, liver cancer, and breast cancer, demonstrating the broad clinical application prospects of this field.
[0004] Among various viral vectors, vesicular stomatitis virus (VSV) is considered an ideal oncolytic virus vector platform due to its advantages such as low pre-existing immunity in humans, genome non-integration, rapid replication, strong oncolytic efficacy, and ease of genetic engineering manipulation. However, wild-type VSV has shown significant neurotoxicity in preclinical studies, especially when administered via the central nervous system, inducing severe encephalitis in rodent and non-human primate models. This safety concern seriously hinders its clinical translation.
[0005] G proteins, as key proteins in VSV infection, not only determine its cell tropism but are also a major factor mediating neurotoxicity. To reduce VSV neurotoxicity, a common strategy in existing technologies is to modify its envelope glycoproteins. For example, studies have reported constructing chimeric VSVs using the GP protein of lymphocytic choriomeningitis virus or the H / F protein of measles virus, which has reduced neurotoxicity to some extent.
[0006] "Armed" oncolytic viruses to express immunostimulatory factors is an important way to enhance their anti-tumor immune effects. Interferon-β (IFN-β) is a type I interferon produced by fibroblasts and immune cells, possessing broad antiviral, tumor cell proliferation inhibition, and immune regulation functions. Introducing IFN-β into oncolytic viruses can directly inhibit tumor cell growth and promote apoptosis in the tumor microenvironment, and activate immune effector cells such as dendritic cells and natural killer cells, thereby enhancing the overall anti-tumor response. In addition, IFN-β has antiviral activity; its expression in viral vectors can inhibit viral replication and accelerate viral clearance. Tumor cells often have a defective type I interferon signaling pathway, resulting in a decreased responsiveness to type I interferon. This mechanism can promote oncolytic virus replication in tumor cells without affecting normal cells, thus improving safety.
[0007] Although previous studies have explored the expression of IFN-β in individual oncolytic virus vectors, the construction of a novel oncolytic virus that combines non-neurotoxicity, specific tumor targeting, and highly efficient immune activation has not yet been reported in existing technologies. Therefore, there is an urgent need in this field to develop a novel oncolytic virus construction method that can effectively address the aforementioned safety and efficacy challenges. Summary of the Invention
[0008] The purpose of this invention is to provide a non-neurotoxic VSV vector recombinant oncolytic virus with enhanced antitumor activity, which is non-neurotoxic, has good safety, and also has a strong tumor-suppressive effect.
[0009] The technical solution adopted by this invention to solve its technical problem is: A recombinant oncolytic virus with antitumor enhancement and no neurotoxicity, VSV vector, was obtained by replacing the G protein-coding gene of wild-type VSV with the G protein-coding gene of Luyovirus using reverse genetics, and inserting a gene encoding the antitumor enhancing factor IFN-β into the VSV vector genome. This resulted in a self-replicating recombinant oncolytic virus with antitumor enhancement and no neurotoxicity, VSV-LUJG-IFN-β.
[0010] Preferably, the gene encoding the antitumor enhancing factor IFN-β is inserted between the M protein of VSV virus and the G protein of Luyo virus.
[0011] Preferably, the antitumor enhancing factor IFN-β is human IFN-β, mouse IFN-β, or canine IFN-β.
[0012] Preferably, the gene sequence of human IFN-β is shown in SEQ ID No. 2, the gene sequence of mouse IFN-β is shown in SEQ ID No. 3, and the gene sequence of canine IFN-β is shown in SEQ ID No. 4.
[0013] Preferably, the wild-type VSV strain is the Indiana strain.
[0014] As a preferred embodiment, the gene sequence of the G protein encoding gene of Luyovirus is shown in SEQ ID No. 1.
[0015] As a preferred embodiment, the preparation method is as follows: (1) Construction of VSV-LUJG-IFN-β plasmid: First, the VSV genome is inserted into the BAC vector, then the gene sequence of the G protein on the VSV genome is replaced with the gene sequence encoding the Luyo virus G protein, and at the same time, the gene encoding the anti-tumor enhancing factor IFN-β is inserted between the M gene and the G protein gene of the VSV genome to obtain the pBAC-VSV-LUJG-IFN-β plasmid; (2) Rescue of recombinant virus: The first cell to be infected was infected with a poxvirus expressing T7 polymerase. The infected cells were co-transfected with pBAC-VSV-LUJG-IFN-β plasmid, pN, pP, pL and pG plasmid. The supernatant of the diseased cells was collected 48 h after transfection. The supernatant was used to infect the second cell to be infected. After the virus was amplified, the supernatant of the diseased cells was collected to obtain the recombinant oncolytic virus of the VSV vector. The first cell type to be infected was BHK21 cells; The second cell to be infected is Vero cell.
[0016] As a preferred option, the mass ratio of pBAC-VSV-LUJG-IFN-β, pN, pP, pL and pG plasmids during co-transfection is 10:3:5:1:3.
[0017] The application of a non-neurotoxic, antitumor-enhanced recombinant oncolytic virus (VSV) vector as described above in the preparation of antitumor drugs. Tumors include gastrointestinal tumors, head and neck tumors, breast cancer, lymphoma, uterine cancer, ovarian cancer, bladder cancer, lung cancer, kidney cancer, osteosarcoma, and melanoma.
[0018] The beneficial effects of this invention are: Mass production capability: The virus can replicate efficiently on Vero cells, with titers reaching 10-1. 8.5 TCID 50 / mL or higher, meeting the requirements for industrial production.
[0019] Significant oncolytic effect: In homologous xenograft tumor models in immunocompetent mice, it can effectively inhibit tumor growth and achieve tumor clearance, significantly prolonging the survival of tumor-bearing mice and demonstrating outstanding therapeutic potential.
[0020] Excellent safety profile: Animal studies have shown that when mice were inoculated via the intracranial route, the virus did not induce significant neurotoxic symptoms (such as significant weight loss, paralysis, convulsions, death, etc.). Attached Figure Description
[0021] Figure 1 This is a schematic diagram of the construction of the VSV-LUJG-IFN-β recombinant oncolytic virus molecule; Figure 2 This is a diagram illustrating the tumor-inhibiting effect of VSV-LUJG-IFN-β recombinant oncolytic virus in a mouse tumor model. Figure 3 This is a graph showing the change in body weight in mice after intratumoral administration of VSV-LUJG-IFN-β recombinant oncolytic virus; Figure 4 The survival curves of mice after intratumoral administration of VSV-LUJG-IFN-β recombinant oncolytic virus are shown. Figure 5 This is a diagram showing the tumor-inhibiting effects of recombinant oncolytic viruses VSV-LUJG-IFN-β, VSV-LUJG-mGMCSF, and VSV-LUJG-PDL1 ScFv in a mouse tumor model. Detailed Implementation
[0022] The technical solution of the present invention will be further described in detail below through specific embodiments.
[0023] In this invention, unless otherwise specified, all raw materials and equipment used are commercially available or commonly used in the field. The methods described in the following embodiments are conventional methods in the field, unless otherwise specified.
[0024] Example 1 Preparation of VSV-LUJG-IFN-β recombinant oncolytic virus (virus construction and rescue) We used a vesicular stomatitis virus (VSV) vector, deleted its surface envelope protein (G protein) gene, and inserted the gene encoding the Lujo virus (LUJV) G protein (SEQ ID No. 1). We also inserted IFN-β genes encoding different species, including human IFN-β (SEQ ID No. 2), mouse IFN-β (SEQ ID No. 3), and canine IFN-β (SEQ ID No. 4), between the M protein of the VSV vector and the G protein of the Lujo virus. Recombinant VSV-LUJG-IFN-β viruses were constructed using reverse genetics. Figure 1 ).
[0025] The vesicular stomatitis virus strain used in this embodiment is the Indiana strain.
[0026] For the construction of the full-length pVSV-LUJG-IFN-β plasmid, the gene encoding the Luyovirus G protein and the human, mouse and canine IFN-β genes were synthesized by gene synthesis. The synthesized gene fragments were amplified by PCR according to the Primer Star enzyme instructions. The primer sequence information for amplification is shown in Table 1.
[0027] Table 1 Amplification Primer Sequences .
[0028] The amplified gene fragments were cloned into the G protein gene position and the space between the M gene and G protein gene in the VSV vector via homologous recombination (Uniclone One Step Seamless Cloning Kit), respectively, to form a full-length recombinant viral plasmid carrying IFN-β and Luyo virus G protein.
[0029] The specific plasmid construction process is as follows: 1. PCR amplification using DNA polymerase (Primer Star) to obtain the corresponding fragments; 2. Recombination of each fragment using homologous recombinase (Uniclone One Step Seamless Cloning Kit) and transformation into competent cells; 3. Picking single colonies and performing bacterial PCR using universal vector primers and Taq enzyme, and sending the PCR product with the correct band size for detection; 4. Extracting plasmids from the correctly sequenced colony clones.
[0030] The virus rescue method is as follows: BHK-21 cells were infected with poxvirus expressing T7 polymerase, and then co-transfected with the full-length plasmids constructed above and the helper plasmids expressing VSV-N, VSV-P, VSV-L, and VSV-G (pN, pP, pL, and pG; the helper plasmids were constructed by inserting the corresponding VSV protein coding sequence into the pBluescript II SK(+) vector) (the mass ratio of the full-length plasmid, pN, pP, pL, and pG plasmids was 10:3:5:1:3). After 48 h, the cells and supernatant were collected, filtered through a 0.22 μm filter, and the supernatant was used for later use. The viral stock solution was inoculated into new Vero cells, and the cells were observed to show cytopathic effects. If cytopathic effects were observed, the cells were collected again and subjected to three freeze-thaw cycles. The cells were then filtered through a 0.45 μm filter, aliquoted, and stored at -80°C to obtain the viral stock solution. The collected recombinant viruses were named VSV-LUJG-mIFN-β, VSV-LUJG-hIFN-β, and VSV-LUJG-dIFN-β, respectively, and the titers of the recombinant viruses were measured.
[0031] Recombinant virus titers were measured using the Reed-Muench method. Viruses were serially diluted 10-fold and inoculated into 96-well plates coated with Vero cells. After 48 hours of incubation, cytopathic effects were observed, and the number of positive and negative wells was recorded. The viral TCID was calculated. 50 The viral titers of the recombinant virus in this embodiment of the invention after passage stabilization are measured as follows (Table 2): Table 2. Recombinant virus titers of each VSV vector .
[0032] Example 2 Evaluation of neurotoxicity of recombinant virus The applicant's previous work has demonstrated that the VSV-LUJG recombinant strain (preparation method described in the applicant's prior application 2025115018044) has no neurotoxicity and good safety. Further insertion of IFN-β will not affect the virus's neurotoxicity because the neurotropism of the VSV vector recombinant virus is determined by the viral envelope protein, and in this recombinant oncolytic virus, IFN-β is in a secretory form and is not expressed on the viral surface, thus having no effect on the virus's neurotoxicity.
[0033] Example 3: Antitumor effect of VSV-LUJG-IFN-β recombinant oncolytic virus To evaluate the potential therapeutic effect of recombinant strains on tumors, a mouse colon cancer CT26 cell xenograft model was used to evaluate the oncolytic effects of each VSV-LUJG-IFN-β recombinant strain constructed in Example 1. The VSV-LUJG recombinant strain (preparation method described in the applicant's prior application 2025115018044) was used as a control. Thirty female BALB / c mice aged 6 to 8 weeks were selected, and each mouse was subcutaneously inoculated with CT26 cells (2 × 10⁻⁶ cells) on the right side. 6 (6 mice per group, 100 μL / 100 μL). Tumor growth was observed daily after inoculation. Tumor volume was measured once the tumor was visually visible, with measurements taken three times every two days using calipers. The volume was calculated using the following formula: Tumor volume = 1 / 2 × a × b² (where a represents the maximum diameter in millimeters; b represents the minimum diameter in millimeters). On day 7 post-inoculation, when the tumor volume reached 80–100 mm³, intratumoral drug administration was initiated, using PBS as a negative control. The administration regimen was: 10 μL / 100 μL per mouse. 6 TCID 50 Administer 100 μL orally every 2 days for a total of 3 doses. Measure tumor volume every 2 days after administration.
[0034] like Figure 2-4 As shown in the mouse xenograft model results, compared with the VSV-LUJG control group, the three recombinant viral strains, VSV-LUJG-mIFN-β, VSV-LUJG-hIFN-β, and VSV-LUJG-dIFN-β, exhibited significantly enhanced tumor-suppressive effects. After administration, their inhibitory effects on tumor growth in mice were more pronounced, with some mice even achieving tumor clearance and complete remission (Table 3). Long-term tumor-free survival exceeded 8 weeks, and the survival rate of mice was significantly prolonged. Intratumoral injection of the drug did not result in significant changes in mouse body weight, indicating that the addition of IFN-β as an immunomodulatory factor to the VSV-LUJG recombinant vector effectively activates anti-tumor immunity, and the resulting VSV-LUJG-IFN-β strain has excellent therapeutic effects on tumors.
[0035] Table 3. Complete tumor remission in mice after administration of VSV-LUJG-IFN-β recombinant virus .
[0036] Comparative Example 1 We used a vesicular stomatitis virus (VSV) vector, deleted its surface envelope protein (G protein) gene, and inserted the coding gene for the Lujo virus (LUJV) G protein (SEQ ID No. 1). We also inserted various anti-tumor enhancing factors, including GMCSF (GeneBank accession number NP_034099.2) and a single-stranded sequence of the variable region of an anti-PDL1 antibody (SEQ ID No. 13), between the M protein of the VSV vector and the G protein of the Lujo virus. After reverse genetic rescue, we obtained recombinant viruses VSV-LUJG-mGMCSF and VSV-LUJG-PDL1 ScFv. The specific virus construction and rescue methods are as described in Example 1, and the primer sequences are shown in Table 4. .
[0037] Using the CT26 mouse tumor model, and with the recombinant VSV-LUJG strain as a control, we compared the antitumor effects of VSV-LUJG-mGMCSF and VSV-LUJG-PDL1 ScFv with those of VSV-LUJG-mIFN-β. Specific experimental methods are detailed in Example 3.
[0038] Figure 5 The results showed that, compared with the VSV-LUJG recombinant virus administration group, although VSV-LUJG-mGMCSF and VSV-LUJG-PDL1 ScFv had certain anti-tumor effects, their effects were far inferior to those of the VSV-LUJG-mIFN-β administration group. The tumor growth of mice in the VSV-LUJG-mIFN-β administration group was significantly inhibited, showing a significant improvement.
[0039] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications may be made without departing from the technical solutions described in the claims.
[0040] SEQ ID NO.2 Human-IFN-β ATGACCAACAAGTGTCTCCTCCAAATTGCTCTCCTGTTGTGCTTCTCCACTACAGCTCTTTCCATGAGCTACAACTTGCTTGGATTCCTACAAAGAAGCAGCAATTTTCAGTGTCAGAAGCTCCTGTGGCAATTGAATGGGAGGCTTGAATACTGCCTCAAGGACAGGATGAACTTTGACATCCCTGAGGAGATTAAGCAGCTGCAGCAGTTCCAGAAGGAGGACGCCGCATTGACCATCTATGAGATGCTCCAGAACATCTTTGCTATTTTCAGACAAGATTCATCTAGCACTGGCTGGAATGAGACTATTGTTGAGAACCTCCTGGCTAATGTCTATCATCAGATAAACCATCTGAAGACAGTCCTGGAAGAAAAACTGGAGAAAGAAGATTTCACCAGGGGAAAACTCATGAGCAGTCTGCACCTGAAAAGATATTATGGGAGGATTCTGCATTACCTGAAGGCCAAGGAGTACAGTCACTGTGCCTGGACCATAGTCAGAGTGGAAATCCTAAGGAACTTTTACTTCATTAACAGACTTACAGGTTACCTCCGAAACTGA; SEQ ID NO.3 Mouse - IFN-β ATGAACAACAGGTGGATCCTCCACGCTGCGTTCCTGCTGTGCTTCTCCACCACAGCCCTCTCCATCAACTATAAGCAGCTCCAGCTCCAAGAAAGGACGAACATTCGGAAATGTCAGGAGCTCCTGGAGCAGCTGAATGGAAAGATCAACCTCACCTACAGGGCGGACTTCAAGATCCCTATGGAGATGACGGAGAAGATGCAGAAGAGTTACACTGCCTTTGCCATCCAAGAGATGCTCCAGAATGTCTTTCTTGTCTTCAGAAACAATTTCTCCAGCACTGGGTGGAATGAGACTATTGTTGTACGTCTCCTGGATGAACTCCACCAGCAGACAGTGTTTCTGAAGACAGTACTAGAGGAAAAGCAAGAGGAAAGATTGACGTGGGAGATGTCCTCAACTGCTCTCCACTTGAAGAGCTATTACTGGAGGGTGCAAAGGTACCTTAAACTCATGAAGTACAACAGCTACGCCTGGATGGTGGTCCGAGCAGAGATCTTCAGGAACTTTCTCATCATTCGAAGACTTACCAGAAACTTCCAAAACTGA; SEQ ID NO.4 Canine IFN-β ATGACCAGTAGATGCATCCTCCAAACAACTCTCCTGTTGTATTTCTCCACCATGGCTCTTGCCATGAGCAACGACTTGCTTCGATCCCAGCTAAGCAGCAGCAGTTTGGAGTGTCAGGAGCTCCTATTACAGTTGAATGGAACCACTGAATATTGCCTCAAGGACAGGATAAACTTCGAGATCCCTGAGGAAATCGAGAAATCACGCCAGTTCCAGAAGGAGGACATCATATTGATCACCCATGAGATGTTCCAGAAGATCTTTGATATTTTCAGGAGAAATATCTCTAGAACAGGATGGAATGAGACCACTGTCGAGAACCTTCTTGTGAAGCTCCACTGGCAGAAGGAACATCTGGAGATAATCCTGGAGGACGTCAAAGAGAAGGAAAACTTCACCTGGGACAACAGGACTCTTCTGCACCTGAAGAAATATTACTTAAGGATTGTGCAGTACCTGAAGGCCAAGGAGTACAGCATCTGTGCCTGGACAATAGTCCAAGCAGAAATCTGCAGGAACTTTTTCTTCCTTAATATACTTACAGATTATCTCCAGAACTGA; SEQ ID No.13 PDL1 ScFv ATGAAGTGCCTTTTGTACTTAGCCTTTTTATTCATTGGGGTGAATTGCGAAATTGTCCTCACTCAAAGTCCTGGAACACTCAGTCTATCCCCGGGGGAGCGGGCCACGTTAAGCTGTCGTGCATCCCAGAGGGTTTCAAGCAGCTACCTGGCGTGGTACCAGCAGAAGCCAGGCCAGGCACCCAGGTTGCTTATATATGATGCTTCTTCGAGAGCCACTGGAATTCCTGATCGCTTCTCTGGATCAGGTTCTGGGACAGACTTCACACTGACCATCTCCCGACTGGAGCCAGAAGACTTTGCTGTGTATTACTGCCAGCAATATGGCAGCCTGCCCTGGACCTTTGGGCAGGGCACCAAGGTGGAGATCAAAAGAGGAGGTGGCGGATCTGGTGGAGGGGGTAGTGGAGGAGGAGGGTCAGAAGTGCAGCTGGTGGAGAGCGGTGGTGGCCTTGTTCAGCCAGGTGGGTCTCTACGGTTGAGCTGTGCAGCGAGTGGCTTCACCTTCTCCCGATACTGGATGTCCTGGGTCAGACAAGCTCCTGGGAAAGGGCTGGAGTGGGTGGCCAACATCAAGCAGGATGGCTCTGAGAAGTATTATGTGGATTCTGTTAAAGGACGCTTCACCATTTCAAGAGACAATGCCAAGAATAGCCTCTACCTGCAGATGAACAGTCTCAGGGCAGAAGACACAGCTGTGTACTACTGCGCCAGGGAAGGAGGCTGGTTTGGAGAGCTGGCTTTTGACTATTGGGGCCAAGGAACATTAGTCACTGTATCCTCAGGAGGGGGAGGCTCAGGAGGGGGAGGCAGTGGAGGAGGAGGAAGTTTTTTCTTTATCATAGGGTTAATCATTGGACTATTCTTGGTTCTCCGAGTTGGTATCCATCTTTGCATTAAATTAAAGCACACCAAGAAAAGACAGATTTATACAGACATAGAGATGAACCGACTTGGAAAGTGA。
Claims
1. An antitumor-enhanced, non-neurotoxic VSV vector recombinant oncolytic virus, characterized in that, The G protein coding gene of the wild type VSV is replaced by the G protein coding gene of the Lujo virus by reverse genetic manipulation technique, and the gene coding the anti-tumor enhancer IFN-β is inserted on the VSV vector genome, and the self-replicating anti-tumor enhanced non-neurotoxic VSV carrier recombinant oncolytic virus VSV-LUJG-IFN-β is obtained by rescue.
2. The non-neurotoxic VSV vector oncolytic virus of claim 1, wherein, The gene coding the anti-tumor enhancer IFN-β is inserted between the M protein of the VSV virus and the G protein of the Lujo virus.
3. The non-neurotoxic VSV vector oncolytic virus according to claim 1 or 2, characterized in that, The anti-tumor enhancer IFN-β is human IFN-β, murine IFN-β or canine IFN-β.
4. The non-neurotoxic VSV vector oncolytic virus of claim 3, wherein, The gene sequence of the human IFN-β is shown in SEQ ID No. 2, the gene sequence of the murine IFN-β is shown in SEQ ID No. 3, and the gene sequence of the canine IFN-β is shown in SEQ ID No.
4.
5. The non-neurotoxic VSV vector oncolytic virus according to claim 1 or 2, characterized in that, The wild type VSV strain is the Indiana strain.
6. The non-neurotoxic VSV vector recombinant oncolytic virus according to claim 1 or 2, characterized in that, The gene sequence of the G protein coding gene of the Lujo virus is shown in SEQ ID No.
1.
7. The non-neurotoxic VSV vector oncolytic virus according to claim 1 or 2, characterized in that, The preparation method is specifically as follows: (1) constructing the VSV-LUJG-IFN-β plasmid: first inserting the VSV genome on the BAC vector, then replacing the gene sequence of the G protein on the VSV genome with the gene sequence coding the Lujo virus G protein, and inserting the gene coding the anti-tumor enhancer IFN-β between the M gene and the G protein gene of the VSV genome to obtain the pBAC-VSV-LUJG-IFN-β plasmid; (2) rescuing the recombinant virus: the first to be infected cells are infected with the vaccinia virus expressing T7 polymerase, the cells after infection are co-transfected with the pBAC-VSV-LUJG-IFN-β plasmid, the pN, pP, pL and pG plasmids, the supernatant of the diseased cells is collected 48 h after transfection, the second to be infected cells are infected with the supernatant, and the supernatant of the diseased cells is collected after amplifying the virus to obtain the VSV carrier recombinant oncolytic virus; The first to be infected cells are BHK21 cells; The second to be infected cells are Vero cells.
8. The non-neurotoxic VSV vector recombinant oncolytic virus according to claim 7, characterized in that, The mass ratio of the pBAC-VSV-LUJG-IFN-β, pN, pP, pL and pG plasmids is 10:3:5:1:3 when co-transfected.
9. The anti-tumor enhanced non-neurotoxic VSV carrier recombinant oncolytic virus according to claim 1 in the preparation of an anti-tumor drug.