Spontaneous deafness disease rat model constructed based on cytosine base editor

Abstract

The invention provides a spontaneous deafness disease rat model constructed based on a cytosine base editor. The rat model provided by the invention lays a foundation for screening a base editor human source treatment target spot for gene therapy of Gjb2V37X point mutation human hereditary deafness, delivery of AAV and other vectors to a human Gjb2 overexpression vector and a base editor, clinical drug screening and a pathogenic mechanism of point mutation deafness on a V37 site on a human Gjb2 gene.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and in particular to a rat model of spontaneous deafness constructed based on a cytosine base editor. Background Technology

[0002] Nonsyndromic hearing loss (NSHL) is a common type of hereditary hearing loss caused by genomic abnormalities that lead to lesions in the sensory or neural parts of the auditory pathway, ultimately resulting in hearing impairment. The incidence of NSHL is 4 / 10,000–8 / 10,000. It is currently recognized that over 60% of permanent hearing loss in newborns is caused by genetic factors, with 60%–70% of these cases being NSHL. NSHL manifests as moderate to severe hearing loss starting in infancy. Currently, there is no cure for NSHL. Treatment primarily involves close monitoring of hearing and the selection of speech therapy, hearing aids, and rehabilitation methods based on the degree of hearing impairment. It severely impacts the growth and education of infants and young children, placing a heavy burden on families and society.

[0003] GJB2 gene mutation is the most common cause of non-hepatic chorionic villus ileus (NSHL). In China, approximately 50% of hereditary deafness is caused by GJB2 gene mutations, and about 21% of most patients with severe or higher-degree NSHL carry this gene mutation, highlighting its importance in the research of hereditary deafness. The GJB2 gene is located at the DFNB1 locus on chromosome 13q11-q12 and encodes the Cx26 protein, which is involved in the formation of ion channels for intercellular signaling. The exact cause of NSHL due to GJB2 gene mutation is not fully understood, but two generally accepted theories exist: 1. GJB2 gene mutation leads to the loss of function of the Cx26 protein, obstructing gap junction-mediated nutrient transport, resulting in a lack of capacity in inner ear cells and causing deafness. 2. GJB2 gene mutation produces a non-functional Cx26 protein, obstructing potassium ion reflux from inner ear hair cells, leading to potassium poisoning in the organ of Corti, affecting intercellular signaling, and thus causing deafness.

[0004] The GJB2 gene mutation sites vary significantly across different countries. Notably, the p.V37I (c.109G>A) mutation also has a high incidence in Asia, with frequencies in hearing loss patients of 8.5% in Thailand, 1.75% in Japan, and 6.2% in China. Researchers are attempting to construct Gjb2 mutations in mice and rats. V37I / V37I Point mutation animal models were used for research, but it was found that homozygous mice and rats with this mutation site all experienced embryonic lethality, while Gjb2... V37I / +Both mouse and rat models showed normal hearing. Therefore, researchers currently primarily use conditional knockout mouse models (Cx26-CKO) for scientific research. However, the role of point mutation mouse and rat models in solving scientific and clinical problems is unparalleled by conditional knockout models. Summary of the Invention

[0005] The main objective of this invention is to provide a rat model of spontaneous deafness constructed based on a cytosine base editor, which has greater research value in terms of pathogenic mechanism and clinical treatment application compared with the previously reported conditional knockout mouse models.

[0006] This invention provides a rat model of spontaneous deafness constructed based on a cytosine base editor. The model is obtained by in situ base editing of the Gjb2 gene in SD rat embryonic cells using the cytosine base editor haA3A-CBE-VA to introduce the mutation site into the rat Gjb2 gene.

[0007] Preferably, the cytosine base editor screens for sgRNAs that target valine at position 37 of the rat Gjb2 gene, the nucleotide sequence of which is shown in SEQ ID NO:1.

[0008] Preferably, the amino acid sequence of the cytosine base editor haA3A-CBE-VA is shown in SEQ ID NO:2.

[0009] Preferably, the mutation site is Gjb2-Val37Met.

[0010] Preferably, the gene editing system used in the spontaneous deafness rat model includes the sgRNA, haA3A-CBE-VA mRNA, and PAM sequences.

[0011] Preferably, the PAM sequence is NGG.

[0012] Preferably, the method of using the gene editing system includes, but is not limited to: using the gene editing system to perform gene editing on rat embryonic cells, hybridizing chimeric rats F0 and WT to obtain heterozygous rats, and mating heterozygous rats to obtain homozygous rats Gjb2. V37M / V37M .

[0013] Furthermore, the cytosine base editor haA3A-CBE-VA is used in the construction of other animal, organoid, or cell models.

[0014] Beneficial effects

[0015] (1) The Gjb2 constructed in this invention V37M / V37MSome rat models exhibited spontaneous hearing loss phenotypes as early as 4 weeks of age, with some showing normal hearing and others showing hearing abnormalities. This hearing distribution pattern is similar to that observed in the human population. V37I / V37I The mutant population exhibited largely consistent hearing characteristics. This model effectively simulates Gjb2. V37I / V37I The phenotype of clinical patients can be used to conduct research on the pathogenesis of deafness at this pathogenic mutation site.

[0016] (2) The Gjb2 of the present invention V37M / V37M Rat models can be used to screen for clinical treatment of Gjb2. V37I / V37I The patient's gene editor and targets, as well as other drugs.

[0017] (3) Gjb2 of the present invention V37M / V37M Rat models can be used to conduct genetic studies, better understand the genetic variation mechanisms that cause deafness in some individuals with mutations while others do, and thus provide the possibility of developing personalized treatment strategies.

[0018] (4) The animal model of the present invention can be used for preliminary treatment and mechanism research, while avoiding ethical issues. Attached Figure Description

[0019] Figure 1 This is a schematic diagram of the sgRNA design and the genotype identification and sequencing results of this invention.

[0020] (Top: sgRNA was designed targeting the antisense strand of exon 2, where valine is located at position 37 of the rat Gjb2 gene. Red bases indicate the PAM sequence, and green bases indicate the sgRNA sequence; Bottom: The red-marked mutation sites in the figure represent the target mutation; in the sequencing peak diagram, the area within the red box is Gjb2) V37M / V37M Target mutation site in rats.

[0021] Figure 2 Wild-type at 4 weeks old and Gjb2 V37M / V37M ABR audiometry results in point mutant rats. Detailed Implementation

[0022] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. The present invention will now be described in detail with reference to the accompanying drawings and embodiments.

[0023] To enable those skilled in the art to better understand the present invention, the technical solutions of the present invention will be clearly and completely described below with reference to the accompanying drawings of the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort should fall within the protection scope of the present invention.

[0024] It should be noted that the terms "first," "second," etc., in the specification, claims, and accompanying drawings of this invention are used to distinguish similar objects and are not necessarily used to describe a specific order or sequence. It should be understood that such data can be interchanged where appropriate so that the embodiments of the invention described herein can be implemented in orders other than those illustrated or described herein. Furthermore, the terms "comprising" and "having," and any variations thereof, are intended to cover non-exclusive inclusion.

[0025] Example 1

[0026] The cytosine base editor haA3A-CBE-VA constructs Gjb2 V37M / V37M Point mutation rat model

[0027] 1. sgRNA design and screening

[0028] First, the rat Gjb2 gene sequence number (Gene ID: 394266) was located in NCBI data. Preliminary sgRNAs were obtained targeting the rGjb2 gene using an online CRISPR sgRNA design website (https: / / www.benchling.com / ). Then, multiple sgRNAs were designed based on the editing window (C5-C9 positions) characteristics of the cytosine base editor haA3A-CBE-VA (SEQ ID NO:2) and screened in 293T cells. The sgRNA with the highest editing efficiency (SEQ ID: NO:1) was used for subsequent rat model construction.

[0029] 2. Model Mouse Preparation Process

[0030] Gjb2 V37M / V37M A schematic diagram of the rat model construction strategy is shown below. Figure 1 As shown. Gene editing was performed on valine residue 37 in exon 2 of the rGjb2 gene. The specific steps are as follows:

[0031] (1) sgRNA and haA3A-CBE-VA mRNA were transcribed in vitro, and then sgRNA and haA3A-CBE-VA mRNA were prepared at a final concentration of 50 ng / μL for later use.

[0032] (2) Superovulation of embryo donor rats: donor female rats were treated with PMSG (Pregnant Mare Serum Gonadotropin), and 46 hours later were injected with hCG (Human Choroinic Gonadotrophin). They were then mated with male rats in the same cage, and the fertilized eggs were collected the next day for microinjection.

[0033] (3) After microinjecting the above haA3A-CBE-VA mixture into fertilized eggs, the embryos were transferred into the uterus of pseudopregnant female mice and the F0 generation rats were awaited to be born.

[0034] (4) Founder Rats Identification: The rats that underwent embryo transfer were born approximately 19-20 days after the surgery. About 7 days after birth, their toes (or tails) were clipped to extract DNA for PCR identification. Specific primer sequences are shown in Table 1 (rGjb2-primer-F / R primers). The PCR reaction used easyTaq enzyme, with a denaturation temperature of 95℃, an annealing temperature of 60℃, and an extension temperature of 72℃ for 35 cycles. The PCR product band size was 459 bp. After completion, the product was sent to the company for sequencing. The gene sequence of the mutant rat was then compared with the target band, and the Founder rats with the target mutation were selected for subsequent co-breeding with WT rats.

[0035] (5) After the Founder rats reach sexual maturity, they are mated with WT rats to obtain heterozygotes.

[0036] (6) Gjb2 is obtained by mating sexually mature heterozygotes with heterozygotes. V37M / V37M Homozygous. Sequencing results show Gjb2 V37M / V37M Point mutant rats were successfully constructed. Figure 1 Down).

[0037] Primers for genotyping identification in rat models are shown in Table 1.

[0038] Table 1

[0039] Primer name Primer sequence (5'→3') rGjb2-primer-F(SEQ ID NO:3) agtgccaaccatccagagga rGjb2-primer-R(SEQ ID NO:4) gatgacccggaagaagatgct

[0040] like Figure 2 As shown, for WT and Gjb2 of the same age V37M / V37M Multiple batches of point mutant rats underwent ABR audiometry tracking over several consecutive months, revealing Gjb2. V37M / V37M Starting at 4 weeks of age, the point mutant rats showed a significant increase in hearing partial pressure (DB SPL) at three frequencies: 16 kHz, 22.6 kHz, and 32 kHz compared to the WT, indicating that the model rats exhibited a significant hearing loss phenotype in these frequency bands.

[0041] The above description is merely a preferred embodiment of the present invention and is not intended to limit the invention. Various modifications and variations can be made to the present invention by those skilled in the art. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.

Claims

1. A rat model of spontaneous deafness constructed based on a cytosine base editor, characterized in that: This was achieved by using the cytosine base editor haA3A-CBE-VA to perform in situ base editing on the Gjb2 gene in SD rat embryonic cells, introducing the mutation site into the rat Gjb2 gene.

2. The rat model of spontaneous deafness according to claim 1, characterized in that: The cytosine base editor screened out sgRNAs that target valine at position 37 of the rat Gjb2 gene, and their nucleotide sequences are shown in SEQ ID NO:

1.

3. The rat model of spontaneous deafness according to claim 1, characterized in that: The amino acid sequence of the cytosine base editor haA3A-CBE-VA is shown in SEQ ID NO:

2.

4. The rat model of spontaneous deafness according to claim 1, characterized in that: The mutation site is Gjb2-Val37Met.

5. The rat model of spontaneous deafness according to claim 1, characterized in that: The gene editing system used in the spontaneous deafness rat model includes the sgRNA, haA3A-CBE-VA mRNA, and PAM sequences.

6. The rat model of spontaneous deafness according to claim 5, characterized in that: The PAM sequence is NGG.

7. The rat model of spontaneous deafness according to claim 5, characterized in that: The method of using the gene editing system includes: using the gene editing system to perform gene editing on rat embryonic cells; hybridizing chimeric rats F0 with WT to obtain heterozygous rats; and mating heterozygous rats to obtain homozygous rats. Gjb2 V37M / V37M 。 8. The application of the cytosine base editor haA3A-CBE-VA as described in claim 1 in the construction of other animal, organoid, or cell models.

Images