Application of polypeptide targeting NTRK3 gene in preparation of medicine for inhibiting growth of rhabdomyosarcoma

By downregulating NTRK3 protein expression and inhibiting the PAX3-FOXO1 fusion protein through peptide drugs targeting the NTRK3 gene, the problem of malignant progression of alveolar rhabdomyosarcoma has been solved, providing a new treatment approach to improve efficacy and prognosis.

CN121648149APending Publication Date: 2026-03-13ZHEJIANG UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-12-19
Publication Date
2026-03-13

AI Technical Summary

Technical Problem

In the existing technology, the high expression of PAX3-FOXO1 fusion protein in alveolar rhabdomyosarcoma leads to malignant progression, and NTRK3 is highly expressed in PAX3-FOXO1 fusion-positive rhabdomyosarcoma. Currently, there is a lack of effective treatments to inhibit its malignant progression.

Method used

Peptide drugs targeting the NTRK3 gene, which downregulate NTRK3 protein expression by interfering with RNA or small molecule compounds, inhibit the expression of PAX3-FOXO1 fusion protein. Entrectinib is used as an NTRK3 target inhibitor to develop a drug for the treatment of PAX3-FOXO1 fusion-positive rhabdomyosarcoma.

Benefits of technology

Significantly inhibiting the level of PAX3-FOXO1 fusion protein and weakening the cell colony-forming ability provides a new drug for the treatment of PAX3-FOXO1 fusion-positive rhabdomyosarcoma, improving efficacy and prognosis.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The invention discloses an application of a polypeptide of a targeted NTRK3 gene in preparation of a medicine for inhibiting the growth of PAX3-FOXO1 fusion positive rhabdomyosarcoma. The invention provides the application of the NTRK3 protein as a drug target to preparation of the drug for resisting malignant proliferation of the PAX3-FOXO1 fusion positive rhabdomyosarcoma for the first time. Furthermore, by down-regulating the expression of the NTRK3 gene, the clone formation capability of the PAX3-FOXO1 fused positive rhabdomyosarcoma cells is remarkably inhibited. Therefore, the invention not only discloses the application of the NTRK3 gene, but also provides a new therapeutic target for the PAX3-FOXO1 fusion positive rhabdomyosarcoma. The invention provides possibility for preparing a novel medicine for treating the PAX3-FOXO1 fusion positive rhabdomyosarcoma and improving the prognosis condition of a patient.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of pharmaceutical biotechnology, specifically the application of peptides targeting the NTRK3 gene in the preparation of drugs that inhibit the growth of rhabdomyosarcoma. It is also the application of a strategy for downregulating NTRK3 protein levels in the preparation of therapeutic drugs for fusion-positive rhabdomyosarcoma. Background Technology

[0002] Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma in children, and acinar rhabdomyosarcoma has the worst prognosis among its subtypes. Molecular pathological studies show that approximately 60% of these patients produce the PAX3-FOXO1 fusion protein. Both PAX3 and FOXO1 are transcription factors, and the PAX3-FOXO1 fusion gene consists of a PAX3 region containing a complete DNA-binding domain and a FOXO1 region containing a transactivation domain. The transactivation domain provided by FOXO1 enhances the downstream transcriptional function of PAX3, resulting in significantly enhanced transcriptional activity of the PAX3-FOXO1 fusion protein. This leads to abnormally high expression of downstream target genes, ultimately causing the malignant progression of rhabdomyosarcoma. Studies have shown that the PAX3-FOXO1 fusion protein is closely associated with a high metastatic rate and low survival rate in acinar rhabdomyosarcoma; patients with positive PAX3-FOXO1 fusions have a significantly worse five-year overall survival (39% for fusion-positive patients vs. 84% for fusion-negative patients). Therefore, the PAX3-FOXO1 fusion protein is an important target for the treatment of rhabdomyosarcoma.

[0003] Our database analysis revealed that neurotrophic tyrosine receptor kinase 3 (NTRK3) was highly expressed in PAX3-FOXO1 fusion-positive rhabdomyosarcoma, showing a significant difference compared to fusion-negative samples, suggesting that NTRK3 may play an important role in the malignant progression of fusion-positive rhabdomyosarcoma. NTRK genes (including NTRK1, NTRK2, and NTRK3) encode TRK proteins (TRKA, TRKB, and TRKC). When fused with other genes, these TRK proteins are continuously activated, driving tumorigenesis. Therefore, current research on NTRK3 mainly focuses on the treatment of NTRK3 fusion-positive patients. However, the correlation between NTRK3 and PAX3-FOXO1 fusion proteins, and whether NTRK3 can affect the progression of PAX3-FOXO1 fusion-positive rhabdomyosarcoma, has not been reported in the literature and requires further investigation. Summary of the Invention

[0004] This invention relates to the application of a polypeptide targeting the NTRK3 gene in the preparation of a drug to inhibit the growth of rhabdomyosarcoma, specifically the application of NTRK3 as a drug target in the preparation of a drug for the treatment of PAX3-FOXO1 fusion-positive rhabdomyosarcoma, with the aim of improving patient efficacy, prognosis, and survival rate.

[0005] Specifically, the drug exerts its effect by downregulating the level of the NTRK3 protein. The nucleotide sequence of the NTRK3 protein gene is shown in SEQ ID NO:1, and its amino acid coding sequence is shown in SEQ ID NO:2.

[0006] Database analysis revealed that NTRK3 was highly expressed in fusion-positive rhabdomyosarcoma, and downstream genes of PAX3-FOXO1 were significantly enriched in the NTRK3-high expression region. Western blotting and clonogenic assays further confirmed that overexpression of NTRK3 upregulated PAX3-FOXO1 protein levels, while downregulation of NTRK3 expression significantly inhibited the expression level of the fusion protein in PAX3-FOXO1 fusion-positive rhabdomyosarcoma cells and significantly weakened the cells' clonogenic ability. Particularly in the Rh30 cell line, downregulation of NTRK3 expression led to a decrease in fusion protein levels and a significant inhibition of clonogenic ability.

[0007] This invention employs interfering RNA targeting the NTRK3 gene to achieve gene knockdown and systematically investigates the role of NTRK3 knockdown in the treatment of PAX3-FOXO1 fusion-positive rhabdomyosarcoma. Experiments show that interfering RNA targeting different NTRK3 sequences (such as SEQ ID NO:4) effectively reduces NTRK3 expression and exhibits significant clonogenic inhibition in PAX3-FOXO1 fusion-positive rhabdomyosarcoma Rh30 cells. Therefore, this invention not only discloses the application of interfering RNA targeting the NTRK3 gene but also provides a novel targeted strategy for the treatment of this type of tumor.

[0008] Specifically, targeting the NTRK3 protein, various drug formulations can be developed to downregulate its expression, thereby achieving anti-tumor effects by inhibiting NTRK3 protein expression. The drug is preferably an interfering RNA targeting NTRK3, with a targeting nucleotide sequence such as SEQ ID NO:3 or SEQ ID NO:4. The aforementioned interfering RNA can effectively inhibit NTRK3 protein expression, thereby downregulating the level of the PAX3-FOXO1 fusion protein and significantly inhibiting the clonogenic ability of tumor cells.

[0009] Furthermore, this invention verified the effect of the NTRK3 target on the stability of the PAX3-FOXO1 fusion protein in PAX3-FOXO1 fusion-positive rhabdomyosarcoma xenografts. The results showed that the NTRK3 target inhibitor entrectinib had a good inhibitory effect on PAX3-FOXO1 fusion-positive rhabdomyosarcoma xenografts. This further demonstrates that the NTRK3 target inhibitor entrectinib has an inhibitory effect on the stability of the PAX3-FOXO1 fusion protein.

[0010] In summary, this invention is the first to propose that interfering RNA targeting the NTRK3 gene can be used as an effective drug for treating the malignant progression of PAX3-FOXO1 fusion-positive rhabdomyosarcoma, and has important application potential in the treatment of this type of tumor.

[0011] In addition, the therapeutic agent also includes double-stranded ribonucleic acid that can inhibit NTRK3 gene expression through RNA interference, peptides that can inhibit NTRK3 protein activity, or small molecule compounds that block NTRK3 protein function. The drug may also contain pharmaceutically acceptable excipients, such as fillers, wetting agents, binders, disintegrants, or lubricants. These excipients should effectively deliver the active ingredient without interfering with its biological activity and without toxic side effects on the host.

[0012] The drug can be prepared into liquid or solid formulations according to conventional pharmaceutical methods.

[0013] The beneficial effects of this invention are as follows: This invention provides, for the first time, a drug target using NTRK3 protein to prepare a drug against the malignant progression of PAX3-FOXO1 fusion-positive rhabdomyosarcoma. Further overexpression of NTRK3 can upregulate PAX3-FOXO1 protein levels, while downregulation of NTRK3 expression can downregulate the fusion protein levels in PAX3-FOXO1 fusion-positive rhabdomyosarcoma cells and effectively inhibit colony formation. This provides a new direction for drug development targeting the malignant progression of PAX3-FOXO1 fusion-positive rhabdomyosarcoma. This invention offers the possibility of preparing new therapeutic drugs for PAX3-FOXO1 fusion-positive rhabdomyosarcoma, improving the efficacy of treatment for patients with PAX3-FOXO1 fusion-positive rhabdomyosarcoma, and improving prognosis and survival. Attached Figure Description

[0014] Figure 1 Analysis of the GEO database revealed that the NTRK3 gene was highly expressed in fusion-positive samples, showing a significant difference compared to fusion-negative samples. Furthermore, gene enrichment analysis showed that downstream genes of PAX3-FOXO1 were mainly enriched in the NTRK3-high expression region.

[0015] Figure 2Two shRNAs targeting different NTRK3 sequences (SEQ ID NO:3; SEQ ID NO:4) were applied to the PAX3-FOXO1 fusion-positive rhabdomyosarcoma cell line Rh30. The results showed that NTRK3 was successfully knocked down, and both NTRK3 shRNAs significantly downregulated the level of PAX3-FOXO1 fusion protein.

[0016] Figure 3 ShRNAs targeting the NTRK3 sequence (SSEQ ID NO:4) were applied to the PAX3-FOXO1 fusion-positive rhabdomyosarcoma cell line Rh30. The results showed that NTRK3 was successfully knocked down and the clonogenic ability of Rh30 cells was significantly inhibited.

[0017] Figure 4 To investigate the inhibitory effect of entrectinib on fusion-positive rhabdomyosarcoma axillary xenografts in nude mice inoculated with the PAX3-FOXO1 fusion-positive rhabdomyosarcoma cell line Rh30, and to evaluate the safety of entrectinib after drug treatment. Detailed Implementation

[0018] The present invention will now be described in further detail with reference to the accompanying drawings and embodiments. The following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0019] Experimental methods not specified in the examples are generally performed under standard conditions, such as those described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0020] The application of the drug for downregulating NTRK3 protein expression described in this invention can be referenced to conventional drug formulation methods and actual development. The drug dosage form and biological agent are medically approved liquid or solid dosage forms, such as powders, injections, capsules, tablets, or oral solutions.

[0021] Example 1: The GEO database (GSE66533) was used, and the samples in the database were divided into two groups: fusion-negative samples and fusion-positive samples. Based on the NTRK3 expression values ​​in the database, the differences in NTRK3 gene expression between the two groups were compared. Results are shown below. Figure 1 (A) The results showed that NTRK3 was highly expressed in fusion-positive samples and was significantly different from that in fusion-negative samples. p<0.05 )。Samples from the GEO database (GSE66533) were divided into two groups based on mean NTRK3 expression: a high NTRK3 expression group and a low NTRK3 expression group. Gene enrichment was used to analyze the correlation between PAX-FOXO1 classical downstream genes and NTRK3 expression. Results are shown below. Figure 1 (B). The results showed that the classical downstream genes of PAX-FOXO1 were mainly enriched in the NTRK3 high expression group.

[0022] Example 2: Using synthesized oligonucleotide sequences, sequences encoding two shNTRK3 sequences were cloned into the lentiviral expression vector pLKO.1 to construct the lentiviral recombinant plasmid pLKO.1-shNTRK3. Simultaneously, a control plasmid pLKO.1-shCtrl was constructed. The correctly identified plasmids were then packaged into lentiviruses. Two shRNAs targeting different NTRK3 sequences (SEQ ID NO:3; SEQ ID NO:4) and the negative control shCtrl were introduced into Rh30 cells (from the Children's Hospital Affiliated to Zhejiang University) via lentiviral infection. Cells were harvested after 96 hours, lysed with SDS lysis buffer, and finally, the protein levels of NTRK3 and PAX3-FOXO1 were detected by Western blotting. Results are shown below. Figure 2 (A). The results showed that all of the above NTRK3 shRNAs could effectively inhibit the expression of NTRK3 protein.

[0023] The nucleotide sequences targeted by the two shRNAs are as follows: 5'-CACGGACATCTCAAGGAATAT-3' (SEQ ID NO: 3); 5'-ATGTCTACAGCACGGATTATT-3' (SEQ ID NO: 4).

[0024] The cDNA of NTRK3 was cloned into the lentiviral expression vector PCDH using molecular cloning technology to construct the lentiviral recombinant plasmid PCDH-NTRK3. After identification, the plasmid was packaged into lentivirus. PCDH-NTRK3 and the corresponding vector PCDH were introduced into Rh30 cells (from the Children's Hospital Affiliated to Zhejiang University) via lentiviral infection. On the third day after infection, cells expressing NTRK3 were selected using puromycin. Cells were lysed using SDS lysis buffer, and the protein levels of NTRK3 and PAX3-FOXO1 were detected by Western blotting.

[0025] See results Figure 2 (B). The results showed that overexpression of NTRK3 upregulated the expression of PAX3-FOXO1 protein.

[0026] Example 3: shRNAs targeting the NTRK3 sequence (SEQ ID NO:4) and the negative control shCtrl were introduced into Rh30 cells (from the Children's Hospital Affiliated to Zhejiang University) via lentiviral infection. On the fourth day after treatment, a portion of the samples were collected, lysed with 4% SDS buffer, quantified with BCA, and subjected to Western blot experiments to verify the NTRK3 knockdown effect. The remaining samples were counted using a hemocytometer, with 2×10⁻⁶ cells... 3 Cells were seeded into 6-well plates, and after colony formation, SRB staining was used to assess the cell colony-forming ability. Results are shown below. Figure 3 The results showed that the above NTRK3 shRNA had a knockdown effect and could significantly inhibit the clonogenic ability of Rh30 cells.

[0027] Example 4: To evaluate the inhibitory effect and safety of entrectinib, an NTRK3 target inhibitor, on a PAX3-FOXO1 fusion-positive rhabdomyosarcoma cell line Rh30 xenograft model, 5 million cells / 0.2 mL were seeded into the axilla of nude mice. Four groups were established: a control group, a low-dose group, a high-dose group, and a positive control group (with vincristine as a control). Seven mice were in each group. The treatment period was 2 weeks. Entrectinib was administered by gavage, and vincristine was administered by intraperitoneal injection. Tumor volume and body weight were measured daily. Tumor volume was calculated using the formula: 0.5 * length * width. 2 See results. Figure 4 The results showed that entrectinib significantly inhibited the growth of the PAX3-FOXO1 fusion-positive rhabdomyosarcoma cell line Rh30 xenograft model.

[0028] It is worth noting that the above embodiments are only some embodiments of the present invention and should not be construed as limiting the present invention. The above embodiments utilize RNA interference technology to verify that downregulation of NTRK3 gene expression can regulate the malignant proliferation of PAX3-FOXO1 fusion-positive rhabdomyosarcoma. Based on this, other techniques for regulating gene expression are also within the scope of protection of the present invention.

Claims

1. The application of an interfering RNA targeting the NTRK3 gene in the preparation of a drug to inhibit the growth of PAX3-FOXO1 fusion-positive rhabdomyosarcoma, characterized in that, The sequence targeting the NTRK3 gene is shown in SEQ ID NO:

1.

2. The application according to claim 1, characterized in that, The drug is a therapeutic agent that can knock down the NTRK3 gene.

3. The application according to claim 1, characterized in that, The nucleotide sequences of the interfering RNA targeting the NTRK3 gene are as follows: SEQ ID NO:3:5' CACGGACATCTCAAGGAATAT3' SEQ ID NO:4: 5'ATGTCTACAGCACGGATTATT3'.

4. The application according to claim 1, characterized in that, The interfering RNA targeting the NTRK3 gene inhibits the stability of the PAX3-FOXO1 fusion protein.

5. The use of a polypeptide capable of inhibiting the activity of NTRK3 protein, or a small molecule compound for blocking the function of NTRK3 protein, in the preparation of a drug for inhibiting the growth of PAX3-FOXO1 fusion-positive rhabdomyosarcoma, wherein the NTRK3 protein sequence is shown in SEQ ID NO:

2.

6. The application according to any one of claims 1-5, characterized in that, The drug is formulated in either a liquid or solid form.