Regidiapteus gifuensis venom protein gene VID and application thereof in degradation of drosophila melanogaster tissues
By using the VID gene of the parasitic wasp *Valus venomusus* to specifically degrade the adult disc tissue in fruit fly larvae, the application of parasitic wasp venom protein in biological pest control has been addressed, achieving efficient and environmentally friendly pest control and providing a new biological control method.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-11-18
- Publication Date
- 2026-03-10
AI Technical Summary
There is a lack of systematic research on the regulation of host tissue state by parasitic wasp venom protein genes and their application in biological pest control. Chemical control has led to serious problems of pesticide residues and pest resistance.
The gene VID for the venom protein of the open-armed reverse-jaw braconid wasp and its encoded venom protein were provided. The protein was synthesized by PCR amplification and applied to the body of fruit fly larvae, specifically degrading the adult disc tissue and preventing the pest from emerging as an adult.
It has achieved efficient and environmentally friendly pest control, reduced damage from non-target organisms, provided new biological control methods, and enriched the research and application of parasitic wasp venom protein genes.
Smart Images
Figure CN121628913A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the fields of molecular biology and genetic engineering, and in particular to a type of open-armed anti-mandible wasp venom protein gene VID and its application in degrading fruit fly tissue. Background Technology
[0002] Fruit flies are widely distributed in temperate and tropical climate zones worldwide. Because their primary food source is rotting fruit, they can be found in orchards, markets, and other human habitats. The fruit fly undergoes complete metamorphosis, developing from egg to adult through four stages: egg, larva, pupa, and adult. A widespread and significant agricultural pest, the fruit fly prefers to lay its eggs inside immature or nearly mature fruits. The female adult has a well-developed ovipositor capable of piercing the fruit peel to lay its eggs. After hatching, the larvae feed on the fruit pulp, leading to fruit rot, quality deterioration, and severe yield reduction. Due to the potential for chemical control to lead to pesticide resistance and residues, biological control has become an important development direction in integrated pest management systems for fruit flies. Parasitic wasps, as an important biological control agent, can effectively control the host population. Therefore, utilizing natural enemies to control fruit flies has become an increasingly important approach in integrated pest management strategies.
[0003] Traditional chemical methods of pest control have led to increasing problems such as pesticide residues, damage to non-target organisms, and pesticide resistance in pests. In contrast, biological control has advantages such as strong insecticidal properties and low susceptibility to pesticide resistance, making it a hot research topic in the field of pest control.
[0004] Parasitic wasps are an important group of parasitic insects within the order Hymenoptera. Their adult stages are free-moving, while their larval stages develop inside or outside the arthropod host. The parasitic process usually leads to the death of the host. It is estimated that parasitic insects account for about 20% of all insect species, with parasitic Hymenoptera being the most numerous, thus playing a crucial role in biological control.
[0005] Parasitic wasps inject venom proteins and other factors during parasitism. These factors have multiple functions, including regulating the host's tissue state and delaying host development, providing an important mechanism for parasitic wasps to acquire resources and avoid competition. However, systematic research on the regulation of host tissue state by parasitic wasp venom protein genes and their potential applications in biological pest control is still lacking. Summary of the Invention
[0006] The technical problem to be solved by the present invention is to overcome the shortcomings of the prior art and provide a type of open-armed anti-mandible wasp venom protein gene VID and its application in degrading fruit fly tissue.
[0007] To solve the technical problem, the solution of the present invention is:
[0008] A class of venom protein genes of the open-armed, reverse-jawed wasp are provided, named venom protein gene VID-1, venom protein gene VID-2, venom protein gene VID-3, venom protein gene VID-4 and venom protein gene VID-5, respectively, and their nucleotide sequences are shown as SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, respectively.
[0009] The present invention also provides a class of open-armed reverse-jaw braconid venom proteins, which are encoded by the aforementioned venom protein genes and respectively named venom protein VID-1, venom protein VID-2, venom protein VID-3, venom protein VID-4 and venom protein VID-5, and their respective amino acid sequences are shown in SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10.
[0010] As a preferred embodiment of the present invention, the amino acid sequence of each venom protein contains the DUF4803 domain.
[0011] The present invention also provides primer pairs for synthesizing the venom protein genes of the open-armed constrictor wasp via PCR amplification, characterized in that there are 5 primer pairs, which are used for specific localization and directional synthesis of each venom protein gene; wherein, the sequences of the upstream and downstream primers for synthesizing venom protein gene VID-1 are shown in SEQ ID NO:11 and SEQ ID NO:12; the sequences of the upstream and downstream primers for synthesizing venom protein gene VID-2 are shown in SEQ ID NO:13 and SEQ ID NO:14; the sequences of the upstream and downstream primers for synthesizing venom protein gene VID-3 are shown in SEQ ID NO:15 and SEQ ID NO:16; the sequences of the upstream and downstream primers for synthesizing venom protein gene VID-4 are shown in SEQ ID NO:17 and SEQ ID NO:18; and the sequences of the upstream and downstream primers for synthesizing venom protein gene VID-5 are shown in SEQ ID NO:19 and SEQ ID NO:20.
[0012] This invention further provides the application of the open-armed anti-mandible wasp venom protein gene in inducing the degradation of adult disc tissue in Drosophila larvae.
[0013] The present invention further provides the use of the venom protein of the open-armed reverse-jaw wasp as an active ingredient in an insecticide.
[0014] The present invention further provides a method for applying the venom protein of the open-armed reverse-jaw wasp, which is used as an active ingredient in an insecticide to specifically degrade the adult disc tissue in the body of fruit fly larvae, preventing them from emerging and thus killing them.
[0015] Description of the invention principle:
[0016] *Asobara japonica* is a dominant endoparasite on the larvae of many fruit flies. Based on genomics and proteomics research, the applicant's research team conducted extensive experiments on *Asobara japonica*, extracting venom proteins produced during parasitism, identifying and studying their biological activities, ultimately confirming a class of five venom proteins, each containing the DUF4803 domain in its amino acid sequence. This domain is abundant in the parasitic wasp's venom and can participate in host immune regulation or physiological interference. Experimental verification by the applicant showed that, due to the presence of the DUF4803 domain, these venom proteins can individually induce apoptosis in the adult disc tissue within the larvae of the fruit fly, leading to the degradation of the adult disc tissue and preventing the pest from molting. Therefore, this provides a new approach for developing novel biocontrol agents, allowing these venom proteins to be applied to agricultural or forestry pest control, providing a highly efficient and environmentally friendly alternative to chemical pesticides while reducing damage to non-target organisms.
[0017] Compared with the prior art, the beneficial effects of the present invention are as follows: In summary, the present invention includes the following beneficial technical effects:
[0018] 1. This invention reveals for the first time the regulatory function of the venom protein of the open-armed mandible wasp on the tissues of fruit fly larvae, and experimental verification shows that the venom protein can specifically induce the degradation of the host adult larvae's disc tissue.
[0019] 2. The research of this invention proves that the venom protein of the open-armed reverse-jaw braconid wasp can kill fruit flies by degrading the adult disc tissue, thus preventing them from emerging. Therefore, it has value for application in agricultural biological control.
[0020] 3. This invention provides new gene resources and theoretical guidance for the research and application of parasitic wasp venom protein genes in the industry. Therefore, the identification and utilization of parasitic wasp venom protein encoding genes proposed in this invention is of great significance for revealing the molecular mechanism of the interaction between parasitic wasps and their hosts and for promoting the biological control of pests. Attached Figure Description
[0021] Figure 1 This is the screening and identification process for the VID gene of the open-armed reverse-jawed wasp venom protein in this invention.
[0022] Figure 2 The PCR verification results are for the VID gene of the open-armed reverse-jaw brachycephalic wasp venom protein.
[0023] Figure 3 The study investigated the degradation effect of the VID gene, a venom protein gene of the open-armed reverse-jaw braconid wasp, on different adult disc tissues of the host larvae.
[0024] Figure 4 To investigate the effects of VID interference on the larval and adult disc tissues of the host (taking the winged adult disc as an example).
[0025] Figure 5 The effects of interference with five VID genes on the larval and adult disc tissues of the host (taking the winged adult disc as an example). Detailed Implementation Plan
[0026] The following describes the implementation of this invention in further detail with specific laboratory test data and practical examples. These examples are for illustrative purposes only and do not constitute a limitation on the scope of protection of this invention. Unless otherwise specified, experimental conditions are performed according to standard operating procedures or those provided by the supplier.
[0027] Implementation Case 1: Screening and Identification of the VID Gene in the Venom of a Type of Split-Armed Reverse-Jaw Wasp
[0028] 1.1 Genome and transcriptome sequencing: High-quality genome and transcriptome sequencing was performed on the open-armed reverse-jaw brachiopod, and the transcriptional expression profiles of each venom gland tissue were obtained.
[0029] 1.2 Proteomics analysis: Proteins in the venom sample were identified using liquid chromatography-tandem mass spectrometry to obtain proteomic data.
[0030] 1.3 Candidate Gene Screening: Based on a comprehensive analysis of transcriptomic and proteomic results, genes highly expressed in the venom glands and detectable in the proteome were screened. Further screening revealed genes with signal peptide structures that were validated at the protein level, which were then identified as venom protein genes.
[0031] 1.4 Functional annotation and comparison: The selected venom protein genes were annotated with their domains.
[0032] Implementation Case 2: Obtaining the full-length VID gene of a type of open-armed, reverse-jawed brachiopod venom protein
[0033] 2.1 RNA extraction
[0034] The mRNA of the open-armed reverse-mandible brachiopod venom gene was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit-BOX2 (Vazyme, Cat# RC101-01). The specific steps are as follows:
[0035] (1) Place the open-arm reverse mandible corydalis venom gland sample in a grinding tube, add 500 μL of lysis buffer, then add an appropriate amount of grinding beads, grind with a grinder for 1 min, then add 200 μL of RNase-free water, shake vigorously for 15 s, and let stand at room temperature for 5 min.
[0036] (2) Centrifuge the sample from step (1) at 12000 rpm for 15 min, and use a pipette tip to transfer about 500 μL of the sample into a new 1.5 mL centrifuge tube.
[0037] (3) Add 800 μL of Buffer RL2 to the centrifuge tube and gently blow to mix.
[0038] (4) Transfer the liquid from step 4 to an RNA elution column, centrifuge at 13000×g for 1 min, and discard the waste liquid.
[0039] (5) Place the elution column in the collection tube, add 500 μL Buffer RW1 to the elution column, centrifuge at 13000×g for 1 min, and discard the waste liquid.
[0040] (6) Place the elution column in the collection tube, add 700 μL of Buffer RW2 to the elution column, centrifuge at 13000×g for 1 min, and discard the waste liquid. Repeat this step once.
[0041] (7) Place the elution column in the collection tube, elute at 13000×g for 2 min, and discard the collection tube.
[0042] (8) Place the elution column in a new 1.5 mL collection tube, add 30 μL of RNase-free water to the central membrane zone of the elution column, place at room temperature for 1 min, and centrifuge at 13000×g for 1 min.
[0043] (9) The concentration of RNA samples was detected using a spectrophotometer and recorded. The samples were then stored in a -80°C refrigerator for later use.
[0044] 2.2 cDNA Synthesis
[0045] cDNA was synthesized using the HiScript II QRT SuperMix for qPCR (Vazyme) kit, following these steps:
[0046] (1) The amount of RNA added to the RNA sample is calculated based on adding 500 ng RNA to a 10 μL reverse transcription system.
[0047] (2) Remove genomic DNA from the sample in step (1): Add a total of 1 μg of RNA according to the RNA concentration, then add 4 μL of 4×g DNA wiper Mix, add RNase-free water to make the sample volume reach 16 μL, mix well and incubate at 42℃ for 2 min.
[0048] (3) Reverse transcription: Add 4 μL of 5×HiScript II qRT SuperMix to the sample obtained in step (2), mix thoroughly, incubate at 37°C for 15 min, and then incubate at 85°C for 5 s. Store the obtained cDNA at -20°C.
[0049] 2.3 PCR amplification of the full-length sequence of the venom protein gene VID of a class of open-armed, reverse-jawed wasp.
[0050] Design a pair of upstream and downstream primers to validate the full-length gene.
[0051] The primers used were:
[0052] SEQ ID NO:11, VID-1-F: ATGTCTCTAAAGCTGTTACTCTGTATAGC
[0053] SEQ ID NO: 12, VID-1-R: TCAATGGTTATCTTCTAACGCAGGCTC
[0054] SEQ ID NO:13, VID-2-F: ATGAGAGGGACTGGCTGGTTCATA
[0055] SEQ ID NO:14, VID-2-R: TTATGTGTTACCAACTATCATGGATACCG
[0056] SEQ ID NO: 15, VID-3-F: ATGAAAAAAATTCCGTTGGTTAAATTTCCTAAT
[0057] SEQ ID NO:16, VID-3-R: CTACGAAAGGCGTTCCTTGATGG
[0058] SEQ ID NO:17, VID-4-F: ATGCAGCTTCCACAAATATCATAGTAGTGA
[0059] SEQ ID NO: 18, VID-4-R: TGCGACATAGGTTTAATTGTGTGTCC
[0060] SEQ ID NO:19, VID-5-F: ATGCATGTATTTAATTTTTTAATAACAAT
[0061] SEQ ID NO: 20, VID-5-R: TCAGACCAGGTGACCTTTAAGTACTTC
[0062] The PCR reaction conditions were as follows: pre-denaturation at 94℃ for 2 min, denaturation at 98℃ for 15 s, annealing at 58℃ for 25 s (adjust the actual Tm value according to different primers), extension at 68℃ for 30 s (adjust the extension time according to different gene lengths), 37 cycles of amplification, extension at 68℃ for 10 min, and then isothermal at 10℃. After the reaction, it can be used directly for downstream experiments or stored at -20℃.
[0063] In the PCR reaction, a pair of upstream and downstream primers were used, and the nucleotide sequence of the resulting PCR product matched the primer pair. Specifically, using the upstream and downstream primers of SEQ ID NO:11 and SEQ ID NO:12, the nucleotide sequence of the corresponding PCR product is shown in SEQ ID NO:1; the amino acid sequence of the open-armed constrictor wasp venom protein VID-1 encoded by the corresponding gene is shown in SEQ ID NO:6. Using the upstream and downstream primers of SEQ ID NO:13 and SEQ ID NO:14, the nucleotide sequence of the corresponding PCR product is shown in SEQ ID NO:2; the amino acid sequence of the open-armed constrictor wasp venom protein VID-2 encoded by the corresponding gene is shown in SEQ ID NO:7. And so on, using suitable primer pairs according to conventional procedures to prepare different gene fragments.
[0064] Implementation Case 3: Expression Interference of the VID Gene in the Venom of a Type of Open-Armed Reverse-Jaw Wasp
[0065] 3.1 Double-stranded RNA Synthesis
[0066] Double-stranded RNA was synthesized using the T7 High Yield RNA Transcription Kit (Vazyme, Cat# TR101-02), following these steps:
[0067] (1) After designing primers to amplify the target band, the target fragment is recovered by gel extraction, ligated, transformed, and sequenced to confirm the target fragment.
[0068] (2) Synthesize the forward and reverse primers that link the T7 promoter sequence to the target band primers. Use the forward and reverse primers linked by T7, and the forward primer and the reverse primer linked by T7, respectively, to perform PCR reactions and recover the target band from the gel.
[0069] (3) After mixing the sample according to the system requirements of the kit, incubate at 37°C for 5 h to obtain two strands of one gene.
[0070] (4) Mix the two strands of a gene in a clean bench.
[0071] (5) After bathing in a 70℃ water bath for 10 min, remove the product and let it stand at room temperature for 20 min.
[0072] (6) Add 180 μL of RNase-free water to the sample from step (5), mix gently, then add a phenol:chloroform:isoamyl alcohol (25:24:1) solution, gently invert the centrifuge tube to mix the sample, and centrifuge at 12000 rpm for 15 min at 4°C.
[0073] (7) Take the supernatant into a new 1.5 mL centrifuge tube, add 200 μL isopropanol and 20 μL sodium acetate, gently invert to mix, and then place on ice for 10 min.
[0074] (8) Centrifuge at 4℃ for 12000 rpm for 30 min and discard the supernatant.
[0075] (9) Wash the precipitate with 1 mL of 70% ethanol, then centrifuge at 12000 rpm for 5 min at 4℃ and discard the supernatant. Repeat twice.
[0076] (10) The sample after being cleaned with ethanol was dried at room temperature for 5 min in a clean bench.
[0077] (11) Add 30 μL of Rnase-free water to the precipitate until the precipitate is completely dissolved.
[0078] (12) The concentration of the synthesized double-stranded RNA was determined by spectrophotometer, and the double-stranded RNA bands were detected by agarose gel electrophoresis and then stored at -80℃.
[0079] 3.2 Microinjection of double-stranded RNA
[0080] Parasitic wasps that had developed to the prepupa stage were injected with RNA expression interference using an Eppendorf FemtoJet 4i injector. Specific injection parameters were: injection pressure = 900 hPa, injection time = 0.1 s, and equilibrium pressure = 30 hPa. Each wasp was injected with 20 nL of double-stranded RNA, with GFP double-stranded RNA used as a control. After injection, the parasitic wasp larvae were transferred to 2% agar plates and cultured at 25°C. After emergence, parasitism experiments were conducted, and the degradation of the host adult wasp disc was observed through dissection.
[0081] from Figure 2As can be seen, the full-length coding sequence bands of the five VID genes obtained by PCR are single and bright, and the coding sequence lengths of the five VID genes are around 2000bp. Specifically, VID-1 is the shortest at 1557bp; while VID-2, VID-3, VID-4, and VID-5 are similar in length, at 2100bp, 1980bp, 1955bp, and 1944bp, respectively.
[0082] Implementation Case 4: Detection of Adult Disc Tissue Degradation Induced by the VID Gene in the Venom of the Split-armed Reverse-mandible Braconid Wasp
[0083] From parasitized and unparasitized *Drosophila melanogaster* larvae, adult disc tissues (wing discs, oculoanthal discs, foot discs, and halteres discs) and other tissues (including the central nervous system, salivary glands, prothymus, and female / male gonads) were obtained by dissection under a stereomicroscope. The dissected tissues were fixed in 4% polyformaldehyde for 30 min at room temperature, followed by two washes with 1×PBST (PBS containing 0.1% Triton X-100 and 0.05% Tween 20) and one wash with 1×PBS. The tissues were then mounted in ProLong Gold mounting medium containing DAPI (Invitrogen, Cat# P36935). The tissues were imaged using a Zeiss LSM800 confocal microscope.
[0084] from Figure 3 It can be seen that 24 hours after parasitism by *Braconchaetomium spp.*, significant degradation occurred in the wing discs, eye-antennae discs, leg discs, and halteres discs of the host *Drosophila melanogaster* larvae. This indicates that the venom protein components of *Braconchaetomium spp.* have the function of inducing the degradation of the host adult discs. Figure 4 It can be seen that after interfering with VID, the parasitism of *Baracus spp.* no longer causes degradation of the host adult's disc (taking the winged adult's disc as an example). From Figure 5 It can be seen that after the expression of the VID-1, VID-2, VID-3, VID-4, and VID-5 genes of the open-armed mandible wasp was interfered with, its parasitism no longer caused the degradation of the host adult's disc (taking the winged adult's disc as an example).
[0085] As can be seen from the above examples, the *VID* venom protein of the *Bracer's mandible* provided by this invention can kill fruit flies by degrading the adult disc tissue, preventing them from emerging. This has significant value for application in agricultural biological control. Therefore, based on the common understanding of those skilled in the art, the *Bracer's mandible* venom protein gene described in this invention can be applied to induce the degradation of the adult disc tissue within fruit fly larvae to achieve the ultimate goal of killing pests. Specifically, the protein prepared from the *Bracer's mandible* venom gene is used as the active ingredient of an insecticide to specifically degrade the adult disc tissue within fruit fly larvae, preventing them from emerging and thus killing them. The specific insecticide formulation can be implemented based on publicly available technologies known to those skilled in the art, and will not be elaborated upon here.
[0086] It should be noted that the above examples are merely specific embodiments illustrating the present invention and are not intended to limit the scope of this application. Obviously, the present invention is not limited to the above embodiments and can have many variations. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of this invention should be considered within the scope of protection of this invention.
Claims
1. A class of open-armed antipodal wasp venom protein genes, characterized in that, The venom protein genes are named as VID-1, VID-2, VID-3, VID-4 and VID-5, respectively, and the nucleotide sequences of each are shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, respectively.
2. A class of Ampulex venom proteins characterized in that, The venom proteins encoded by the venom protein genes of claim 1 are named as VID-1, VID-2, VID-3, VID-4 and VID-5, respectively, and the amino acid sequences of each are shown in SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9 and SEQ ID NO: 10, respectively.
3. The open-armed antipodal wasp venom protein of claim 2, wherein, Each of the venom proteins comprises a DUF4803 domain in the amino acid sequence thereof.
4. A pair of primers for amplifying the gene of the open-armed antipodal wasp venom protein of claim 1 by PCR, characterized in that, The primer pairs comprise five pairs, each of which is used for specific positioning and directional synthesis of the venom protein genes; wherein the sequences of the upstream and downstream primers for synthesizing the venom protein gene VID-1 are shown in SEQ ID NO: 11 and SEQ ID NO: 12; the sequences of the upstream and downstream primers for synthesizing the venom protein gene VID-2 are shown in SEQ ID NO: 13 and SEQ ID NO: 14; the sequences of the upstream and downstream primers for synthesizing the venom protein gene VID-3 are shown in SEQ ID NO: 15 and SEQ ID NO: 16; the sequences of the upstream and downstream primers for synthesizing the venom protein gene VID-4 are shown in SEQ ID NO: 17 and SEQ ID NO: 18; and the sequences of the upstream and downstream primers for synthesizing the venom protein gene VID-5 are shown in SEQ ID NO: 19 and SEQ ID NO:
20.
5. Use of the venom protein genes of the open-armed Fenton's antipodal wasp of claim 1 in inducing degradation of adult disc tissue in Drosophila larvae.
6. Use of the venom protein of the open-armed Fenton's antipodal wasp of claim 2 as an active ingredient of an insecticide.
7. The method of claim 2, wherein the oribatid mite venom protein is used for the treatment of a disease or disorder selected from the group consisting of: cancer, autoimmune diseases, inflammatory diseases, infectious diseases, and neurodegenerative diseases. The venom protein is used as an active ingredient of an insecticide for specifically degrading adult disc tissue in Drosophila larvae to prevent them from eclosion and thus killing them.